Author Produced

Oppdage sykdommen Lyme spiroketen, Borrelia Burgdorferi, i flått bruke nestede PCR

Biology
 

Summary

Nestede PCR er en følsom, spesifikk og enkel teknikk som kan brukes å sjekke DNA ekstrakter for å undersøke for Borrelia burgdorferi, forårsaker agent av Lyme sykdom. Første PCR eksperimentet bruker gen-spesifikke primere for å generere lange amplicons, som da blir maler for en påfølgende reaksjon med interne primere.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lyme sykdom er en alvorlig vektor-borne infeksjoner som er forårsaket av Borrelia burgdorferi sensu lato familie Spiroketer, som overføres til mennesker ved bitt av infisert Ixodes flått. Den primære paranoid agenten i Nord-Amerika er Borrelia burgdorferi sensu narkotikaprosjekter. Som geografisk risiko områder utvide, er det klokt å støtte robuste overvåking-programmer som kan måle tick infeksjon priser og kommunisere funn klinikere, veterinarians og allmennheten. Molekylær teknikken for nestede polymerasekjedereaksjons (nPCR) har lenge vært brukt til dette formålet, og det er fortsatt et sentralt, rimelig og robust tilnærming i deteksjon av Borrelia både flått og dyreliv.

Denne artikkelen viser bruk av nPCR for å sjekke DNA ekstrakter å identifisere infiserte prøver. To uavhengige B. burgdorferi mål, gener koding Flagellin B (FlaB) og ytre overflaten protein A (OspA), har vært brukt mye med denne teknikken. Protokollen innebærer kryss samling, DNA utvinning og en innledende runde med PCR å oppdage hver av de to Borrelia-spesifikke loci. Etterfølgende polymerasekjedereaksjons (PCR) bruker produktet av den første reaksjonen som en ny mal for å generere mindre, interne forsterkning fragmenter. Kjedede tilnærming forbedrer på både spesifisitet og følsomhet for konvensjonelle PCR. En hake anses positivt for patogen når indre amplicons fra både Borrelia gener kan oppdages av agarose gel geleelektroforese.

Introduction

Lyme sykdom (LD) er den mest utbredte vektor-borne infeksjonen på den nordlige halvkulen, og frekvensen sin fortsetter å øke1. Denne ødeleggende sykdommen er forårsaket av spirocheteal patogener i den Lyme borreliose (LB) komplekse (ofte referert til som Borrelia burgdorferi sensu lato eller s.l.), som historisk består av dominerende nordamerikanske patogen, B. burgdorferi sensu narkotikaprosjekter (SS), i tillegg til B. afzelii og B. garinii, som er utbredt over hele Europa og Asia, og arter av nye kliniske relevans2,3. Disse bakterier overføres til mennesker ved bitt av infiserte Ixodes flått2. Selv om de viktigste nordamerikanske vektorene I. scapularis og I. pacificus, er flere arter i denne slekten funnet til havn og overføre bakterie4. Hos mennesker, kan B. burgdorferi forårsake multisystem symptomene påvirker hud, ledd, hjerte, nervesystemet, endokrine kjertler, fordøyelsessystemet og indre organer5,6,7, 8,9,10. Center for Disease Control og Prevention anslår øyeblikket over 300.000 nye menneskelige tilfeller årlig i USA11,12. Mens prognose er gunstig når sykdommen diagnostisert og behandlet i de tidlige stadiene, har studier antydet at hvor som helst mellom 10% og 60% av pasienter som fikk den anbefalte antibiotikumet område fortsatte å symptomer etter terapi opphør, kalt i et fenomen innlegget behandling Lyme sykdom syndrom (PTLDS)13,14,15. Videre kan forsinkelser i klinisk intervensjon oppstå som følge av mangel på bevissthet om et flåttbitt, uspesifisert presentasjon av den første sykdommen, og lav følsomheten av tradisjonelle serologi-baserte diagnostikk når ved utbruddet av infeksjonen. Unnlatelse av å behandle raskt og riktig kan symptom progresjon som kan i stadig mer ødeleggende komplikasjoner16,17. Lyme sykdomsforebygging er derfor en hjørnestein i risikostyring. Strategier for å bekjempe denne økende trussel inkluderer robust overvåking tiltak for å angi patogen prevalensen flått og identifisere geografiske områder av bekymring.

Denne artikkelen viser nytten av nestede polymerasekjedereaksjons (nPCR) som molekylær screening verktøyet å identifisere infisert flått. For å øke spesifisitet, brukes to Borrelia gener for parallell forsterkning. Flagellin B (FlaB) koder et større filament protein flagell18, og genet ligger i enkel lineær kromosomet, mens lipoprotein produktet ytre overflaten protein A (OspA) formidler tick midttarmen kolonisering, og plasmider-kodet19,20. Arbeidsflyten består av tick samling, DNA utvinning og en innledende runde med PCR å oppdage Borrelia-spesifikke loci. Etterfølgende PCR bruker et produkt av den første reaksjonen som en ny mal for å generere mindre, interne forsterkning fragmenter. En hake er vurdert positivt for Borrelia burgdorferi når indre amplicons fra både Borrelia gener kan oppdages av agarose gel geleelektroforese.

Både det nPCR teknikken, og FlaB og OspA gene mål, har vært mye brukt for økologiske overvåking og klinisk påvisning av Lyme spiroketen siden tidlig på 1990-tallet21,22,23 ,24,25. Før utviklingen av molekylære protokoller, ble flått vurdert av utsette gut innholdet antiBorrelia immunofluorescence (hvis) flekker, mikrobielle kultur eller en kombinasjon av disse26. Disse tilnærmingene, lider av iboende begrensninger, inkludert langsom vekst og kresne natur Borrelia27antistoff ytelsesproblemer og kravet til live flått for hvis behandlingen21. PCR ble vedtatt for å gi rask, følsom og bestemt identifikasjon av infiserte vektorer. Det tilbys merket forbedringer over den tradisjonelle metodikken, inkludert kultur-uavhengig direkte søknad til ulike prøven typer, som døde og arkiverte flått som ellers ville være uegnet for testing21,22 . Nestede eksperimentell design ytterligere forbedre på spesifisitet og følsomhet for klassisk PCR ved å bruke to adskilt apparater av gen-spesifikke primere i to påfølgende rundene forsterkning25,28.

Eksperimentell suksess er kritisk avhengig av strategisk genet utvalg og amplicon design. For å nøyaktig beregne tilstedeværelsen av Borrelia burgdorferi, skal primere oppdage relevant patogener uten cross-reacting med symptomer Spiroketer også i Borrelia slekten. I tilfelle av FlaB, er denne spesifisitet oppnådd ved å målrette en variabel interne region av genet, i stedet for den relativt bevarte flankemanøveren sekvenser som deles av ulike bakterier (figur 1)24,29 , 30.

Figure 1
Figur 1: konseptet med nPCR, som illustrert ved hjelp av Borrelia FlaB genet som mål. 5' og 3 termini av genet er felles for organismer utover Borrelia burgdorferi s.l. gjengi disse regionene uegnet for bestemte vurdering av Lyme-forårsaker patogener. Bruker mindre-bevart interiør sekvensene som primer mål, utføres to rundene PCR for å oppdage en endelige, intern amplicon. Klikk her for å se en større versjon av dette tallet.

I en test av diskriminerende kapasiteten, interiør FlaB primere evaluert med over 80 forskjellige Borrelia isolerer, og fant for å identifisere bare de forbundet med Lyme sykdom24. Den nedre grensen for nPCR påvisning er dokumentert på mellom seks24 og ti31 bakterier fra ren kultur, selv om følsomhet kan forbedres ytterligere ved Southern blotting amplicon og hybridizing en radiolabelled eller chemiluminescent sonde. Kopling teknikker reduserer oppdagelsen terskelen til en enkelt spiroketen31. Direkte sammenligning, ble konvensjonelle, unprobed ett-runde PCR funnet for å rapportere tilstedeværelsen av minst 104 Spiroketer31. Det bemerkes imidlertid at analysen følsomhet vil være lavere når du arbeider med komplekse miljømessige og klinisk eksempler av overveldende urelaterte DNA og potensielle hemmende stoffer. Disse utfordringene kan omgås hovedsakelig ved bruk av nPCR.

Til tross for fremskritt i molekylær teknologier i de siste tiårene fortsatt nPCR en stift teknikk i moderne overvåking innsats. Hvis forsiktig i utformingen og gjennomføring av denne protokollen, er det en kraftig, tilpasningsdyktige og relativt enkel tilnærming til fange tilstedeværelse av patogener i kryss vektorer.

Protocol

1. DNA isolasjon fra flått

  1. Erverve flått via feltet samling eller passiv overvåking fra veterinarians og allmennheten. Flått bør være drept av frysing, plassert i en forseglet pose, og sendt ved romtemperatur.
    1. Bruker et Sendeskjema, samle informasjon om dato og geografisk plassering av møtet, tick vedlegg statusen, vert arter og siste kjøreloggen verten.
    2. Siden nestede PCR er iboende sårbare for forurensning, sikre at laboratoriet arbeidsområdet er konfigurert å minimere kryss-eksponering av prøver. Dette innebærer utfører ulike elementer av protokollen i egen, dedikert områder godt isolert fra hverandre som er grundig rengjøres og steriliseres, og sikrer at alle instrumenter er fri for forurensning.
    3. Ved mottak av prøven, fotografere haken og bestemme arter, utviklingsstadiet, sex og Overfylling status sammenligning en identifikasjon nøkkel32 .
    4. Under aseptiske forhold, halvere kryss med en bakteriefri barberblad eller skalpell og plassere to kryss fragmenter i separate microcentrifuge rør.
  2. Til ekstrakt totale DNA, bruke noen isolasjon prosedyre som gir PCR-kompatible malen. denne protokollen demonstrerer en enkel chelation tilnærming.
    1. Begynn med å legge til en riktig volum (ofte mellom 50-200 µL) på en lytisk chelation reagens til tick fragment. Det spesifikke beløpet avhenger av prøven størrelsen og Overfylling statusen. retningslinjer bør gis av produsenten. Homogenize bruker en microtube støter.
    2. Inkuber prøver i et vannbad ved 60 ° C i 45 min og vortex kort.
    3. Sentrifuge prøver for 4 min 16,276 x g (13,300 rpm) i en stasjonær microcentrifuge.
    4. Overføre nedbryting til en frisk, merket microtube som inneholder 50 µL isopropanol, blanding av inversjon og re sentrifuge som (1.2.3).
    5. Dekanter nedbryting, og skyll DNA pellets med 50 µL av 70% etanol.
    6. Fjern overflødig etanol med en pipette, og tillate pellets til air-dry i 15 min ved romtemperatur.
    7. Resuspend DNA, legge til 50 µL av 1 mM Tris pH 7.0 og ruge prøver i et vannbad 1t på 60 ° C. DNA kan nå lagres på 20 ° C for fremtidige molekylær analyse.

2. nestede PCR påvisning av Borrelia OspA og FlaB.

Merk: En oversikt over de generelle PCR prinsipper og praksis tilbys av Lorenz, 201233.

  1. Syntetisere eller få Borrelia gen-spesifikke ytre og indre oligonucleotide primere. Se tabell 1 for primer sett, respektive amplicon størrelser og smeltingen temperaturer.
Primer navn Genet målrette Sekvens (5 - 3') Amplicon størrelse Avspenning temperatur
FlaB ut Fw FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB ut Rv FlaB tggggaacttgattagcctg
FlaB i Fw FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB i Rv FlaB tcattgccattgcagattgt
OspA ut Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA ut Rv OspA caactgctgacccctctaat
OspA i Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA i Rv OspA ttggtgccatttgagtcgta

Tabell 1: Indre og ytre primere for nPCR av Borrelia burgdorferiFlaB og OspA.
I praksis FlaB primerne oppdage B. burgdorferi SS og andre nært beslektet Borrelia genospecies, mens OspA primere registrerer bare B. burgdorferi SS. forsterkning fra begge loci indikerer B. burgdorferi. SS

  1. Pre sterilisere PCR regjering med UV lys og 70% etanol.
    Merk: For å redusere potensielle eksempel forurensning, bør arbeidsområdet være forskjellig fra plasseringen til aksemerker disseksjon, DNA utvinning, og gel geleelektroforese.
    1. For det første PCR løp, bruke ytre primerne sammen med malen DNA utvinnes i trinn 1.0 ovenfor, og angi reaksjonsblandingen som beskrevet i tabell 2. Parallelt, utføre positiv kontrollen kjører bestående av bekreftet Borrelia DNA, og negativ kontroll kjører inkludert nei-mal reaksjoner å oppdage reagens og aerosol forurensning. Legge til DNA på slutten for å redusere potensielle forurensning av reagenser. Kontroller hver rør er stengt hele tiden når reagenser legges ikke og lukke rør umiddelbart etter DNA og før andre rør åpnes.
    2. Programmet en termisk cycler som følger: 95 ° C i 5 min; 40 sykluser av 95 ° C for 15 s, annealing temperatur for 30 s, 72 ° C i 45 s; 72 ° C i 5 min; og holde på 4 ° C.
  2. Utføre den andre runden av PCR lik den første reaksjonen, men indre primere med 2 µL av første PCR produktet (produsert i 2.2.2).
    Merk: Reaksjon volumene finnes igjen i tabell 2. Man må være forsiktig å unngå kryss-kontaminering av amplicons ved å sikre at malen DNA legges siste og at bare rør tilsvarer ett utvalg er åpne samtidig.
     
    Komponent PCR # 1 volumer PCR # 2 volumer
    Taq Polymerase Master Mix 2 X 12.5 ΜL 12.5 ΜL
    Nuclease-fritt vann 8,5 ΜL 8,5 ΜL
    10 µM forover og bakover grunning 1.0 µL ytre primere 1.0 µL indre primere
    DNA mal 2.0 µL, fra prøve utvinning (1.2.7) 2.0 µL, runde 1 av PCR (2.2.2)
    Tabell 2: PCR reaksjon blandinger for første og andre amplifications.
     
    1. Programmere den termiske cycler som før, men justere annealing temperaturen til indre primerne (se tabell 1).

3. Agarose Gel gelelektroforese og bildebehandling

Merk: Grunnleggende instruksjoner om skille DNA av geleelektroforese, se Lee et al., 201234.

  1. Forberede en 1,2% agarose gel med 20 X SB buffer (0,2 M NaOH, 0,8 M borsyre pH 8), utvannet til 1 X, og Legg ca 5 µL av en DNA flekken, før helle, hvis pre farging av gel.
  2. Last 10 µL av produktet fra andre (indre) PCR reaksjonen fra hver eksperimentelle og kontroll prøven, sammen med en 100 bp stige (5 µL).
    1. Electrophorese 1t på 107 V (5V/cm).
  3. Vis og dokumentere gel med en transilluminator og tilknyttede kamera og programvare.

Representative Results

nPCR er en elegant øke spesifisitet og følsomhet av patogen deteksjon, spesielt når komplekse miljøprøver er under etterforskning. Som vist i figur 1, kan to rundene PCR målretting en strategisk region av Borrelia FlaB locus (og OspA, ikke bildet) rapportere tilstedeværelsen av bakterien Borrelia burgdorferi gjennom generasjon kort indre amplicons. Når løst av gel geleelektroforese, kan FlaB og OspA reaksjon produktene fra hvert kryss visuelt scoret og sammenlignet mot kontroller. I figur 2, unike prøven identifikatorer finnes øverst på hver gel og nei-mal og aerosol vises helt til venstre og høyre, henholdsvis ved stiger.

Robust amplicon band er tydelig i Velg eksperimentelle prøver, og de er lett skilles fra overskudd primere og gjenværende DNA (figur 2). Basert på eksperimentell design prinsippene fastsatt, er en sjekke vurdert positivt for Borrelia når parallelle negative kontroller viser ingen forsterkning og indre amplicons produseres fra både FlaB og OspA primere. I dette tilfellet møtte prøver T907, T604 og T606 overvåking kriterier for Lyme patogen (figur 2). By Contrast, T923 var bare positivt for OspA, et resultat som det er flere mulige forklaringer: A) kryss opprinnelse var negativ for Borrelia, men ytre eller indre OspA PCR utarbeidelse var spuriously forurenset med malen DNA (Merk at systemisk forurensning av reagensene var utelukket via negative kontroller), B) kryss gjennomført Lyme Borrelia, men lav mal beløp eller eksperimentelle feil hindret forsterkning av FlaB, eller C) en organisme var tilstede som inneholdt bevarte OspA sekvensen, men manglet Flagellin eller hadde lite identitet i regionen målrettet FlaB å anneal til primerne. Faktisk har OspA sekvens likheter vært nevnt i en rekke organismer, inkludert planter og dyr28. Converse situasjonen, forsterkning mer bevart Flagellin genet, men ikke OspA genet, kan indikere relaterte Borrelia art. I praksis gir denne protokollen mer OspA single-positive resultater enn FlaB primerne, antyder at scenariet 'A' er den minst sannsynlige forklaringen. Uten videre eksperimentelle analyse av den kontroversielle, men er det ikke mulig å finne kilden til single-positive resultatet. Øke antall tekniske gjentak på tvetydig prøver kan bidra til å forene deres sanne status, siden eventuelle forurensninger som ble spuriously introdusert til tidligere reaksjoner ikke ville være i arkiverte DNA. Hvis påfølgende reaksjoner med disse veiledningene ikke gi konkluderende resultater, kan imidlertid andre Borrelia loci undersøkes av PCR. Amplicons generert fra disse reaksjonene kunne også sekvensert og forhold blant isolerer å tilordne identitet og estimere graden av belastning divergens. SAPI og kolleger gir et eksempel på denne arbeidsflyten bruker menneskelige kliniske prøver35.

Alle faktorer vurderes, skissert protokollen og tolkning kriteriene er kostnadsberegnet til falske positive og falske negative priser på 0,17% og 0.0063%, henholdsvis.

Figure 2
Figur 2 : Gjenkjenning av Borrelia burgdorferi i enkelte merker av nPCR av FlaB og OspA. Som er tilordnet hvert kryss vises øverst i geléer og identiteter justere vertikalt for å rapportere oppdagelsen av OspA og FlaB i hvert eksemplar. Baner rett B til venstre i bildet representerer no-mal kontrollene, mens en (høyre baner) er aerosol kontroller å fange forurensning av laboratoriemiljø. Klikk her for å se en større versjon av dette tallet.

Discussion

Over tiår med bruk, PCR-baserte teknikker har konsekvent vist sin verdi i deteksjon av Borrelia fra leddyr og pattedyr prøver, om Borrelia kommer fra miljømessige eller klinisk opprinnelse. PCR tilbyr mange forbedringer over eksisterende tilnærminger til overvåking. Spesielt, det er ikke avhengig av utvikling og ytelse av antistoff reagenser, og stedet kan enkelt tilpasses for å oppdage nye mål av interesse ved å endre primer sekvenser. PCR rommer også evalueringen av flere loci parallelt, enten uavhengig eller via en multiplex reaksjon. Den kan brukes til forskjellige prøven innganger, inkludert friske og arkiverte flått22, dyr eller human kroppsvæsker og kappet vev25. PCR gir også amplicons som kan bearbeides videre, for eksempel ved begrensning enzym fordøyelsen, sonde hybridisering eller sekvensering, å gi økt innsikt i mikrobiell identitet21.

Som et klinisk verktøy anbefales PCR konseptuelt til standard serologisk diagnostikk, som det gir en direkte angivelse av bakteriell tilstedeværelse, i stedet for å stole på verten immunforsvaret som et sekundært forsvar av infeksjon. Imidlertid Lyme borreliose er knyttet til en relativt beskjeden mikrobiell byrde (< 50 organismer/mL av urin eller plasma) og forbigående spirochetemia, som kan gi opphav til falske negative resultater25. Følsomhetsnivået til denne teknikken i klinikken varierer avhengig vev, stadium av infeksjon, og eksempel tilstand, faller mellom 12,5% og 62% i eksisterende studier av blod og Cerebrospinalvæske biopsied vev36. Molekylær følsomhet begrensninger er ikke en bekymring om PCR foretas etter bakteriell kultur, men gjenoppretting av levedyktig Spiroketer fra klinisk eksemplarer har vist lignende utfordrende. Bare nylig har protokoller er optimalisert for høyere avkastning35. I mellomtiden kan tarmen av en infisert tick voksne inneholde gjennomsnittlig hvor som helst fra 2000 til over 50.000 Borrelia37,38,39, som er innen oppdagelsen nPCR. Dermed er protokollen godt egnet til tick overvåking innsats.

Til tross for sine mange fordeler utgjør nPCR visse utfordringer, og kapasiteten til denne teknikken for nøyaktig rapport tick infeksjon er derfor avhengig av strategiske valget av gener og amplicons, grundig eksperimentelle arbeidsflyter som gjenopprette kvalitet DNA fra prøver samtidig minimere kryss-eksponering av prøver og bruk av egnede kontroller som kan rapportere forurensninger i laboratoriemiljø og reagenser. Før noen eksperimentering, bør omfang og intensjoner undersøkelsen være klart definert slik at riktig genetisk loci og områder, kan velges. Hvis målet er å gi en objektiv skjermen for Lyme-forårsaker Borrelia burgdorferi s.l. komplekse, primere skal opprettes for å oppdage alle de tilknyttede stammene med lignende affinitet og forsterkning effektivitet, uten fange urelaterte organismer25. Ny primere kan være utformet og vurdert i sili bruke programvareverktøy som Primer-BLAST40, men de bør også valideres eksperimentelt mot standard referanse isolerer før blir brukt til uncharacterized prøver. Målet med DNA utvinning prosedyren er å gjenopprette intakt mikrobiell mal fra et blandet miljø utvalg (sjekke homogenate). Et valgfritt trinn før du fortsetter med PCR er å vurdere integriteten til utdraget DNA. Parallell reaksjoner kan i tillegg defineres å målrette et housekeeping gen i kryss. Sistnevnte kan også indikere tilstedeværelse av hemmere i reaksjonsblandingen, gir økt tillit at negative Borrelia reaksjoner er på grunn av fravær av organismen, og ikke tilstedeværelse av en hemmende miljøgifter.

Økt følsomhet av nestede PCR tilnærming kommer på bekostning av potensielle forurensning som genererer falske positive resultater. Eksogene mal kan bli introdusert et utvalg under haken disseksjon og DNA gjenoppretting, eller i ferd med å sette opp den ytre og indre forsterkning reaksjoner. Det er derfor spesielt viktig å følge beste praksis protokoller for PCR å unngå mal eller amplicon kryssforurensning. Disse inkluderer bruk av separate arbeidsstasjoner med uavhengige prosjekteringsvilkår, luftstrømmer, forvaring i PCR og biologiske sikkerhetskabinett skap eventuelt grundig kjemiske og fysiske rengjøring og sterilisering av overflater og reagenser og forsiktig håndtering av DNA 41. No-mal kontrollene er også viktig i å identifisere forurensning av lager reagenser. Et bestemt sikkerhetsproblem i nPCR er amplicon håndtering som oppstår ved overføring av den første reaksjonen til andre PCR fartøyet. Siden målet DNA har allerede gjennomgått eksponentiell berikelse i positiv prøver, dette er spesielt utsatt for kryss-smitte, og en enkelt-rør nPCR protokoll er utviklet for å omgå denne begrensningen. I denne tilnærmingen legges begge settene med primere for et gitt gen sammen slik reaksjon som forblir lukket for begge rundene PCR31. Ytre og indre primer parene må thermodynamically tydelig, slik at de ytre par forsterker mal ved høy annealing temperatur som uoverkommelige for indre primerne. I andre runde senkes annealing temperaturen til interne paret. Ikke bare gjør dette omkjøringsvei et potensielt forvirrende skritt, det også tillater bruk av flere anti-forurensning måler31,42. Men kan denne endringen ofre noen analysen følsomhet. Uansett tilnærming, vil øke antall tekniske gjentak utført uavhengig på et utvalg bidra til å identifisere falske forurensning.

Molekylær teknikker har fortsatt å utvikle seg siden introduksjonen av nPCR, og disse nyere tilnærminger tilbyr utvalgte fordeler fremfor den opprinnelige design, men på økt finansielle kostnader. Som navnet antyder, kvantitativ PCR (qPCR eller ekte tid (RT)-PCR) tillater nummereringen av patogener i en prøve, mens konvensjonelle teknikker er kvalitativ i naturen43. Følsomheten til qPCR er angivelig lik som nPCR38, men det kan variere avhengig av primer egenskaper28. En variant av qPCR som bruker molecular Beacon (MB) i stedet for konvensjonelle TaqMan prober har også vist lovende i deteksjon av Borrelia i klinisk prøver44,45,46. På grunn av sin unike sekundære struktur produsere molecular Beacon angivelig lavere bakgrunn fluorescens og høyere legitime signaler, og dermed gir overlegen følsomhet47. Pre-klinisk evaluering foreslå en potensiell oppdagelsen terskel for mellom en og ti Spiroketer44,45. Videre er har teknikken vært anvendt i multiplex reaksjoner samtidig oppdage et pattedyr vert genet44 og andre flåttbårne patogener45, som er ikke så lett oppnåelig med nPCR. Andre endringer inkluderer slippverktøy digital PCR (ddPCR) teknologi, som kan kvantifisere DNA uten bruk av en standardkurve39,48. Den nedre oppdagelse grensen av denne teknikken for Borrelia er også rundt ti Spiroketer/sample39. Sammenlignet med nPCR, har disse metodene også fordelen av redusert potensialet for forurensning, som de krever bare en enkelt forsterkning protokoll.

Hvis målet for overvåking er stedet å profilere variert bakteriell innholdet til en hake, er 16S rRNA metagenomic screening et attraktivt alternativ49. Selv om denne tilnærmingen er dyrere, krever spesialisert DNA sequencere ikke finnes i alle molekylærbiologi laboratorier og nødvendiggjør mer sofistikerte bioinformatikk-baserte tolkning, kanne den fange et bredt spekter av mikrober mer nøyaktig representere patogen belastningen av vektoren.

Mens qPCR og dets derivater er metoder for valg for kvantitative programmer og metagenomics skjermer gir bred lagerbeholdning på tick microbiome, er målrettet overvåking innsats ofte opptatt av binære rapportering av tilstedeværelse eller fravær av én eller noen få patogener i en vektor. Under slike omstendigheter, kan disse nyere, mer forseggjort tilnærminger introdusere unødvendige kompleksitet og økonomisk byrde i prosessen. For disse grunner, har nPCR stått testen av tid som en avgjørende teknikk i kryss testing.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Forfatterne vil takke Kami Harris for primer design, Ashley McKibbon og Jessica Thomas-Ebbett for filming, John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck og Rosie hunden for vises i den video. A. M. K. ble støttet av den kanadiske Lyme sykdom Research Foundation, og prosjektmidler ble gitt av naturvitenskap og Engineering Research Council for Canada (NSERC). M. K. B. W. mottatt lønn finansiering fra New Brunswick innovasjon Foundation (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics