Author Produced

Utveckling av en elektrokemisk DNA Biosensor att upptäcka livsmedelsburna patogener

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ett protokoll för utvecklingen av en elektrokemisk DNA biosensor bestående av en polylactic acid-stabiliserad, guld nanopartiklar modifierade, screentryckt kol elektroden för att upptäcka Vibrio parahaemolyticus presenteras.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nordin, N., Yusof, N. A., Radu, S., Hushiarian, R. Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen. J. Vis. Exp. (136), e56585, doi:10.3791/56585 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vibrio parahaemolyticus (V. parahaemolyticus) är gemensamma livsmedelsburna patogener som bidrar till en stor del av problem med folkhälsan globalt, avsevärt påverkar graden av mänsklig dödlighet och sjuklighet. Konventionella metoder för detektion av V. parahaemolyticus såsom kultur-baserade metoder, immunologiska analyser och molekylär-baserade metoder kräver komplicerade provhantering och är tidskrävande, omständlig och kostsam. Nyligen, biosensorer har visat sig vara en lovande och omfattande detektionsmetod med fördelarna med snabb detektering, kostnadseffektivitet och funktionalitet. Denna forskning fokuserar på att utveckla en snabb metod för att upptäcka V. parahaemolyticus med hög selektivitet och känslighet enligt principerna för DNA hybridisering. I arbetet uppnås karakterisering av syntetiserade polylactic acid-stabiliserad Guldnanopartiklar (PLA-AuNPs) med hjälp av röntgendiffraktion (XRD), ultraviolett-synliga spektroskopi (UV-Vis), Transmission Electron Microscopy (TEM), fält-utsläpp Scanning Electron Microscopy (FESEM) och cyklisk voltametri (CV). Vi genomförde också ytterligare provning av stabilitet, känslighet och reproducerbarhet av den PLA-AuNPs. Vi hittade att de PLA-AuNPs bildas en sund struktur av stabiliserad nanopartiklar i vattenlösning. Vi observerade också att känsligheten förbättrats tack vare mindre kostnad överföring motstånd (Rct) värdet och en ökning av aktiv yta (0.41 cm2). Utvecklingen av vårt DNA biosensor baserades på modifiering av en screentryckt kol elektroden (SPCE) med PLA-AuNPs och med metylenblått (MB) som indikatorn redox. Vi bedömde händelserna immobilisering och hybridisering av differential pulse voltametri (DPV). Vi hittade som kompletterande, icke-komplementära och inkompatibla oligonukleotider var särskilt kännetecknas av den fabricerade biosensor. Den visade också på ett tillförlitligt sätt känslig detektion i korsreaktivitet studier mot olika livsmedelsburna patogener och identifiering av V. parahaemolyticus i färska hjärtmusslor.

Introduction

Ett större ämne för offentliga och vetenskaplig debatt under de senaste åren, matförgiftning förknippas främst med 3 ombud: mikroorganismer1, kemikalier2och parasiter3. Förorenad mat kan orsaka allvarliga hälsokonsekvenser i människor, särskilt i de högre riskgruppen för dem med svagt immunförsvar, äldre, gravida kvinnor, barn och unga barn4. Med mer än en miljon fall av akut diarré inträffar årligen i barn under 5 år i Afrika, Asien och Latinamerika, matförgiftning är en större global sjukdom5,6 och Världshälsoorganisationen har fastställt mikroorganismer som den viktigaste bidragsgivare7. Vibrio parahaemolyticus sticker ut bland de mest erkända virulenta stammarna. Vanligtvis finns i kust, flodmynningar och marina miljöer8, är det en gramnegativ bakterie, som blir aktiv i hög salt miljöer, och orsakar allvarliga mänskliga gastroenterit när ätit otillräckligt kokta, misskött eller råa Marine produkter9. Dessutom gör existerande sjukdomstillstånd hos vissa personer dem benägna att sår infektion, blodförgiftning eller öra infektion uppkommer V. parahaemolyticus10. Virulensfaktorer av V. parahaemolyticus Hemolysiner är indelade i två typer som bidrar till sjukdomspatogenes: termostabila direkt hemolysin (TDH) kodad av tdh gener och TDH-relaterade hemolysin kodad av trh gener11. Virulens markörerna (tdh och trh gener) för V. parahaemolyticus finns främst i kliniska prover i stället för miljömässiga exemplar.

V. parahaemolyticus besitter förmågan att överleva under en lång rad villkor, svarar snabbt på miljöförändringar12. Dess spridning mekanism eskalerar dess fara potential som dess toxicitet ökar parallellt med cell mass13. Ännu värre, klimatförändringar ger dessa bakterier med gott om villkor för att påskynda deras cell befolkningen tillväxt14. På grund av dess hög frekvens måste V. parahaemolyticus övervakas längs livsmedelskedjan, särskilt inom handel och produktion av skaldjur eftersom dessa produkter är där de finns i enorma mängder15,16 över hela världen. För närvarande bakterierna identifieras och isolerade med hjälp av en rad metoder inklusive biokemiska tester, anrikning och selektiva medier17, enzymkopplad immunmagnetisk sorbent assay (ELISA)18, puls-field gel electrophoresis (PFGE) 19, latex agglutinationsprov och polymeras-kedjereaktion (PCR) tester20. Dessa metoder kräver vanligtvis kvalificerad personal, sofistikerade instrument och mödosamma tekniker som inte ger information om kontaminering omedelbart. Detta begränsar kraftigt sannolikheten för att snabbt upptäcka skadliga föroreningar och hotellets program. Snabb upptäckt verktyg förbli en utomordentligt stor utmaning.

Biosensing framstår som ett lovande alternativ för livsmedelsburna patogener eftersom det erbjuder en tidsbesparande, kostnadseffektiv, praktiska och realtid analys metod21,22,23,24 . Dock även om det har varit många positiva resultat för analyten detection i spetsiga prover och standardlösning med biosensorer, finns det fortfarande en brist på forskning tillämpas på verkliga prover i vattenlösning blandningar eller organiska extrakt25. Nyligen, elektrokemiska biosensorer med direkta eller indirekta deoxiribonukleinsyra (DNA) identifiering har fått ökad uppmärksamhet bland forskare, på grund av deras specifika upptäckt av kompletterande målet via en hybridisering event26 , 27 , 28 , 29. dessa unika tillvägagångssätt är mer stabila jämfört med enzym-baserade biosensorer, vilket ger en lovande teknik för miniatyrisering och kommersialisering. Målet för studien rapporterade här är att konstruera en snabb verktyg som kan upptäcka V. parahaemolyticus med hög selektivitet och känslighet praktiska, baserat på DNA sekvens specificitet under hybridisering. Identifiering strategier innebär kombinationen av polylactic acid-stabiliserad Guldnanopartiklar (PLA-AuNPs)30 och screentryckt Kolelektroder (SPCEs) i närvaro av indikatorn hybridisering, metylenblått (MB). Potentialen hos den utvecklade upptäckt konstruera är ytterligare utforskas med hjälp av bakterier DNA lysate och fräsch hjärtmussla prover.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Obs: Alla kemiska och biokemiska reagenser som används bör vara av analyskvalitet och används utan ytterligare rening. Förbereda alla lösningar med sterilt avjoniserat vatten. Autoklav allt glas före sterilisering.

Försiktighet: Använd alla lämpliga säkerhetsrutiner när du utför laboratorieverksamhet inklusive användning av tekniska kontroller (spiskåpa, handskfack) och personlig skyddsutrustning (skyddsglasögon, handskar, labbrock, full längd byxor, stängd tå skor).

1. tillverkning och karakterisering av modifierade elektrod använder PLA-AuNPs

  1. Förberedelse och karakterisering av PLA-AuNPs
    1. Snabbt lägga till 10 mL natriumcitratlösning (38,8 mM) i 100 mL kokande aqueous chloroauric syralösning (1 mM) och kyla ner till rumstemperatur. Observera att ändringar i färg i den beredda lösningen för AuNPs som startar som gult, ändringar av svartaktiga och slutligen avslutas som mörk rubinröd.
    2. Placera PLA pellets i en rostfritt stål mögel för smältprocessen och värm dem vid en temperatur på 190 ° C i 10 min. Följ med förfarandet för pressning: sätta dem under ett tryck av 2,2 MPa för 1 min som en del av PLA blad beredning. PLA bladet kommer att vara redo för användning efter kylning för ca 3 h.
    3. Omrörning kraftfullt, Lös 0,68 mg PLA blad i 5 mL kloroform i rumstemperatur. Blanda den upplösta PLA med 10 mL av den tidigare beredd AuNPs och homogeneously rör det vid rumstemperatur. De homogena blandningarna kan betecknas som PLA-AuNPs och kännetecknas med UV-Vis, XRD, TEM och FESEM med EDX.
  2. Förberedelse och karakterisering av modifierade screentryckt kol elektroden
    Obs: Den SPCE som används i denna studie omfattar ett tre-elektrod system: en counter elektrod, ett kol arbetselektroden och en referenselektrod av Ag/Granulatfyllda.
    1. Snabbt torka Pipettera 25 µL av homogen lösningen av PLA-AuNPs på SPCE och sedan luft för 24 h före användning.
    2. Elektrokemiskt karakterisera de modifierade elektroderna, SPCE/PLA-AuNPs, i ferro kaliumcyanid (K3[Fe(CN)6]3 -/4 -) att mäta aktiva yta, elektroimpedansspektroskopi, repeterbarhet, reproducerbarhet och stabilitet30.

2. utveckling av den elektrokemiska DNA Biosensor

  1. Sonden förberedelse
    Obs: Sekvenserna av ssDNA sonden och kompletterande DNA valdes baserat på information från National Center for Biotechnology Information (NCBI) databas.
    1. Köpa syntetiska oligonukleotider (20-mer ssDNA sond, 20-mer kompletterande DNA, 20-mer omaka DNA och 21-mer icke-komplementära DNA) som frystorkat pulver från kommersiella laboratorier, baserat på följande sekvenser:
      thiolated ssDNA sond: 5′ - / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3′
      kompletterande DNA: 5′ - CAGTGCTTCTGCATAATCCG - 3 '
      One-base avvikande DNA: 5′ - CAGTGCTTCTGC ṪTAATCCG - 3′
      tre-bas avvikande DNA: 5′ - CAGTGCTTCT Ċ ṪṪTAATCCG - 3′
      icke-komplementära DNA: 5′ - CGCACAAGGCTCGACGGCTGA - 3 '
    2. Förbereda stamlösningar av alla oligonukleotider (100 µM) med hjälp av en steril TE lösning (10 mM Tris-HCl, 1 mM EDTA, pH 7.5), uppdelad i testportioner. Hålla detta vid-4 ° C och gör sedan de lämpliga utspädningarna precis före användning.
  2. Optimering av immobilisering och hybridisering
    Obs: En SPCE modifierad med PLA-AuNPs, betecknas som SPCE/PLA-AuNPs, användes för denna studie och en droppe gjutning metod användes för DNA immobilisering och hybridisering.
    1. Först, immobilisera 25 µL av thiolated ssDNA sond på den SPCE/PLA-AuNPs och sedan luft torka den i 24 timmar vid rumstemperatur, varefter det kommer att vara slutligen betecknas som SPCE/PLA-AuNPs/ssDNA. Bestämma optimering av villkoret immobilisering med hjälp av tre faktorer: koncentrationen av ssDNA (allt från 0,2 1,4 µm), tid (allt från 30 till 210 min) och temperatur (strövande från 25 till 75 ° C).
    2. Pipettera 25 µL av kompletterande DNA vidare till ytan av SPCE/PLA-AuNPs/ssDNA att utföra hybridisering händelsen efter som det kan vara slutligen betecknas som SPCE/PLA-AuNPs/dsDNA. Bestämma optimering av hybridisering skick via de två faktorerna tid (allt från 5 till 30 min) och temperatur (allt från 25 till 75 ° C).
    3. Fördjupa den immobiliserade och hybridiserade elektroder i µM 20 MB för 30 min. ta bort icke-specifikt adsorberade DNA och överskjutande MB genom tvättning med 0,5 M ABS/20 mM NaCl (pH 4,5) och sedan skölja med avjoniserat vatten. Mått toppström på MB minskning med DPV teknik. Exekvera DPV mätning med 0,1 M fosfatbuffrad Koksaltlösning (pH 7) innehåller ingen indikator.
  3. Karakterisering av den fabricerade DNA-biosensor
    1. Fördjupa den SPCE/PLA-AuNPs i µM 20 MB för 30 min, tvätta med 0,5 M ABS/20 mM NaCl (pH 4,5) och skölj sedan med avjoniserat vatten före mätning. Följ ett liknande förfarande för alla interaktioner inklusive sonden DNA, kompletterande DNA, avvikande DNA och icke-komplementära DNA-prover.
    2. Mäta den elektrokemisk reduktion.
      Obs: Vi mätte DPV med ett kommersiellt tillverkade Autolab med interface mjukvara.
      DPV mätningar av den MB elektrokemisk reduktion utförs på en potentiell alltifrån -0,5 V till 0,25 V, med ett steg som är potentiella 0,005 V modulering amplituden av 0.05 V, och en avsökningshastighet av 7.73 mVs-1 i 0,1 M fosfatbuffrad Koksaltlösning (pH 7), innehåller ingen indikator. Den selektivitet, känsligheten, reproducerbarhet och värme stabiliteten i den påhittade DNA-biosensor studerades ytterligare. Rapporterade resultaten presenterades som genomsnittliga värde mätningar i tre replikat.

3. validering av den fabricerade DNA Biosensor använder riktiga prover

  1. Beredning av bakteriestammar
    1. Välj bakteriella prov baserat på deras betydande förorening av skaldjur31,32 .
      Obs: V. parahaemolyticus som referensstammar och 8 andra bakteriestammar (Campylobacter jejuni, Listeria monocytogenes, Salmonella typhimurium, Salmonella enterit, Klebsiella pneumoni, Escherichia coli O157: H7, Bacillus cereusoch Vibrio alginolyticus) av den gemensamma livsmedelsburna patogener sysselsatta för elektrokemisk DNA biosensor validering i denna studie.
    2. Genomföra en rutinmässig subkultur av bakteriestammar på deras respektive agar varannan vecka att upprätthålla sin lönsamhet, se tabell 1 för odlingsbetingelser.
    3. Upprätthålla långsiktigt bevarande av de bakteriella stammarna i deras respektive växande buljonger innehållande 20% (v/v) glycerol vid-80 ° C som glycerol skyddar bakterier genom att förhindra bildandet av iskristaller som kan skada dem under frysprocessen. Nästa, Inokulera en slinga av bevarade bakteriecell kultur i glycerol bestånd i de respektive buljonger. Inkubera i buljonger enligt deras respektive tillväxt tid och temperatur när du behöver återuppliva bakterierna.
    4. Bestäm mängden V. parahaemolyticus celler som använder en spridning plattan teknik33, en standard och en välkänd metod för att räkna upp mikroorganismer som härrör från en serie av utspädningar.
      1. Kultur V. parahaemolyticus i Trypticase Soy buljong (TSB + 3% NaCl) vid 37 ° C i en 140-rpm skakningar skick. Överför sedan 1 mL bakterier cellkulturen till 9 mL TSB + 3% NaCl att få en 10-1 utspädningsfaktor.
    5. Upprepa detta steg nio gånger för att få en fullständig serie av upp till 10-10 utspädningsfaktor. Därefter sprids 0,1 mL av varje Utspädningsfaktor (start från 10-1 till 10-10) på en Vibrio selektiv agarplatta för kolonin räkna, respektive. Inkubera plattorna inkuberas vid 37 ° C under 24 h.
    6. Använda en koloni räknare för att räkna enskilda kolonier och sedan tillbaka-beräkna (antal CFU/pipetteras beloppet x utspädningsfaktor) för att få en kolonibildande enhet per milliliter densitet (CFU mL-1). Härleda koncentrationen av de kolonibildande enheter (CFUs) i de bakterier cellsuspensioner från kalibreringskurva CFU mL-1 mot absorbans.
  2. Beredning av PCR-analysen
    1. Extrahera genomiskt DNA efter en modifierad kokt lysis förfarande34. Första, streak en enskilda bakteriell stam på agar media och Inokulera det i buljongen media, följt av inkubation det på dess relativa tillväxt villkorar, en 140 rpm skakar skick.
    2. Pipettera en 1 mL kultur av buljongen i en mikro centrifugrör. Centrifugera detta vid 4830 x g och 4 ° C i 1 min att få pellets. Använda ca 500 µL sterilt TE buffert för resuspension med pelleten. Håll den resulterande suspensionen för 10 min 98 ± 2 ° C i ett värmeblock och omedelbart chill det vid-18 ° C i ca 10 min att lysera celler och släppa DNA.
    3. Centrifugera genomisk DNA vid 4830 x g och 4 ° C för 3 min att erhålla en tydlig suspension och hålla supernatanten vid-20 ° C för vidare användning. Använda en biophotometer mätning med UV-absorption vid en våglängd av 260 nm (som nukleinsyror absorberande våglängd av ljus) och även vid en våglängd på 280 nm (som proteinerna absorberande våglängd av ljus) att bestämma koncentrationen och renheten av den extraherade genomiskt DNA och sedan identifiera alla stammar använder biokemisk standardanalyser35 och verifiera dem av 16S rRNA-genen sekvensering36. Slutligen, denaturera genomisk DNA vid 92 ° C under 2 minuter och kyl den snabbt i is vatten före applicering till biosensor.
    4. Ytterligare bekräfta närvaron V. parahaemolyticus använda PCR för att nå den toxR genen. Utföra den här proceduren i en termocykler använder en primer-par (5'-GTCTTCTGACGCAATCGTTG-3' och 5'-ATACGAGTGGTTGCTGTCATG-3'). Optimera den PCR-amplifieringen i en total reaktionsvolym 25 µL bestående av sterilt vatten (15,5 µL), buffert (5 µL), primer (1 µL, 10 µM), dNTP mix (1 µL), DNA-mall (2 µL) och Taq-DNA-polymeras (0.2 µL, 10 x).
    5. Blanda komponenterna väl och ordna den PCR-amplifieringen av målet sekvensen i en termocykler programmerad för 30 cykler av förstärkning. I vår studie, varje cykel bestod av tre steg reaktioner dvs., inledande denaturering (94 ° C, 3 min) följt av 30 cykler av denaturering (94 ° C, 1 min), glödgning (63 ° C, 1,5 min) och förlängning (72 ° C, 1,5 min), följt av sista förlängning (72 ° C, 7 min).
    6. Bestämma de förstärkta produkterna och deras storlekar via elektrofores på 1,5% agarosgel. Fånga gel bilder med ett kommersiellt producerade gel-dokumentationssystem.
  3. Beredning av hjärtmussla prover
    1. Få färska prover.
      Obs: Våra färska hjärtmusslor (Anadara granosa) var erhållits från våt marknaden i Serdang, Selangor, och snabbt kommer till laboratoriet i en ice svalare box för analys. Dela in proverna i 2 grupper, nämligen den behandlade och obehandlade gruppen, förutsatt att hjärtmusslor skördades jämnt från början av skörden tills placera dem i kylförvaring.
    2. Förbehandla hjärtmusslor i gruppen behandlade genom att lagra dem vid-20 ° C under 24 h, följt av UV-ljus vid 20 ° C i 4 h innan DNA-extraktion.
      Obs: Frystemperaturen och UV-exponering används för kontrollerad grupp dödar eller åtminstone begränsar den naturligt ackumulera V. parahaemolyticus i hjärtmusslor. Applicera inte en högre pastörisering regim 70 ° c som kontrollerade villkoret i denna studie syftar att efterlikna den verkliga situationen av färska hjärtmusslor. Samtidigt analysera prover direkt från den obehandlade gruppen utan någon förbehandling så snart de anländer till laboratoriet.
    3. Subkulturen en stam av V. parahaemolyticus ATCC 17802 i TSB (3% NaCl). Fastställa nivån på viabla celler i inokulatet via plätering av lämpliga utspädningar av TSB (3% NaCl) på CA för att erhålla ett inokulum 104 CFU mL-1 av V. parahaemolyticus. Tvätta varje hjärtmussla i destillerat vatten och skrubba den fri från smuts innan du använder steril pincett i ett laminärt flöde skåp för att avlägsna vävnader från skalet.
    4. Homogenisera ca 10 g av hjärtmussla vävnadsprover med en Homogenisatorer i 90 mL steril TSB (3% NaCl) för 60 s. Lägg till ett känt belopp av V. parahaemolyticus till 9 mL av homogeniserade provet buljongen för spetsiga prover. Använda de unspiked proverna som en negativ kontroll. Uppskatta cell räkningarna av V. parahaemolyticus spetsade till hjärtmussla proverna av plätering 0,1 mL av proverna på CA, och därefter pipettering 1 mL av prover i en mikrocentrifug rör för DNA prov utvinning, att användas i biosensor och PCR-analys.
    5. Extrahera genomisk DNA den V. parahaemolyticus spetsiga och unspiked prover efter en modifierad kokt lysis förfarande36. Slutligen bestämma DNA-koncentration och renhet med en bio fotometer mätning med UV-absorption vid en våglängd av 260 nm (som nukleinsyror absorberande våglängd av ljus) och även vid en våglängd på 280 nm (som proteinerna absorberande våglängd av ljus).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bildandet av AuNPs avslöjades genom förändringen i färg av en vattenlösning med natriumcitrat närvarande. Detta orsakade färgen som ska ändra från ljusgul till en djupt rubinröd. Generering av PLA-AuNPs bekräftades från UV-vis spektra (figur 1) där tillväxten av ytan plasmon resonans (SPR) toppen hittades vid cirka 540 nm. Bildning och förekomsten av PLA-AuNPs indikerades på 500-600 nm våglängd intervall, beroende på partikel storlek37. XRD konsumtionsmönster AuNPs och PLA-AuNPs visas i figur 2. Alla naturgrafiten topparna observerades vid 2θ 31,7 38,2, 44,4, 64,7 och 77,7 °. De tillskrevs den (100) (111) (200) (220), och (311) kristallografisk plan av cubic-FCC (face-centered cubic) guld (metall) nanostrukturer (JCPDS file no.-00-004-0783). De PLA-AuNPs naturgrafiten peak också stödnivåer som en bredare diffraktion topp centrerad på 31,7 °, vilket innebär att AuNPs var inbäddade i PLA och föreslå bildandet av polyphasic guld nanostrukturer38. Dessutom visade alla AuNP diffraktion topparna visas på den PLA-AuNPs att AuNPs hade en stabil struktur. Genomsnittsstorleken PLA-AuNPs beräknades med hjälp av Scherrers ekvation (L = kλ/βcosθ), genom att bestämma bredden på den (100) Braggs reflektion. Från FWHM och d-spacing (tabell 2), PLA-AuNPs naturgrafiten storlek beräknades som 27 nm.

Dimensionerna av den PLA-AuNPs och dess morfologi undersöktes ytterligare använder TEM. Från TEM partikeln kurvan storleksfördelning och bilder av PLA-AuNPs sågs det att Guldnanopartiklar var nästan sfärisk form (figur 3). Storleken på nanopartiklarna var i intervallet ca 37 nm, något större än erhålls Scherrers formel, vilket tyder på en polykristallina natur som-synthesized nanopartiklar39. Mindre storlek följd av XRD i motsats till TEM har också observerats i tidigare forskning, troligen eftersom partikeln strukturen är polykristallina i naturen på grund av den betydande mängden crystallites som är mindre (sub partiklar)40 . Figur 4 visar FESEM bilden av som förberedda PLA-AuNPs på SPCE. Det är uppenbart från FESEM bilder och EDX spectra att den SPCE/PLA-AuNPs hade den högsta andelen guld, största täthet i vikt, och störst ytbehandlar av nanopartiklar täckning. Det kan också noteras, särskilt, att figur 4(en) visar FESEM bilden av en bare SPCE. FESEM bilden i figur 4(b) visar väl distribuerade PLA-AuNPs. För att bejaka den syntetiserade PLA-AuNPs' kemisk sammansättning, var EDX anställd för att undersöka den kemiska sammansättningen av de som producerade PLA-AuNPs, enligt figur 4(en)och 4(b). Det EDX-spektrumet bekräftat att de som producerade PLA-AuNPs bestod av guld (Au) endast, och visas inget andra element utom toppen som motsvarar kol (C) och syre (O). Förekomsten av C topp berodde på kol elektroden till vilket provet var droppe cast.

Det EDX-spektrumet visade också förekomsten av O indikerar att syre var adsorberat på kol elektroden eftersom filmen var utsätts för luft. Detta bekräftar att syre är adsorberat på kolnanorör om de utsätts för luft för en lång tid41. Det finns olika gasmolekyler i luft, var syre tros vara den främsta adsorbate på air-exponerade kolnanorör42, möjligen på grund av dess snabbare adsorption jämfört med andra molekyler43. Detta var baserat på att hitta att syre var den huvudsakliga adsorbate på kol elektroden under natten luften exponering i provberedning och förstärkt den PLA-AuNPs kemiska renhet. Förhållandet mellan anodisk och katodiskt peak (jagpa/ipc) var nästan 1, vilket gav konstanta toppar potential som scan Betygsätt ökad44. Dessutom överensstämde anodisk och katodiskt maximal potential på olika scan priser45 tyder på att den elektrokemisk reaktionen var reversibel baserat på peak separation (figur 5). Den aktiva ytan av modifierade elektroden beräknades med hjälp av Randles-Sevick ekvation (jagpc = (2,69 × 105) n3/2 AD1/2 Cv1/2. Från lutningen på tomten jagpc kontra v1/2 i figur 5(en) och (b), ytan av elektroderna beräknades som 0,26 cm2 och 0,41 cm2 för bare SPCE och PLA-AuNPs, respektive. Detta resultat bekräftas att förbättringen av PLA-AuNPs på det aktiva yta var relativt högre än med bare SPCE. Härledda resultatet var jämförbar med polymer-embedded guld nanopartiklar (β-CD-EDAS(N-[3-(trimethoxysilyl)propyl]ethylene-diamine matrix inkapslade Guldnanopartiklar), som visade att en stor aktiv yta förbättrade processen för elektronöverföring och därför resulterade i bättre känslighet46.

Den modifierade SPCE elektrokemisk reaktionen var i en process av kontrollerad diffusion, visas av en minskning av K3[Fe(CN)6]3 -/4 - toppströmmen, vilket i sin tur grundade sig på aktuellt av scan rate kvadratroten (v 1/2). För att få en bättre bild av modifierade elektrod egenskaper, genomfördes en elektrokemisk impedans spektroskopi (EIS) studie för att korrelera med utförandet av den modifierade elektroden som presenteras i form av CV mätningar. Avsnittet halvcirkel sett vid höga frekvenser korrelerade med begränsande processen av elektron överföringen i EIS. Kostnad överföring motstånd (Rct) mättes direkt som diametern av halvcirkel. Detta resultat stämde med värdet på Rct av den kala SPCE, som var 1932 Ω och om ändring av SPCE/PLA-AuNPs minskat till 1444 Ω (figur 6). Minskningen av Rct -värde i SPCE/PLA-AuNPs kan ha lett till en minskning av lokala Dielektricitetskonstant eller en ökning av tjockleken på den elektriska dubbletten lager47, vilket tyder på att K3[Fe(CN)6]3 - /4 - funktion genom adsorption vid gränssnittet metall/lösning. Dessa utgångar uppfyllt de härrör från mätningar av CV (figur 7). Toppströmmar ökade successivt med ändring av de SPCEs som använder PLA-AuNPs, som visade att en högre känslighet var inversen av den lägre Rct48. Således, ökningen av värdet av CV av modifierade elektroderna och minskningen i R-ct -värden kan ha berott på att gradvis ersattes av vattenmolekyler (volymen av vattenmolekylerna är 27.19 Å3) av adsorption av K3 [Fe(CN)6] 3 -/4 - på metallytan, minska omfattningen av de upplösning reaktion49.

Tabell 3 anger den relativa standardavvikelsen (RSD) av repeterbarhet och reproducerbarhet av modifierade elektroden. Rutinmässiga CV inspelning av K3[Fe(CN)6]3 -/4 - gjordes för sex på varandra följande uppsättningar att undersöka repeterbarheten av modifierade elektroderna. Den RSD av SPCE/PLA-AuNPs härleddes 4,26 procent. Elektroden med PLA-AuNPs modifiering gav bättre RSD efter flera mätningar. Dessutom var med samma procedur, sex modifierade elektroder självständigt fabricerade, vilket gav RSD värden 4,05% för SPCE/PLA-AuNPs, som indikerar bättre reproducerbarhet av elektroden tillverkning för PLA-AuNPs. Modifierade substratet beroende på PLA-AuNPs hölls vid 37 ° C om förlängning av giltighetstiden. Det var också utnyttjas för posten i 20 cykler och en minskning med 18% i signalkvalitet. För att uppnå de högsta effekt från biosensor, immobilisering period, temperatur, tillsammans med undersöktes ssDNA koncentration och kriterier för hybridisering. Dessa villkor krävs ska optimeras, eftersom de påverkar toppström av DPV. För att optimera ssDNA koncentrationen, SPCE/PLA-AuNPs var pipetteras med olika koncentration (0,2, 0,4, 0,6, 0,8, 1,0, 1,2 och 1,4 µM) av ssDNA i 60 min så att den optimala koncentrationen av ssDNA bestämdes. DPV toppströmmen utifrån figur 8, och ökat liksom högre DNA koncentrationer användes. Studien fann också att den optimera koncentrationen av DNA var 1,2 µM ssDNA.

För att optimera immobilisering perioden som omfattar enkelsträngat DNA i SPCE/PLA-AuNPs, 25 µL av ssDNA (1,2 µM) testades under olika tider (30, 60, 90, 120, 150, 180 och 210 min). I figur 9visar resultaten en ökning av immobilisering period vilket ger en kontinuerlig ökning av DPV toppströmmen. Således valdes optimal immobilisering tiden av ssDNA som 180 min. För att optimera immobilisering temperaturen, den SPCE/PLA-AuNPs var pipetteras med ssDNA (1,2 µM) vid olika temperaturer (75, 65, 55, 45, 35 och 25 ° C) för 180 min. Vi hittade att när temperaturen i immobilisering ökades till 55 ° C, den DPV toppström initialt eskalerade följt av en efterföljande avskrivningar (figur 10). Således, 55 ° C valdes som optimerade immobilisering temperaturen ska användas i efterföljande experiment. Separation av ssDNA som är orörlig från ytor den elektrod och hybridisering handikapp orsakades av ökande temperaturer. Det har förekommit andra rapporter med liknande resultat50. Snabbare delning och degeneration av DNA från ytor av nanopartiklar av guld inträffade vid högre temperaturer51. Forskning nyligen rapporterade att bindningen mellan guld och thiol oxiderar bryts ned snabbt och enkelt i en situation som är ambient, till exempel när de utsätts för vatten, luft och ljus52,53,54. Effekten av hybridisering tid undersöktes också i denna studie.

Den påhittade SPCE/PLA-AuNPs/ssDNA var drop-cast med en lösning av mål-DNA (0,2 µM) vid olika hybridisering tider (5, 10, 15, 20, 25 och 30 min). Svaret från DPV ökade naturligtvis med en 5-min ökning av tid för inkubation (från 5 till 10 min) (figur 11). När detta värde erhölls, observerades ett 10 till 30 min nedåtgående mönster så önskad tid för hybridisering valdes som 10 min. Effektiviteten i hybridisering ökade med en ökning i temperaturen mellan 25 ° C till 35 ° C (figur 12). Den höga nuvarande sågs att långsamt minska vid en temperatur som är högre än 35 ° C. Anledningen till detta tillskrevs smörgås struktur denaturering minska detekteringssignal. Den optimala hybridiseringstemperatur valt var därför 35 ° C. Processen som vi används för att upptäcka V. parahaemolyticus består AuNPs för att förbättra den aktiva ytan på arbetselektroden, PLA att medla ytmodifiering och den komplexa, redox MB, att reduceras det till LB. Resultatet av denna oxidationsprocess var en bättre samhörighet mellan ssDNA och MB55. Den nuvarande DPV minskade på grund av det lägsta antalet bifogade MB molekyler under hybridisering av ssDNA med dess kompletterande sekvens.

Vi har utfört ytterligare utredningar av utförandet av den utvecklade biosensor. DPV resultaten i figur 13 visar att det kunde skilja selektivt sonden DNA, kompletterande DNA, one-base avvikande DNA, tre-base avvikande DNA och icke-komplementära DNA i närvaro av MB som upptäckt etikett56, 57. lägsta toppströmmen (0,73 µA) ställdes av kompletterande DNA, som sakta ökade med one-base avvikande DNA (0.94 µA), tre-baser omaka DNA (1,05 µA), icke-komplementära DNA (3,25 µA), och sond DNA (4,79 µA). Målet DNA nuvarande var den minsta av alla strömmar av oligonukleotiden sekvenser så att våra biosensor diskriminera sekvenserna av oligonukleotiden känsligt och specifikt. MB bundna starkt med ssDNA immobiliserade sonden DNA producerar en stor DPV toppström. SPCE/PLA-AuNPs/icke-komplementära DNA halveras immobiliserade sonden DNA nuvarande nästan som endast en liten mängd MB monterade på ytan av SPCE/PLA-AuNPs/dsDNA. Detta är sannolikt på grund av otillgängliga interaktioner mellan MB och guanin baser. Lägena interaktion av DNA och MB är starkt beroende av sådana experimentella villkor som pH, temperatur, DNA koncentrationen, jonstyrka och typ av buffert58,59. MB länkar ofta till dsDNA av groove och intercalative lägen, vilket resulterar i MB ackumulering på dsDNA ytan60. Exponering av våra fånga sond DNA one-base avvikande DNA och tre-base avvikande DNA minskar ständigt DPV toppströmmar och kompletterande mål DNA fortsatte denna trend. Tabell 4 visar andelen av selektivitet skattesats för MB peak nuvarande. Vår övergripande slutsats var att hybridisering av den konstruerade DNA-biosensor var mycket selektiv via immobiliserade sonden DNA på den SPCE/PLA-AuNPs' yta.

Känsligheten hos de utvecklade DNA-biosensor undersöktes ytterligare med olika koncentrationer av kompletterande mål oligonukleotiden. Figur 14 skildrar gradvis utarmning av DPV toppström MB på den SPCE/PLA-AuNPs som kompletterande DNA koncentrationen ökade. Figur 15 uppvisar linjär regressionskoefficienten 0,96 som genererades mellan loggen för minskad MB toppströmmen och loggen flera koncentration av mål-DNA (0.2 pM till 0,02 mM). En graf över topp aktuella ändringar (ΔP) var ritade med hjälp av 3σ/m formel (σ är standardavvikelsen för blindlösningen och m är lutningen på en linjär kurva)61,62,63. Detektionsgränsen för den påhittade DNA-biosensor beräknades vara 4. 05.43 pM som var större än vår minsta faktiskt mätt provet. Detta resultat var överens med faktumen att ΔP för 0.2 pM och 2 pM (2,65 × 10-6 A och 2,81 × 10-6 A) med en standardavvikelse på 1.19 × 10-7 A och 1,06 × 10-7 A, respektive överlappade.

För att beräkna Kvantifieringsgränsen för den påhittade DNA-biosensor, vi använde formeln 10σ/m där (σ är blindlösningens standardavvikelsen och m är lutningen på den linjära kurvan) och hittade resultatet att vara en vinst på 14.8 pM. Upprepade denaturering av kompletterande DNA utfördes för att bedöma den DNA biosensor kapacitetsmässigt dess förnyelse. Vi gjorde detta genom ruvning 0,2 µM kompletterande DNA-modifierade elektrod i varmvatten på 86 ° C i 8 min för att denaturera dubbelsträngat DNA, följt av snabb kylning i ett isbad att upprätthålla den denaturerat enkelsträngat DNA64.

Aktiviteten hybridisering bibehölls till 91% av dess första svar efter 8 försök av regenerering (n = 5, RSD = 4,05%). Det DNA biosensor baserat på SAM metod för DNA sonden immobilisering vidare till SPCE/PLA-AuNPs var mycket stabil, att uppnå ett bra svar att upptäcka kompletterande DNA efter upprepade denaturering processer. Stabiliteten i vår DNA biosensor angående värme var utforskas ytterligare. Detta gör lagrat vi PLA-AuNPs/SPCE/ssDNA elektroden vid temperaturer på 4 ° C, 25 ° C och 45 ° C i en förseglad aluminium påse innehållande kiseldioxid geler. I slutet av 6 månader, vi bedöms kompletterande DNA och uppskattade procentandelen av återvinning av signal produktion. Figur 16 visar att sonden SPCE/PLA-AuNPs/ssDNA var mycket stabil med mer än 80% av dess ursprungliga signalen fortfarande återställas efter 6 månaders lagring. Starka reaktionen mellan PLA-AuNPs och ssDNA befanns ha långsiktig stabilitet vid en temperatur lägre än 45 ° C.

Nio olika arter av bakterier (B. cereus, L. monocytogenes, C. jejuni, E. coli O157: H7, V. alginolyticus, S. typhimurium, S. enterit, K. pneumoni och V. parahaemolyticus) screenades av PCR-detektion. PCR-amplifiering produkterna för artspecifika upptäckt av V. parahaemolyticus från bakterier kultur visas i figur 17. Den toxR genen av V. parahaemolyticus utnyttjades som PCR primer för V. parahaemolyticus identifiering på grund av dess närvaro i sjukdomsframkallande isolat. Från PCR-analysen, V. parahaemolyticus visade positiva resultat på grund av specificiteten av PCR primer av genen toxR mot V. parahaemolyticus. Ingen PCR-produkter från andra bakteriestammar upptäcktes. DPV toppströmmen erhålls efter en korsreaktivitet bedömning visade mycket tydlig detektion av V. parahaemolyticus i jämförelse med andra bakterier arter, som avbildas i figur 18. DPV signalen ökat antalet baspar minskade, på grund av den större mängden MB molekyler bundna till sonderna. V. parahaemolyticus kunde klart diskrimineras från de andra livsmedelsburna patogener som härmade miljö av mat provet.

Hjärtmusslor valdes ut som riktiga prover för DNA biosensor validering i denna studie eftersom de är populära ingredienser i flera typer av lokal mat. Det är väl känt att rå hjärtmusslor bär ofta patogena V. parahaemolyticus och kan överföra bakterierna till människor, speciellt om de är otillräckligt kyld under lagringen efter skörd65. Hjärtmussla prover behandlade gruppen var lagras vid-20 ° C under 24 h och utsätts för UV-ljus vid 20 ° C i 4 h före DNA extraktion under vårt förbehandling steg. Figur 19 visar att PCR-analys fann V. parahaemolyticus i både behandlat och obehandlat (spetsiga) proverna. Detta visas i Lane 7, 8, 9, 10, 11 och 12 korrelera med kolonin räknas i den föregående diskussionen. Ingen V. parahaemolyticus visas i behandlat och obehandlat (unspiked) proverna, som visas i Lane 1, 2, 3, 4, 5 och 6 i PCR-resultaten även antalet koloni visar sin närvaro i proverna. En möjlig anledning till detta är förekomsten av kontaminerande metaboliter såsom protein i extraherad DNA66.

Figur 20 fördelningsunderlaget upptäckt med hjälp av den utvecklade DNA biosensor, som framgångsrikt fastställt förekomsten av V. parahaemolyticus i den behandlade gruppen bestående av spetsiga och unspiked prover. Dessa resultat korrelerar positivt med de tidigare diskuterade PCR-resultat. Varje prov av PCR som visade positiva resultat upptäcktes med hjälp av PLA-stabiliserad elektrokemisk biosensor-tekniken, som är AuNP-baserade, och DPV toppens tydligt korresponderade med resulterande PCR intensitet banden (figur 19 och Figur 20). Dessa resultat indikerar att den föreslagna nanopartikel-baserade elektrokemisk sensorn i denna studie detekteras V. parahaemolyticus framgångsrikt i de riktiga prover, styrker att det är överlägsen PCR utan effekt på äktheten av resultaten.

Figure 1
Figur 1 : Absorbans PLA-AuNPs Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Röntgendiffraktion spektrum av PLA-AuNPs. Anpassad med tillstånd från ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : TEM frekvensfördelningen diameter och bilder av PLA-AuNPs på en mätning skala 50 nm. Omtryckt med tillåtelse från ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : EDX spectra och FESEM bilder av (a) bare SPCE och (b) SPCE/PLA-AuNPs. Omtryckt med tillåtelse från ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : Handlingen i peak nuvarande oxidation mot scan rate kvadratroten och cykliska voltamogrammen: (a) bare SPCE och (b) SPCE/PLA-AuNPs i 1.0 mmol L-1 K3[Fe(CN)6] (pH 7). Scan var 300, 250, 200, 150, 100 och 50 mV s1. Anpassad med tillstånd från ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6 : Impedans spektra av modifierade elektroder i 1.0 mmol L-1 Karlsson 3 [Fe(CN)6] (pH 7). Amplitud: 5 mV och frekvensområde: 0,1-105 Hz. anpassad med tillstånd från ref. [22]. Copyright (2016) Elsevier. Klicka här för att se en större version av denna siffra.

Figure 7
Figur 7 : Anodisk toppström för modified elektroder i 1.0 mmol L-1 Karlsson 3 [Fe(CN)6] (pH 7) på en avsökningshastighet av 0,1 V s -1 med hjälp av cyklisk voltametri mätning Klicka här för att se en större version av denna siffra.

Figure 8
Figur 8 : Effekt av koncentrationen för ssDNA immobilisering på SPCE/PLA-AuNPs i 0.1 mol L-1 PBS (pH 7) till scan priser på 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning Klicka här för att se en större version av denna siffra.

Figure 9
Figur 9 : Effekt ssDNA immobilisering tid på SPCE/PLA-AuNPs i 0.1 mol L -1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning Klicka här för att se en större version av denna siffra.

Figure 10
Figur 10 : SsDNA immobilisering temperaturens inverkan på SPCE/PLA-AuNPs på en avsökningshastighet av 0,1 V s -1 på 0,1 mol L -1 PBS (pH 7) efter en inkubationstid på 30 min i 20 µM MB med differential pulse voltametri mätning Klicka här för att se en större version av denna siffra.

Figure 11
Figur 11 : Effekt av hybridisering tid på SPCE/PLA-AuNPs/ssDNA i 0,1 mol L -1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning Klicka här för att se en större version av denna siffra.

Figure 12
Figur 12 : Hybridisering temperaturens inverkan på SPCE/PLA-AuNPs/ssDNA i 0,1 mol L -1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning. Omtryckt med tillåtelse från ref. [22]. Copyright (2016) Elsevier. Klicka här för att se en större version av denna siffra.

Figure 13
Figur 13 : Histogram över MB minskning toppströmmen använder olika typer av DNA i 0,1 mol L 1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB. Infällt illustrerar differential pulse voltamogrammen på samma villkor. Omtryckt med tillåtelse från ref. [22]. Copyright (2016) Elsevier. Klicka här för att se en större version av denna siffra.

Figure 14
Figur 14 : Histogram över MB minskning toppströmmen använder olika DNA-koncentration i 0,1 mol L 1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning. Omtryckt med tillåtelse från ref. [22]. Copyright (2016) Elsevier. Klicka här för att se en större version av denna siffra.

Figure 15
Figur 15 : En linjär plot av minskningen topp nuvarande MB mot loggen för olika DNA-koncentration i 0,1 mol L -1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning. Omtryckt med tillåtelse från ref. [22]. Copyright (2016) Elsevier. Klicka här för att se en större version av denna siffra.

Figure 16
Figur 16 : Effekten av olika hybridisering temperaturer på SPCE/PLA-AuNPs/ssDNA vid 6 månaders lagringsintervall (n = 3). Mätningarna gjordes i 0,1 mol L-1 PBS (pH 7) på en avsökningshastighet av 0,1 V s-1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning. Omtryckt med tillåtelse från ref. [22]. Copyright (2016) Elsevier. Klicka här för att se en större version av denna siffra.

Figure 17
Figur 17 : Agaros gelelektrofores-PCR amplifiering med hjälp av 16S rRNA-genen sekvensering produkter av utvalda bakterier från bakterier kultur. Lane M: 1kb DNA stege, Lane C−: negativ kontroll (sterilt destillerat vatten), Lane c +: positiv kontroll (DNA extraheras från E. coli används som mall), Lane EG: E. coli O157: H7, Lane CJ: C. jejuni , Lane BC: B. cereus, Lane KP: K. lunginflammation, Lane ST: S. typhimurium, Lane LM: L. monocytogenes, Lane SE: S. enterit, Lane VP: V. parahaemolyticus och Lane VV: V. alginolyticus vänligen klicka här för att visa en större version av denna siffra.

Figure 18
Figur 18 : Histogram över MB minskning toppströmmen för korsreaktivitet studie av de DNA biosensor mot olika livsmedelsburna patogener i 0,1 mol L -1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning. Omtryckt med tillåtelse från ref. [23]. Copyright (2017) Springer. Klicka här för att se en större version av denna siffra.

Figure 19
Figur 19 : Agaros gelelektrofores-PCR amplifiering produkter av V. parahaemolyticus från färska hjärtmussla prover. Lane M: 2ul av 100 bp DNA stege, Lane 1-3: obehandlad unspiked prover, Lane 4-6: behandlade unspiked prover, Lane 7-9: obehandlad spetsade prover, Lane 10-12: behandlade spetsade prover, Lane c +: positiv kontroll (V. parahaemolyticus ATCC 17802), Lane C-: negativ kontroll (sterilt destillerat vatten). Omtryckt med tillåtelse från ref. [23]. Copyright (2017) Springer. Klicka här för att se en större version av denna siffra.

Figure 20
Figur 20 : Histogram över MB minskning toppströmmen för detektion av V. parahaemolyticus i färska hjärtmussla prover med hjälp av DNA biosensor i 0,1 mol L-1 PBS (pH 7) på en avsökningshastighet av 0,1 V s-1 efter 30 min inkubation i µM 20 MB med differential pulse voltametri mätning. Omtryckt med tillåtelse från ref. [23]. Copyright (2017) Springer. Klicka här för att se en större version av denna siffra.

Elektroden sammansättning Inkubationstiden (h) Temperatur (° C) Tillväxt medier
Campylobacter jejuni 48 42 BA / BB
Listeria monocytogenes 48 30 TSA / TSB
Salmonella typhimurium 24 37 TSA / TSB
Salmonella enteritidis 24 37 TSA / TSB
Klebsiella pneumoni 24 37 EMBA / TSB
Escherichia coli O157: H7 24 37 MA / TSB
Bacillus cereus 24 37 MYPA / TSB
Vibrio alginolyticus 24 37 TSA + 3% NaCl/TSB+3% NaCl
Vibrio parahaemolyticus 24 37 CA/TSA+3% NaCl/TSB+3% NaCl

Tabell 1: Kultur villkoren för utvalda bakterier.

Prov POS. [° 2.] FWHM [° 2.] d-avståndet [Å] Naturgrafiten storlek (nm)
PLA-AuNPs 31.682 0.3149 2.8243 27

Tabell 2: Storleken på de PLA-AuNP crystallites. Anpassad med tillstånd från ref. [30]. Copyright (2016) Sociedade Brasileira de Química.

Modifierade elektrod % RSD (n = 6) Signalen reduktion (%) (n = 20)
Repeterbarhet Reproducerbarhet
SPCE/PLA-AuNPs 4,26 4.05 18

Tabell 3: egenskaper för modifierade elektroder om AuNPs och PLA-AuNPs modifieringen i K 3 [Fe(CN)6] med 1,0 mmol L -1 koncentration på en avsökningshastighet av 0,1 V s -1 . Anpassad med tillstånd från ref. [30]. Copyright (2016) Sociedade Brasileira de Química.

Elektroden sammansättning Jagpa (µA) Epa Selektivitet skattesats (%)
(n = 3) (V)
SPCE/PLA-AuNP/probe DNA 4.79 ± 0,10 -0.46 -
SPCE/PLA-AuNP/icke-komplementära DNA 3.25 ± 0,12 -0,44 67.85
SPCE/PLA-AuNP/3-baser avvikande DNA 1,05 ± 0,11 -0.45 21.92
SPCE/PLA-AuNP/1-base avvikande DNA 0,94 ± 0,12 -0.46 19.62
SPCE/PLA-AuNP/kompletterande DNA 0,73 ± 0,10 -0.45 15,24

Tabell 4: DPV selektivitet MB toppströmmen i 0,1 mol L -1 PBS (pH 7) på en avsökningshastighet av 0,1 V s -1 efter 30 minuters inkubation i µM 20 MB

Sammansättning av elektroderna Metod för detektion Linjära området (M) Detektionsgränsen (M) Referenser
3D AuNPs DPV 1,5 × 10-6 - 7.0 × 10-9 2,0 × 10-10 69
(+) AuNPs DPV 1,0 × 10-9 - 1,5 × 10-12 2.6 × 10-12 70
AuNPs/GR DPV 1,3 × 10-9 - 2,5 × 10-11 8,3 × 10-12 71
AuNPs-ADH-GSs DPV 5,0 × 10-8 - 3.0 × 10-13  3.0 × 10-13 72
AuNPs-MPTS DPV 5,0 × 10-9 - 1,0 × 10-11  5,0 × 10-11 73
AuNPs – gå DPV 1,0 × 10-9 - 1,0 × 10-14 3,5 × 10-15 74
CoS / AuNPs DPV 1,0 × 10-9 - 1,0 × 10-12 7.0 × 10-13 75
PLA-AuNPs DPV 2,0 × 10-8 - 2,0 × 10-13 5.3 × 10-12 Detta arbete

Tabell 5: Jämförelse av några av de nyligen utvecklade elektrokemiska DNA nanosensorer. Omtryckt med tillåtelse från ref. [22]. Upphovsrätt (2016) Elsevier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De kritiska steg i en ram för framgångsrik utveckling av denna typ av elektrokemisk biosensor är urval av lämpliga biologiska erkännande element för givaren (nukleinsyra eller DNA här); kemisk metod för att konstruera det fjärranalys lagret av givaren; transduktion material; optimering av DNA immobilisering och hybridisering; och validering av den utvecklade biosensor använder riktiga prover.

Core till en framgångsrik utveckling av en känslig och selektiv elektrokemiska DNA biosensor, är optimering av villkoret immobilisering och hybridisering. I detta arbete använde vi MB som den komplexa redox. Det finns olika principer för MB-DNA interaktioner: (i) av elektrostatiska växelverkan av MB katjoniska laddningen med fosfat ryggraden anjon laddningen av både ssDNA och dsDNA; (ii) genom MB interkalation genom framgångsrika införandet av MB mellan omväxlande G-C baspar i dsDNA; (iii) genom kovalent bindning till slutet av den mål ssDNA, som producerar en låg etikett densitet (en eller två MB molekyler för per DNA-strängen); och (iv) av MB interaktioner med en bas i ssDNA obundna guanin. Vi tillämpat den fjärde principen, som exakt identifierar V. parahaemolyticus från cross reaktivitet av bakterier och i färska hjärtmusslor. Efter oxidation av särskilt intresse fanns det en starkare samhörighet mellan MB och ssDNA. Hybridisering av ssDNA med dess kompletterande sekvens ersätter de bundna MB-molekylerna, och därmed minskar signalen.

Serien av experimentella resultat som presenterats ovan fokuserar på utvecklingen av en snabb metod för att upptäcka V. parahaemolyticus med hög selektivitet och känslighet enligt principerna för DNA hybridisering. Det första steget är syntes och karakterisering av polylactic acid-stabiliserad Guldnanopartiklar (PLA-AuNPs) för ändring av elektroden (siffrorna 1-6 och tabell 2). Kvaliteten på Guldnanopartiklar utvärderades med hjälp av UV-synliga spektroskopi (UV-Vis), röntgendiffraktion (XRD), fält-utsläpp Scanning Electron Microscopy (FESEM), Transmission Electron Microscopy (TEM), cyklisk voltametri (CV) och Impedansanalys. Den andra delen av utvecklingen involverade en elektrokemisk karaktärisering av modifierade elektroden (figur 7-12 och tabell 3-4) som beslutsamma framgångsrika förbättrande av modifierade elektroden i förhållande till den kala elektroden i villkor för att upptäcka händelsen hybridisering.

Det tredje steget i DNA baserat biosensor utvecklingen baserades på optimering av experimentella villkoren för händelsen hybridisering och tillämpningen av den utvecklade biosensor till upptäckten av den faktiska patogenen (siffrorna 13-20). Hybridisering händelsen som beslutsamma framgången för upptäckt av patogen bedömdes med hjälp av differential pulse voltametri (DPV). Positiv förekomsten av riktade patogenen indikerades genom minskning av nuvarande. Känsligheten hos de utvecklade biosensor utvärderades genom byggandet av en kalibreringskurva och beräkningen av LOD (figur 15). Den påhittade biosensor kunde specifikt särskilja V. parahaemolyticus från andra patogener baserat på de olika nivåerna av nuvarande minskning (siffror 17 och 18). Utvärdering av genomförbarheten av den utvecklade biosensor för detektion av V. parahaemolyticus i faktiska mat prov presenteras i figurerna 19 och 20 och positiva förekomsten av riktade patogenen indikeras genom reduktion av nuvarande . Framgångsrik utveckling av DNA-baserad biosensorer är starkt beroende av DNA sonden urval, förbättring av modifierade elektroden samt optimering av de experimentella förhållandena. DNA sonden här har anpassats från tidigare arbete Nakano67. Förbättring av modifierade elektroderna utfördes med hjälp av Guldnanopartiklar stabiliserad med polymjölksyra aktivera standardiseringen av nanosize. Guldnanopartiklar funktionen som electro katalytiska material68 och agera för att öka överföringshastigheten av elektronen och ger också en yta att förankra DNA sonden. De experimentella parametrarna var optimerad när det gäller temperatur och inkubation tid vilket är avgörande för DNA att bilda duplex. Hybridisering temperaturen påverkar avståndet mellan icke-specifika adsorption och detta ökar selektiviteten i sensorn. Inkubationstiden för hybridisering ökar chanserna för duplex bildandet. Immobilisering förfarandet måste optimeras för att kontrollera DNA sonden kommer att vara i lämplig riktning för duplex bildandet till formuläret.

Tabell 5 jämför ett urval av nyligen utvecklat elektrokemiska DNA biosensorer69,70,71,72,73,74,75 ,. DNA-baserade biosensing är en lovande metod för att ersätta molekylär baserade tekniker även om det finns några begränsningar som måste åtgärdas innan metoden kan vara bärbara nog för på platsen användning. Den största begränsningen är provet bearbetning DNA-extraktion som renhet och mängden DNA extraheras på plats är inte sannolikt att vara lika bra som utvinns av standarden lab-baserad metod. Det är dock ett lovande alternativ om den PCR och gel elektrofores kan ersättas med prov förbehandling system såsom simuleras.

DNA-baserade biosensorer är potentiellt användbara för många tillämpningar, inklusive medicinsk diagnostik, miljöövervakning och mat övervakning. Denna teknik gör det möjligt för online-övervakning av kvalitetskontroll processer samt point-of-care övervakning av patienter. Överförbarheten av hela sensorsystemet kommer att möjliggöra decentralisering av diagnostiska processer där konsumenten kan använda för upptäckande i bekvämligheten av deras hem.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Författarna vill erkänna stöd av Universiti Putra Malaysia.

Materials

Name Company Catalog Number Comments
Acetic acid Merck 100056
Chloroform Merck 102445
Diaminoethane tetraacetic acid Promega E5134
Dibasic sodium phosphate  Sigma-Aldrich S9763
Disodium hydrogen phosphate Sigma-Aldrich 255793
Ethanol  Sigma-Aldrich 16368
Gold (III) chloride trihydrate Sigma-Aldrich 520918
Hydrochloric acid Merck 100317
Methylene blue Sigma-Aldrich M44907
Monobasic sodium phosphate, monohydrate Sigma-Aldrich S3522
Phosphate-buffered saline Sigma-Aldrich P5119
Poly(lactic acid) resin, commercial grade 4042D NatureWorks 4042D
Potassium chloride R&M Chemicals 59435
Potassium dihydrogen phosphate Sigma-Aldrich P9791
Potassium hexacyanoferrate III R&M Chemicals 208019
Sodium acetate anhydrous salt Sigma-Aldrich S2889
Sodium chloride Sigma-Aldrich S9888
Trisodium citrate Sigma-Aldrich S1804
Tris(hydroxymethyl) aminomethane Fisher Scientific T395-100
Tris-Base Fisher Scientific BP152-500
2X PCR Master Mix with Dual-Dye Norgen Biotek 28240
Agarose gel Merck 101236
Bolton Agar Merck 100079
Bolton Broth Merck 100079
CHROMagar Vibrio CHROMagar VB910
dNTPs Promega U1511
Nuclease-free water Thermo Scientific R0581
Eosin methylene blue agar  Merck 101347
GelRed Biotium 41001
Glycerol Merck 104092
Go Taq Buffer Promega M7911
Loading dye 100 bp DNA ladder Promega G2101
Loading dye 1kb DNA ladder Promega G5711
Magnesium chloride Promega 91176
Mannitol egg yolk polymyxin agar Merck 105267
McConkey Agar Merck 105465
Nutrient Broth Merck 105443
Taq polymerase Merck 71003
Trypticase Soy Broth Merck 105459
Trypticase Soy Agar Merck 105458

DOWNLOAD MATERIALS LIST

References

  1. Gould, L. H., Rosenblum, I., Nicholas, D., Phan, Q., Jones, T. F. Contributing factors in restaurant-associated foodborne disease outbreaks, FoodNet sites, 2006 and 2007. Journal of Food Protection. 76, 1824-1828 (2013).
  2. Arvanitoyannis, I. S., Kotsanopoulos, K. V., Papadopoulou, A. Rapid detection of chemical hazards (toxins, dioxins, and PCBs) in seafood. Critical Reviews in Food Science and Nutrition. 54, 1473-1528 (2014).
  3. Robertson, L. J., Sprong, H., Ortega, Y. R., van der Giessen, J. W. B., Fayer, R. Impacts of globalisation on foodborne parasites. Trends in Parasitology. 30, 37-52 (2014).
  4. Sandilands, E. A., Bateman, D. N. The epidemiology of poisoning. Medicine. 44, 76-79 (2016).
  5. Boschi-Pinto, C., Velebit, L., Shibuya, K. Estimating child mortality due to diarrhoea in developing countries. Bulletin of the World Health Organization. 86, 710-717 (2008).
  6. Farthing, M. J. G. Diarrhoea: A Significant Worldwide Problem. International Journal of Antimicrobial Agents. 14, 65-69 (2000).
  7. World Health Organization. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015. 1-255 (2015).
  8. Yeung, M., Boor, K. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease. 1, 74-88 (2004).
  9. Sakazaki, R. Foodborne Diseases. Cliver, D. O., Riemann, H. P. Academic Press. 127-136 (2002).
  10. Grochowsky, J., Odom, S. R., Akuthota, P., Stead, W. Primary Septicemia and Abdominal Compartment Syndrome From Vibrio parahaemolyticus Infection in a 40-Year-Old Patient With No Known Immunocompromise. Infectious Disease in Clinical Practice. 22, (2013).
  11. Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Frontiers in Microbiology. 5, 805 (2014).
  12. Kalburge, S. S., Whitaker, W. B., Boyd, E. F. High-Salt Preadaptation of Vibrio parahaemolyticus Enhances Survival in Response to Lethal Environmental Stresses. Journal of Food Protection. 77, 246-253 (2014).
  13. Esteves, K., Hervio-Heath, D., Mosser, T., Rodier, C., Tournoud, M. G., Jumas-Bilak, E., Colwell, R. R., Monfort, P. Rapid proliferation of Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae during freshwater flash floods in French Mediterranean Coastal lagoons. Applied and Environmental Microbiology. 81, 7600-7609 (2015).
  14. Khandeparker, L., Anil, A. C., Naik, S. D., Gaonkar, C. C. Daily variations in pathogenic bacterial populations in a monsoon influenced tropical environment. Marine Pollution Bulletin. 96, 337-343 (2015).
  15. Caburlotto, G., Suffredini, E., Toson, M., Fasolato, L., Antonetti, P., Zambon, M., Manfrin, A. Occurrence and molecular characterization of Vibrio parahaemolyticus in crustaceans commercialised in Venice area, Italy. International Journal of Food Microbiology. 220, 39-49 (2016).
  16. Wong, H. C., Chen, M. C., Liu, S. H., Liu, D. P. Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries. International Journal of Food Microbiology. 52, 181-188 (1999).
  17. Rosec, J. P., Causse, V., Cruz, B., Rauzier, J., Carnat, L. The international standard ISO/TS 21872-1 to study the occurence of total and pathogenic Vibrio parahaemolyticus and Vibrio cholerae in seafood: ITS improvement by use of a chromogenic medium and PCR. International Journal of Food Microbiology. 157, 189-194 (2012).
  18. Maniyankode, R. A., Kingston, J. J., Murali, H. S., Batra, H. V. Specific identification of vibrio parahaemolyticus employing monoclonal antibody based immunoassay. International Journal of Pharmacy and Biological Sciences. 4, (2), B156-B164 (2013).
  19. Suffredini, E., Lopez-Joven, C., Maddalena, L., Croci, L., Roque, A. Pulsed-field gel electrophoresis and PCR characterization of environmental Vibrio parahaemolyticus strains of different origins. Applied and Environmental Microbiology. 77, 6301-6304 (2011).
  20. Bhattacharyya, N., Hou, A. A pentaplex PCR assay for detection and characterization of Vibrio vulnificus and Vibrio parahaemolyticus isolates. Letters in Applied Microbiology. 57, 233-240 (2013).
  21. da Silva, E. T. S. G., et al. Electrochemical Biosensors in Point-of-Care Devices: Recent Advances and Future Trends. ChemElectroChem. 4, (4), 778-794 (2017).
  22. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. Sensitive detection of multiple pathogens using a single DNA probe. Biosensors and Bioelectronics. 86, 398-405 (2016).
  23. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. A simple, portable, electrochemical biosensor to screen shellfish for Vibrio parahaemolyticus. AMB Express. 7, (1), 41 (2017).
  24. Zhang, J., Li, Z., Zhang, H., Wang, J., Liu, Y., Chen, G. Rapid detection of several foodborne pathogens by F0F1-ATPase molecular motor biosensor. Journal of Microbiological Methods. 93, 37-41 (2013).
  25. Barsan, M. M., Ghica, E. M., Brett, C. M. A. Portable biosensing of food toxicants and environmental pollutants. Nikolelis, D. P., Varzakas , T., Erdem, A., Nikoleli, G. P. CRC Press, Taylor & Francis Group. Boca Raton. 33-69 (2014).
  26. Kwun, J., Yun, S., Park, L., Lee, J. H. Development of 1,1'-oxalyldiimidazole chemiluminescent biosensor using the combination of graphene oxide and hairpin aptamer and its application. Talanta. 119, 262-267 (2014).
  27. Thavanathan, J., Huang, N. M., Thong, K. L. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms. International Journal of Nanomedicine. 10, 2711-2722 (2015).
  28. Hushiarian, R., Yusof, N. A., Abdullah, A. H., Ahmad, S. A. A., Dutse, S. W. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase. Analytical Chemistry Research. 6, 17-25 (2015).
  29. Dutse, S. W., Yusof, N. A., Ahmad, H., Hussein, M. Z., Zainal, Z., Hushiarian, R., Hajian, R. An Electrochemical Biosensor for the Determination of Ganoderma boninense Pathogen Based on a Novel Modified Gold Nanocomposite Film Electrode. Analytical Letters. 47, (5), 819-832 (2014).
  30. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hajian, R. Characterization of Polylactide-Stabilized Gold Nanoparticles and Its Application in the Fabrication of Electrochemical DNA Biosensors. Journal of the Brazilian Chemical Society. 27, (9), 1679-1686 (2016).
  31. Vongkamjan, K., Wang, S., Moreno Switt, A. I. Rapid detection of foodborne bacterial pathogens in seafood. Handbook of Seafood: Quality and Safety Maintenance and Applications. 247-257 (2016).
  32. Wang, F., Jiang, L., Yang, Q., Han, F., Chen, S., Pu, S., Vance, A., Ge, B. Prevalence and antimicrobial susceptibility of major foodborne pathogens in imported seafood. Journal of Food Protection. 74, (9), 1451-1461 (2011).
  33. Szermer-Olearnik, B., Sochocka, M., Zwolinska, K., Ciekot, J., Czarny, A., Szydzik, J., Kowalski, K., Boratynski, J. Comparison of microbiological and physicochemical methods for enumeration of microorganisms. Postepy Higieny i Medycyny Doswiadczalnej. 68, 1392-1396 (2014).
  34. Ivanov, I. G., Bachvarov, D. R. Determination of plasmid copy number by the "boiling" method. Analytical Biochemistry. 165, (1), 137-141 (1987).
  35. Gopireddy, V. R. Biochemical tests for the identification of bacteria. International Journal of Pharmacy and Technology. 3, (4), 1536-1555 (2011).
  36. Böhme, K., Fernández-No, I. C., Pazos, M., Gallardo, J. M., Barros-Velázquez, J., Cañas, B., Calo-Mata, P. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting. Electrophoresis. 34, (6), 877-887 (2013).
  37. Seoudi, R., Fouda, A. A., Elmenshawy, D. A. Synthesis, characterization and vibrational spectroscopic studies of different particle size of gold nanoparticle capped with polyvinylpyrrolidone. Physica B: Condensed Matter. 405, 906-911 (2010).
  38. Mishra, A., Harper, S., Yun, S. I. Interaction of biosynthesized gold nanoparticles with genomic DNA isolated from E. coli and S. aureus. Nanotechnology (IEEE-NANO). 1745-1750 (2011).
  39. Sugimoto, T. Formation of modoispersed nano- and micro-particles controlled in size, shape, and internal structure. Chemical Engineering and Technology. 26, 313-321 (2003).
  40. Rath, C., Sahu, K. K., Kulkarni, S. D., Anand, S., Date, S. K., Das, R. P., Mishra, N. C. Microstructure-dependent coercivity in monodispersed hematite particles. Applied Physics Letters. 75, 4171-4173 (1999).
  41. Abbas, M., Wu, Z. Y., Zhong, J., Ibrahim, K., Fiori, A., Orlanducci, S., Sessa, V., Terranova, M. L., Davoli, I. X-ray absorption and photoelectron spectroscopy studies on graphite and single-walled carbon nanotubes: Oxygen effect. Applied Physics Letters. 87, (5), 051923 (2005).
  42. Lim, S. C., Choi, Y. C., Jeong, H. J., Shin, Y. M., An, K. H., Bae, D. J., Lee, Y. H., Lee, N. S., Kim, J. M. Effect of gas exposure on field emission properties of carbon nanotubes arrays. Advanced Materials. 13, 1563-1567 (2001).
  43. Kim, B. H., Kim, B. R., Seo, Y. G. A study on adsorption equilibrium for oxygen and nitrogen into carbon nanotubes. Adsorption. 11, 207-212 (2005).
  44. Bard, A. J., Faulkner, L. R. Electrochemical methods: Fundamentals and applications. John Wiley & Sons Inc. (2000).
  45. Tan, Q., Wang, L., Ma, L., Yu, H., Ding, J., Liu, Q., Xiao, A., Ren, G. Study on anion electrochemical recognition based on a novel ferrocenyl compound with multiple binding sites. Journal of Physical Chemistry B. 112, 11171-11176 (2008).
  46. Manivannan, S., Ramaraj, R. Polymer-embedded gold and gold/silver nanoparticle-modified electrodes and their applications in catalysis and sensors. Pure and Applied Chemistry. 83, 2041-2053 (2011).
  47. Benali, O., Larabi, L., Traisnel, M., Gengembre, L., Hareka, Y. Electrochemical, theoretical and XPS studies of 2-mercapto-1-methylimidazole adsorption on carbon steel in 1 M HClO4. Applied Surface Science. 253, 6130-6139 (2007).
  48. Shi, Y., Wen, L., Li, F., Cheng, H. M. Nanosized Li4Ti5O12/graphene hybrid materials with low polarization for high rate lithium ion batteries. Journal of Power Sources. 196, 8610-8617 (2011).
  49. Bentiss, F., Traisnel, M., Lagrenee, M. The substituted 1,3,4-oxadiazoles: a new class of corrosion inhibitors of mild steel in acidic media. Corrosion Science. 42, 127-146 (2000).
  50. Wang, M., Gong, W., Meng, Q., Zhang, Y. Electrochemical DNA impedance biosensor for the detection of DNA hybridization with polymeric film, single walled carbon nanotubes modified glassy carbon electrode. Russian Journal of Electrochemistry. 47, 1368-1373 (2011).
  51. Herdt, A. R., Drawz, S. M., Kang, Y., Taton, T. A. DNA dissociation and degradation at gold nanoparticle surfaces. Colloids and Surfaces B: Biointerfaces. 51, (2), 130-139 (2006).
  52. Bhatt, N., Huang, P. J. J., Dave, N., Liu, J. Dissociation and degradation of thiol-modified DNA on gold nanoparticles in aqueous and organic solvents. Langmuir. 27, 6132-6137 (2011).
  53. Liu, X., Jang, C. H., Zheng, F., Jürgensen, A., Denlinger, J. D., Dickson, K. A., Raines, R. T., Abbott, N. L., Himpsel, F. J. Characterization of protein immobilisation at silver surfaces by near edge X-ray absorption fine structure spectroscopy. Langmuir. 22, 7719-7725 (2006).
  54. Willey, T. M., Andrew, L., Vance, T., Buuren, V., Bostedt, C., Terminello, L. J., Fadley, C. S. Rapid degradation of alkanethiol-based self-assembled monolayers on gold in ambient laboratory conditions. Surface Science. 576, (1), 188-196 (2005).
  55. Farjami, E., Clima, L., Gothelf, K., Ferapontova, E. E. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific. Analyst. 135, 1443-1448 (2010).
  56. Lin, X., Ni, Y., Kokot, S. An electrochemical DNA-sensor developed with the use of methylene blue as a redox indicator for the detection of DNA damage induced by endocrine-disrupting compounds. Analytica Chimica Acta. 867, 29-37 (2015).
  57. Zhang, F. T., Nie, J., Zhang, D. W., Chen, J. T., Zhou, Y. L., Zhang, X. X. Methylene Blue as a G-Quadruplex Binding Probe for Label-Free Homogeneous Electrochemical Biosensing. Analytical Chemistry. 86, 9489-9495 (2014).
  58. Ning, L., Li, X., Yang, D., Miao, P., Ye, Z., Li, G. Measurement of Intracellular pH Changes Based on DNA-Templated Capsid Protein Nanotubes. Analytical Chemistry. 86, 8042-8047 (2014).
  59. Sani, N. D. M., Heng, L. Y., Surif, S., Lazim, A. M., et al. AIP Conference Proceedings. Murad, A., et al. 1571, 636-640 (2013).
  60. Xu, P., Wang, J., Xu, Y., Chu, H., Shen, H., Zhang, D., Zhao, M., Liu, J., Li, G. Binding modes and interaction mechanism between different base pairs and methylene blue trihydrate: a quantum mechanics study. Advances in Experimental Medicine and Biology. 827, 187-203 (2015).
  61. Guo, Y., Chen, J., Chen, G. A label-free electrochemical biosensor for detection of HIV related gene based on interaction between DNA and protein. Sensors & Actuators, B: Chemical. 184, 113-117 (2013).
  62. Huang, K. J., Liu, Y. J., Wang, H. B., Wang, Y. Y., Liu, Y. M. Sub-femtomolar DNA detection based on layered molybdenum disulfide/multi-walled carbon nanotube composites, au nanoparticle and enzyme multiple signal amplification. Biosensors and Bioelectronics. 55, 195-202 (2014).
  63. Kong, R. M., Song, Z. L., Meng, H. M., Zhang, X. B., Shen, G. L., Yu, R. Q. A label-free electrochemical biosensor for highly sensitive and selective detection of DNA via a dual-amplified strategy. Biosensors and Bioelectronics. 54, 442-447 (2014).
  64. Rashid, J. I. A., Yusof, N. A., Abdullah, J., Hashim, U., Hajian, R. Novel Disposable Biosensor Based on SiNWs/AuNPs Modified-Screen Printed Electrode for Dengue Virus DNA Oligomer Detection. IEEE Sensors Journal. 15, 4420-4421 (2015).
  65. Yingkajorn, M., Sermwitayawong, N., Palittapongarnpimp, P., Nishibuchi, M., Robins, W. P., Mekalanos, J. J., Vuddhakul, V. Vibrio parahaemolyticus and its specific bacteriophages as an indicator in cockles (Anadara granosa) for the risk of V. parahaemolyticus infection in Southern Thailand. Microbial Ecology. 67, 849-856 (2014).
  66. Ahmad Ganaie, H., Ali, M. N. Short term protocol for the isolation and purification of DNA for molecular analysis. International Journal of Pharmaceutical Sciences Review and Research. 24, 266-270 (2014).
  67. Nakano, K., Kimura, T., Kitamura, Y., Ihara, T., Ishimatsu, R., Imato, T. Potentiometric DNA sensing platform using redox-active DNA probe pair for sandwich-type dual hybridization at indicator electrode surface. Journal of Electroanalytical Chemistry. 720-721, 71-75 (2014).
  68. Yang, J., Jim Yang, L., Heng-Phon, T., Gan-Moog, C. Inhibition of DNA hybridization by small metal nanoparticles. Biophysical Chemistry. 120, 87-95 (2006).
  69. Niu, L. M., Liu, F., Wang, W., Lian, K. Q., Ma, L., Shi, H. M., Kang, W. J. Electrochemical Behavior of Paraquat on a Highly Ordered Biosensor Based on an Unmodified DNA-3D Gold Nanoparticle Composite and Its Application. Electrochimica Acta. 153, 190-199 (2015).
  70. Li, Z., Miao, X., Xing, K., Zhu, A., Ling, L. Enhanced electrochemical recognition of double-stranded DNA by using hybridization chain reaction and positively charged gold nanoparticles. Biosensors and Bioelectronics. 74, 687-690 (2015).
  71. Niu, S., Sun, J., Nan, C., Lin, J. Sensitive DNA biosensor improved by 1,10-phenanthroline cobalt complex as indicator based on the electrode modified by gold nanoparticles and graphene. Sensors and Actuators B: Chemical. 176, 58-63 (2013).
  72. Yi, H., Xu, W., Yuan, Y., Bai, L., Wu, Y., Chai, Y., Yuan, R. A pseudo triple-enzyme cascade amplified aptasensor for thrombin detection based on hemin/G-quadruplex as signal label. Biosensors and Bioelectronics. 54, 415-420 (2014).
  73. Das, R., Sharma, M. K., Rao, V. K., Bhattacharya, B. K., Garg, I., Venkatesh, V., Upadhyay, S. An electrochemical genosensor for Salmonella typhi on gold nanoparticles-mercaptosilane modified screen printed electrode. Journal of Biotechnology. 188, 9-16 (2014).
  74. Han, X., Fang, X., Shi, A., Wang, J., Zhang, Y. An electrochemical DNA biosensor based on gold nanorods decorated graphene oxide sheets for sensing platform. Analytical Biochemistry. 443, (2), 117-123 (2013).
  75. Huang, K. J., Liu, Y. J., Zhang, J. Z., Cao, J. T., Liu, Y. M. Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification. Biosensors and Bioelectronics. 67, 184-191 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics