Author Produced

Détecter le Spirochete de la maladie de Lyme, Borrelia Burgdorferi, chez les tiques à l’aide de la PCR nichée

Biology
JoVE Journal
Biology
AccessviaTrial
 

Summary

PCR nichée est une technique sensible, spécifique et simple qui peut être appliquée aux tiques QU'ADN extraits pour sonder pour Borrelia burgdorferi, l’agent causal de la maladie de Lyme. La première expérience PCR utilise des amorces de gène-spécifique pour générer des amplicons longs, qui deviennent alors des modèles pour une réaction à l’aide d’amorces internes.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K. B., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La maladie de Lyme est une infection grave à transmission vectorielle qui est causée par la Borrelia burgdorferi sensu lato famille des spirochètes, qui sont transmis aux humains par la morsure de tiques Ixodes infectées. Le principal agent étiologique en Amérique du nord est Borrelia burgdorferi sensu stricto. Régions géographiques risque l’expansion, il est prudent de soutenir les programmes de surveillance robuste qui peuvent mesurer les taux d’infection de tiques et communiquer les résultats aux cliniciens vétérinaires et du grand public. La technique moléculaire de réaction en chaîne de polymérase imbriqués (nPCR) a longtemps été utilisée à cette fin, et il reste dans la détection de Borrelia dans les tiques et la faune de manière centrale, peu coûteux et robuste.

Cet article illustre l’application de nPCR de cocher des extraits d’ADN pour identifier les spécimens infectés. Deux indépendants cible de b. burgdorferi , gènes codant Flagelline B (graisse) et protéine de surface externe A (OspA), ont été largement utilisés avec cette technique. Le protocole implique collection tique, extraction de l’ADN, puis une première ronde de la PCR pour détecter chacune des deux Borrelia-loci spécifiques. Subséquente d’amplification génique (PCR) utilise le produit de la première réaction comme un nouveau modèle pour générer des fragments d’amplification plus petits, interne. La démarche imbriquée améliore la spécificité et la sensibilité de la PCR classique. Une tique est considérée comme positive pour l’agent pathogène lorsque des amplicons intérieures de deux gènes de Borrelia peuvent être détectées par électrophorèse sur gel d’agarose.

Introduction

La maladie de Lyme (LD) est l’infection de transmission vectorielle plus répandue dans l’hémisphère Nord, et son incidence ne cesse d’augmenter de1. Cette maladie invalidante est causée par des pathogènes de la borréliose de Lyme (LB) complexe (communément dénommée Borrelia burgdorferi sensu lato, ou s.l.), qui comprend historiquement pathogène prédominant nord-américain, B. spirocheteal Borrelia sensu stricto (s.s), en plus de b. afzelii et b. garinii, qui sont répandus dans toute l’Europe et l’Asie et sont des espèces de nouveaux pertinence clinique2,3. Ces bactéries sont transmises aux humains par la morsure de tiques infectées de Ixodes 2. Bien que les principaux vecteurs d’Amérique du Nord sont I. scapularis et I. pacificus, plusieurs espèces au sein de ce genre ne se harbor et transmettre la bactérie4. Chez l’homme, b. burgdorferi peuvent provoquer des symptômes multisystémiques touchant la peau, articulations, coeur, système nerveux, les glandes endocrines, tractus gastro-intestinal et organes internes5,6,7, 8,9,10. Le Center for Disease Control and Prevention évalue actuellement plus 300 000 nouveaux cas humains chaque année dans les États-Unis11,12. Alors que le pronostic est souvent favorable lorsque la maladie est diagnostiquée et traitée dans les premiers stades, des études ont suggéré que n’importe où entre 10 % et 60 % des patients qui ont reçu le schéma d’antibiothérapie recommandé a continué à ressentir des symptômes après le traitement cessation, dans un phénomène appelé Syndrome de la maladie de Lyme pour le traitement Post (PTLDS)13,14,15. En outre, les délais d’intervention clinique peuvent survenir par suite du manque de conscience d’une morsure de tique, présentation non spécifiques de la maladie initiale et la faible sensibilité des traditionnelles axées sur la sérologie diagnostics lorsqu’il est utilisé au début de l’infection. Incapacité à traiter rapidement et correctement permet progression de symptômes qui peut se manifester de plus en plus débilitante complications16,17. Prévention de la maladie de Lyme est donc un élément fondamental de la gestion des risques. Stratégies pour lutter contre cette menace grandissante comprennent des mesures de surveillance robuste pour indiquer la prévalence de l’agent pathogène chez les tiques et d’identifient les régions géographiques d’intérêt.

Cet article démontre l’utilité de la réaction en chaîne de polymérase imbriqués (nPCR) comme outil de dépistage moléculaire permettant d’identifier des tiques infectées. Pour augmenter la spécificité, deux gènes de Borrelia sont utilisées pour l’amplification parallèle. B la flagelline (graisse) code pour une protéine de filament principal du flagelle18, et le gène est localisé sur le chromosome linéaire unique, alors que le produit de la lipoprotéine de Outer surface protéine A (OspA) intervient dans l’intestin de la tique la colonisation, et est codé plasmide19,20. Le flux de travail se compose de collection tique, extraction de l’ADN, puis une première ronde de la PCR pour détecter les Borrelia-loci spécifiques. PCR ultérieur utilise le produit de la première réaction comme un nouveau modèle pour générer des fragments d’amplification plus petits, interne. Une tique est considéré comme positive pour Borrelia burgdorferi , lorsque des amplicons intérieures de deux gènes de Borrelia peuvent être détectées par électrophorèse sur gel d’agarose.

Fois la technique nPCR et la graisse et l’OspA gènes cibles, ont été largement utilisées pour la surveillance écologique et de la détection clinique du spirochète de Lyme depuis le début des années 1990,21,22,23 ,24,25. Avant l’élaboration de protocoles moléculaires, les tiques ont été évalués en soumettant le contenu intestinal anti -Borrelia immunofluorescence (IF) coloration, culture microbienne, ou une combinaison des deux26. Ces approches souffrent de limitations inhérentes, notamment la croissance lente et fastidieuse de Borrelia27, problèmes de performances des anticorps et l’exigence de tiques vivants pour IF traitement21. PCR a été adopté afin de fournir une identification rapide, sensible et spécifique des vecteurs infectés. Il offre des améliorations marquées sur la méthode traditionnelle, y compris une application directe indépendante de la culture pour les types divers de spécimens, comme les tiques mortes et archivées qui seraient autrement impropres pour le test21,22 . Expérimentaux imbriquée de plus améliorer la spécificité et la sensibilité de la PCR classique en employant deux ensembles distincts d’amorces gène-spécifiques dans deux séries consécutives d’amplification25,28.

Succès expérimental est critique dépend de la conception de sélection et d’amplicon gène stratégique. Pour évaluer avec précision la présence de Borrelia burgdorferi, amorces doivent détecter les agents pathogènes concernés sans réagissant avec fièvre récurrente spirochètes aussi dans le genre Borrelia . Dans le cas de la graisse, cette spécificité est obtenue en ciblant une région variable interne de la gène, plutôt que les séquences flanquantes relativement conservées qui sont partagées par diverses bactéries (Figure 1)24,29 , 30.

Figure 1
Figure 1 : la notion de nPCR, tel qu’illustré à l’aide de Borrelia FlaB gène comme cible. Les extrémités 5' et 3' du gène sont communes aux organismes au-delà Borrelia burgdorferi s.l., rendant ces régions impropres à l’évaluation spécifique des agents pathogènes causant le Lyme. En utilisant les séquences d’intérieurs moins conservée en tant que cibles d’apprêt, deux cycles de PCR sont exécutées pour détecter un amplicon final, interne. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Dans un essai de leur capacité discriminatoire, intérieur FlaB amorces ont été évaluées avec plus de 80 différents isolats de Borrelia et trouvés pour identifier uniquement celles associées à la maladie de Lyme,24. La limite inférieure de détection de nPCR a été documentée à entre six24 et dix31 bactéries de culture pure, bien que la sensibilité peut être encore améliorée en éponger l’amplicon Sud et hybridation un radiomarqué ou sonde de chimiluminescence. Les techniques de couplage permet de réduire le seuil de détection à un spirochète unique31. Par comparaison directe, PCR tour conventionnel, unprobed a été trouvé pour signaler la présence d’au moins 104 spirochètes31. Toutefois, il est à noter que la sensibilité sera plus faible lorsque vous travaillez avec des échantillons cliniques et environnementaux complexes, en raison de la présence massive d’ADN indépendant et de possibles substances inhibitrices. Ces défis peuvent être contournées en grande partie par l’utilisation de nPCR.

Malgré les progrès réalisés dans les technologies moléculaires au cours des dernières décennies, nPCR reste une technique discontinue dans les efforts de surveillance moderne. Si le soin dans la conception et l’exécution du présent protocole, c’est une approche relativement simple, puissante et adaptable pour capturer la présence d’agents pathogènes dans les tiques vectrices.

Protocol

1. isolement contre les tiques

  1. Tiques par collecte sur le terrain, ou une surveillance passive des vétérinaires et des membres du public de l’acquisition. Tiques doivent être tuées par congélation, placés dans un sac scellé et envoyé par la poste à température ambiante.
    1. À l’aide d’un formulaire de soumission, recueillir des informations sur la date et le lieu géographique de la rencontre, statut d’attachement tique, espèces hôtes et voyage l’histoire récente de l’hôte.
    2. PCR nichée étant intrinsèquement vulnérable à la contamination, s’assurer que l’espace de travail de laboratoire est mis en place pour minimiser les croix-exposition d’échantillons. Cela implique l’exécution de différents éléments du protocole en espaces distincts, dédiés bien isolés les uns des autres qui sont soigneusement nettoyés et stérilisés, et veiller à ce que tous les instruments sont exemptes de contaminants.
    3. À la réception de l’échantillon, photographier la tique et de déterminer les espèces, le stade de développement, sexe et statut d’engorgement par comparaison à une clé d’identification32 .
    4. Dans des conditions aseptiques, coupent la tique à l’aide d’une lame de rasoir stérile ou un scalpel et placer les fragments de deux tiques dans des tubes de microcentrifuge distinct.
  2. Pour extraire l’ADN total, utiliser toute méthode d’isolement qui génère un modèle compatible PCR ; Ce protocole montre une approche axée sur la chélation simple.
    1. Commencez par ajouter un volume approprié (souvent entre 50-200 µL) d’un réactif de chélation lytique au fragment de la tique. Le montant précis dépendra de l’état de taille et de l’engorgement de spécimen ; lignes directrices devraient être fournies par le fabricant. Homogénéiser à l’aide d’un pilon microtube.
    2. Incuber les échantillons dans un bain-marie à 60 ° C pendant 45 min, puis vortexer brièvement.
    3. Centrifuger les échantillons pendant 4 min à 16 276 x g (13 300 tr/min) dans une micro-centrifugeuse bureau.
    4. Transférer surnageant dans un microtube frais, étiqueté, contenant 50 µL isopropanol, mélanger par inversion et re-centrifuger comme (1.2.3).
    5. Éliminer le surnageant et rincer le granule d’ADN avec 50 µL d’éthanol 70 %.
    6. Enlever l’excès d’éthanol avec une pipette et laisser le culot à sécher à l’air à température ambiante pendant 15 minutes.
    7. Pour remettre en suspension les ADN, ajouter 50 µL de 1 mM Tris pH 7.0 et incuber les échantillons dans un bain-marie pendant 1 h à 60 ° C. L’ADN peut maintenant être conservé à-20 ° C pour des analyses moléculaires.

2. nested PCR Detection of Borrelia OspA et graisse.

Remarque : Un aperçu général des principes de la PCR et des pratiques est fourni par Lorenz, 201233.

  1. Synthétiser, ou obtenir des Borrelia gène-spécifiques internes et externes amorces. Voir le tableau 1 pour les amorces, leurs tailles respectives amplicon et températures de fusion.
Nom de l’apprêt Gène cible Séquence (5' - 3') Taille de l’amplicon Température de recuit
Graisse sur Fw Graisse gcatcactttcagggtctca 503 bp 55° C
Graisse sur Rv Graisse tggggaacttgattagcctg
Graisse en Fw Graisse ctttaagagttcatgttggag 447 bp 58° C
Graisse en Rv Graisse tcattgccattgcagattgt
OspA Out Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA Out Rv OspA caactgctgacccctctaat
OspA LF OspA acaagagcagacggaaccag 350 bp 58° C
OspA dans Rv OspA ttggtgccatttgagtcgta

Tableau 1 : Intérieurs et extérieurs amorces pour nPCR de Borrelia burgdorferiFlaB et OspA.
Dans la pratique, les amorces de graisse détecter B. burgdorferi s.s. et autre apparenté Borrelia genospecies, tandis que des amorces OspA capturent seulement de b. burgdorferi s.s. Amplification de deux locus indiquerait B. burgdorferi. s.s.

  1. Les stériliser un cabinet PCR avec UV lumière et 70 % d’éthanol.
    Remarque : Pour minimiser la contamination potentielle des échantillons, cet espace de travail doit être distincte de l’emplacement de la dissection de la tique, extraction de l’ADN et électrophorèse sur gel.
    1. Pour la première manche PCR, utiliser les amorces externes avec le modèle ADN récupéré à l’étape 1.0 ci-dessus et mis en place le mélange réactionnel, tel que décrit dans le tableau 2. En parallèle, effectuer positif contrôle exécute consistant en vérifié Borrelia ADN et contrôle négatif exécute notamment les réactions non-modèle pour détecter la contamination réactif et aérosols. Ajouter l’ADN à l’extrémité pour minimiser le risque de contamination de réactifs. S’assurer que chaque tube est fermé en tout temps lorsque les réactifs ne sont pas ajoutés et fermer les tubes immédiatement après l’addition de l’ADN, et avant que les autres tubes sont ouverts.
    2. Programmez un thermocycleur comme suit : 95 ° C pendant 5 min ; 40 cycles de 95 ° C pendant 15 s, recuit température pendant 30 s, 72 ° C pendant 45 s ; 72 ° C pendant 5 min ; maintenez à 4 ° C.
  2. Effectuer la deuxième série de PCR semblable à la première réaction, sauf utiliser les amorces internes avec 2 µL du premier produit PCR (produit à la section 2.2.2).
    NOTE : Volumes de réaction sont encore fournis dans le tableau 2. Il faut pour éviter la contamination croisée des amplicons en veillant à ce que l’ADN modèle est ajouté en dernier et que les seuls tubes correspondant à un échantillon sont ouverts à la fois.
     
    Composant PCR # 1 Volumes PCR # 2 Volumes
    Taq polymérase Master Mix 2 X 12,5 ΜL 12,5 ΜL
    Eau exempte de nucléase 8,5 ΜL 8,5 ΜL
    10 µM amorces marche avant et arrière Amorces externe 1,0 µL Amorces internes 1,0 µL
    Matrice d’ADN µL 2.0, de l’extraction de l’échantillon (1.2.7) µL 2.0, du 1er cycle de PCR (2.2.2)
    Tableau 2 : Mélanges de réaction PCR pour les premiers et deuxième amplifications.
     
    1. Programmer le thermocycleur comme avant, mais régler la température de recuit pour accommoder les amorces internes (voir tableau 1).

3. imagerie et électrophorèse sur Gel d’Agarose

Remarque : Pour les instructions de base sur la séparation de l’ADN par électrophorèse, voir Lee et al., 201234.

  1. Préparer un gel d’agarose à 1.2 % en utilisant 20 X SB buffer (0,2 M NaOH, 0,8 M acide borique pH 8), dilué à 1 X et ajouter environ 5 µL de la tache de l’ADN, avant de verser, si avant une coloration du gel est souhaitée.
  2. Charger 10 µL du produit de la seconde réaction PCR (interne) de chaque expérimentale et échantillon de contrôle, aux côtés d’une échelle de bp 100 (5 µL).
    1. ELECTROPHORESE pendant 1 h à 107 V (5 v/cm).
  3. Visualiser et documenter le gel à l’aide d’un Transilluminateur et associé de caméra et un logiciel.

Representative Results

nPCR est une approche élégante, d’augmenter la spécificité et la sensibilité de détection des pathogènes, particulièrement lorsque les échantillons environnementaux complexes sont incriminés. Comme illustré à la Figure 1, deux cycles de PCR ciblant une région stratégique du Borrelia FlaB locus (et OspA, non illustré) peuvent signaler la présence de la bactérie Borrelia burgdorferi grâce à la génération de la court intérieure amplicons. Lorsque résolu par électrophorèse sur gel, les graisse et OspA produits de réaction de chaque graduation peuvent être visuellement a marqué et comparés à des contrôles. Dans la Figure 2, identificateurs unique spécimen sont prévus le long de la partie supérieure de chaque gel et contrôles non-modèle et aérosols sont représentés à gauche et à droite, respectivement, adjacents à des échelles.

Amplicon robuste bandes sont clairement visibles dans certains échantillons expérimentaux, et ils sont facilement distingués des amorces excédentaires et l’ADN résiduel (Figure 2). Basé sur les principes de conception expérimentale, une tique est considéré comme positive pour Borrelia en parallèle des contrôles négatifs ne montrent aucune amplification et amplicons intérieures proviennent des amorces de la graisse et l’OspA . Dans ce cas, spécimens T907 T604 et T606 correspond aux critères de surveillance de l’agent pathogène de Lyme (Figure 2). By Contrast, T923 n’était positif pour l' OspA, un résultat pour lequel il y a plusieurs explications possibles : A) la tique d’origine a été négative pour Borrelia, mais la préparation extérieure ou intérieure de OspA PCR a été faussement contaminée par modèle ADN (Notez que la contamination systémique des réactifs a été écartée par l’intermédiaire du contrôle négatif), B) la tique conduites Lyme Borrelia, mais modèle faibles montants ou les erreurs expérimentales ont empêché l’amplification de la graisse, ou C) un organisme était présent qui contient la séquence de OspA conservée, mais manquait de flagelline ou avait une identité insuffisante dans la région ciblée de graisse de recuire pour les amorces. En effet, les similitudes de séquences OspA ont été relevées dans une variété d’organismes, y compris les plantes et les animaux28. La situation inverse, amplification des plus conservé le gène de la flagelline , mais pas le gène de l’OspA , pourrait indiquer une espèce apparentée de Borrelia . Dans la pratique, ce protocole donne des résultats positifs single OspA plus que ne le font les amorces de graisse , ce qui suggère que le scénario « A » est l’explication la moins probable. Sans plus loin l’analyse expérimentale du spécimen litigieux, cependant, il n’est pas possible de déterminer la source du résultat positif unique. Augmentation du nombre de réplicats techniques effectuées sur des échantillons équivoques peut aider à concilier leur véritable statut, puisque tous les contaminants qui ont été faussement présentés aux réactions précédentes ne serait pas présents dans l’ADN archivé. Toutefois, si des réactions subséquentes avec ces amorces ne parviennent pas à fournir des résultats concluants, autres locus Borrelia puissent être examinés par PCR. Amplicons générés par ces réactions puissent également être séquencé et comparées entre les isolats afin d’assigner l’identité et estimer le degré de divergence de la souche. SAPI et ses collaborateurs fournissent un exemple de ce flux de travail à l’aide d’échantillons cliniques humains35.

Tous les facteurs pris en compte, les critères décrits de protocole et l’interprétation ont été estimées à produire des fausses positifs et de fausses négatifs taux de 0,17 % et 0,0063 %, respectivement.

Figure 2
Figure 2 : Détection de Borrelia burgdorferi chez les tiques individuels par nPCR de FlaB et OspA. Codes assignés à chaque graduation sont représentées dans la partie supérieure des gels et identités aligneraient verticalement pour signaler la détection de l’OspA et graisse dans chaque échantillon. Lanes intitulé B à gauche des contrôles d’image représentent non-modèle, alors qu’un (voies de droite) sont des contrôles d’aérosol pour capturer la contamination de l’environnement de laboratoire. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

Au fil des décennies d’utilisation, techniques basées sur la PCR ont constamment prouvé leur valeur dans la détection des Borrelia de spécimens arthropodes et chez les mammifères, si Borrelia proviennent d’origines environnementales ou cliniques. PCR offre de nombreuses améliorations sur des approches préexistants à la surveillance. Notamment, il n’est pas tributaire de l’élaboration et l’exécution de réactifs d’anticorps et au lieu de cela, peut être facilement adapté pour détecter les nouvelles cibles d’intérêt simplement en modifiant les séquences d’amorces. PCR accueille également l’évaluation de plusieurs loci en parallèle, soit individuellement, soit par une réaction de multiplexe. Il peut être appliqué aux entrées de divers spécimens, y compris les tiques frais et archivées22, animal ou humains fluides corporels et tissus réséqués25. PCR permettent également d’obtenir les amplicons qui peuvent être traitées ultérieurement, par exemple par enzyme de restriction digestion, hybridation de la sonde ou le séquençage, à éclairer une augmentation sur identité microbienne21.

Comme un outil clinique, PCR est théoriquement préférable au diagnostic sérologique standard, car il fournit une indication directe de la présence bactérienne, plutôt que de compter sur la réponse immunitaire de l’hôte comme une mesure secondaire de l’infection. Toutefois, la borréliose de Lyme est associée à une charge microbienne relativement modeste (< 50 organismes/mL d’urine ou de plasma) et spirochetemia transitoire, qui peut donner lieu à faux négatif résulte25. La sensibilité de cette technique à la clinique varie considérablement selon le type de tissu, stade de l’infection et l’état de l’échantillon, se situant entre 12,5 % et 62 % dans les études existantes du sang, liquide céphalorachidien et tissus biopsiés36. Limites de sensibilité moléculaires ne sont pas une préoccupation si la PCR est entrepris à la suite de la culture bactérienne, mais la récupération de spirochètes viables à partir des échantillons cliniques s’est avéré difficile de même. Que récemment les protocoles ont été optimisés pour plus de rendement35. Pendant ce temps, le tube digestif d’une tique adulte infecté peut abriter en moyenne n’importe où de 2 000 au plus 50 000 Borrelia37,38,39, qui est solidement dans la plage de détection du nPCR. Ainsi, le protocole est bien adapté aux efforts de surveillance de tiques.

Malgré ses nombreux avantages, nPCR pose certains défis et la capacité de cette technique de signaler précisément infection tique dépend donc de la sélection stratégique des gènes et des amplicons, méticuleux workflows expérimentales qui récupérer l’ADN de qualité d’après des échantillons tout en minimisant les croix-exposition des échantillons et l’utilisation des contrôles appropriés qui peuvent signaler des contaminants dans l’environnement de laboratoire et des réactifs. Avant toute expérimentation, la portée et les intentions de l’enquête devraient être clairement définies afin que les locus génétiques appropriées et les régions qui y sont, peuvent être sélectionné. Si l’objectif est de fournir un écran non biaisé pour la s.l. causant le Lyme Borrelia burgdorferi complexes, des amorces doivent être créées pour détecter toutes les souches associées avec une affinité semblable et efficacité de l’amplification, sans capture sans rapport avec les organismes25. Nouvelles amorces peuvent être conçues et mises en recouvrement en silico à l’aide d’outils logiciels tels que Primer-BLAST40, bien qu’ils doivent également être validées expérimentalement contre le standard de référence isole avant d’être appliqué aux échantillons indéterminés. L’objectif de la procédure d’extraction de l’ADN est de récupérer le modèle microbienne intacte auprès d’un échantillon d’environnement mixte (tique homogénat). Une étape facultative avant de procéder à la PCR est d’évaluer l’intégrité de l’ADN extrait. En outre, réactions parallèles pourraient être mises en place pour cibler un gène de ménage chez la tique. Cette dernière méthode peut également indiquer la présence d’inhibiteurs dans le mélange réactionnel, fournissant une plus grande confiance que les réactions négatives de Borrelia sont en raison de l’absence de l’organisme et non à la présence d’un contaminant inhibitrice.

La sensibilité accrue de la démarche imbriquée de la PCR se fait aux dépens de contamination potentielle qui génère des résultats faussement positifs. Modèle exogène pourrait être introduit à un échantillon au cours de la dissection de la tique et récupération de l’ADN, ou dans le processus de mise en place des réactions d’amplification interne et externe. Il est donc particulièrement important de suivre les meilleurs protocoles de pratique pour l’ACP afin d’éviter le modèle ou l’amplicon contamination croisée. Ceux-ci incluent l’utilisation de stations de travail distinctes avec des débits indépendants, confinement en PCR et enceintes de sécurité biologique le cas échéant, approfondie chimique et physique de nettoyage et stérilisation des surfaces et des réactifs et la gestion prudente de l’ADN 41. contrôles non-modèle sont également vitales dans l’identification de la contamination des réactifs stocks. Une vulnérabilité particulière de nPCR est l’amplicon manipulation qui se produit lorsque les produits de la première réaction lors du transfert vers le deuxième navire PCR. Puisque l’ADN cible a déjà fait l’objet d’enrichissement exponentiel dans les échantillons positifs, cette étape est particulièrement sujette à la contamination croisée, et un seul tube nPCR protocole a été développé afin de contourner cette limitation. Dans cette approche, les deux ensembles d’amorces pour un gène donné sont additionnées d’un tube à essais qui reste scellé pour les deux tours de PCR31. Les paires d’amorces internes et externes doivent être thermodynamiquement différents, tels que le couple externe amplifie modèle à une haute température de recuit qui est prohibitive pour les amorces internes. Au second tour, la température de recuit est abaissée pour tenir compte de la paire interne. Non seulement cela contourne une étape potentiellement confondant, il permet aussi l’utilisation d’autres mesures de lutte contre la contamination31,42. Toutefois, cette modification peut sacrifier certaines sensibilité. Quel que soit l’approche, augmentant le nombre de réplicats techniques exécutées de façon autonome sur un échantillon aidera à identifier la contamination parasite.

Techniques moléculaires ont continué à évoluer depuis l’introduction du nPCR, et ces nouvelles approches offrent des avantages certains sur les conceptions originales, quoiqu’en augmentation des charges financières. Comme son nom l’indique, PCR quantitative (qPCR ou real time (RT)-PCR) permet pour le dénombrement des agents pathogènes dans un échantillon, tandis que les techniques conventionnelles sont qualitatives nature43. La sensibilité de qPCR est aurait été semblable à celle de nPCR38, bien qu’il peut fluctuer selon l’apprêt caractéristiques28. Une variation de qPCR qui utilise les balises moléculaires (MB) à la place des sondes TaqMan conventionnelles s’est montré aussi prometteur dans la détection de Borrelia dans les échantillons cliniques44,45,46. En raison de leur structure secondaire unique, molecular beacons produisent aurait été plus faible fluorescence de fond et des signaux supérieurs légitimes, permettant ainsi de sensibilité supérieure47. Les évaluations précliniques suggèrent un seuil de détection de potentiel d’entre un et dix spirochètes44,45. Par ailleurs, la technique a été appliquée avec succès dans des réactions multiplexes à détecter simultanément un mammifère hôte gène44 et autres agents pathogènes transmis par des tiques45, qui n’est pas aussi facilement réalisable avec nPCR. Autres modifications de conception incluent la technologie numérique gouttelette PCR (ddPCR), qui permet de quantifier l’ADN sans l’utilisation d’une courbe d’étalonnage39,48. La limite inférieure de détection de cette technique pour Borrelia est également une dizaine de spirochètes/échantillon39. Par rapport aux nPCR, ces approches ont aussi l’avantage de réduire les risques de contamination, car ils n’ont besoin que d’un protocole unique d’amplification.

Si l’objectif de la surveillance est plutôt pour profiler le contenu bactérien varié d’une tique, dépistage de métagénomique ARNr 16 s est une option attrayante49. Bien que cette approche est plus coûteuse et nécessite des séquenceurs d’ADN spécialisés non trouvés dans tous les laboratoires de biologie moléculaire nécessite plus sophistiquée interprétation basée sur la bio-informatique, il peut capturer un large éventail de microbes à plus précisément représenter la charge pathogène du vecteur.

Tandis que qPCR et ses dérivés sont des méthodes de choix pour les applications quantitatives, et métagénomique écrans offrent de vastes inventaires du microbiome tique, une surveillance ciblée des efforts sont préoccupent souvent binaire de signalement de la présence ou l’absence de un ou plusieurs agents pathogènes dans un vecteur. Dans de telles circonstances, ces approches nouvelles, plus élaborées peuvent introduire une complexité inutile et charge financière dans le processus. Pour ces raisons, nPCR a résisté à l’épreuve du temps comme une technique pivotale en tique test.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Les auteurs tiennent à remercier Kami Harris pour la conception d’amorce, Ashley McKibbon et Jessica Thomas-Ebbett pour le tournage et John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck et Rosie le chien pour ses apparitions dans le vidéo. A. M. K. a été soutenu par la Fondation canadienne de recherche de la maladie de Lyme, et le projet a été financé par les Sciences naturelles et génie conseil recherche du Canada (CRSNG). M. K. B. W. reçu un salaire financement de la Fondation de l’Innovation Nouveau-Brunswick (FINB).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics