Site-verwiesene Immobilisierung von Knochen morphogenetische Protein 2 an feste Oberflächen durch Click-Chemie

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Biomaterialien, dotiert mit Knochen morphogenetische Protein-2 (BMP2) wurden als neue therapeutische Strategie zur Pseudarthrose Knochenbrüche zu heilen. Um Nebenwirkungen durch eine unkontrollierbare Freigabe des Faktors zu überwinden, schlagen wir eine neue Strategie zur Website-Faktors, wodurch Materialien mit verbesserten osteogene Funktionen direkt zu immobilisieren.

Cite this Article

Copy Citation | Download Citations

Siverino, C., Tabisz, B., Lühmann, T., Meinel, L., Müller, T., Walles, H., Nickel, J. Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry. J. Vis. Exp. (133), e56616, doi:10.3791/56616 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Verschiedene therapeutische Strategien für die Behandlung von nicht heilenden lange Knochendefekte wurden intensiv untersucht. Derzeit verwendeten Behandlungen vorhanden mehrere Einschränkungen, die auf die Verwendung von Biomaterialien in Kombination mit knochenbildenden Wachstums-Faktoren, wie zum Beispiel Knochen morphogenetische Proteine (BMPs) geführt haben. Häufig verwendete Absorption oder Kapselung Methoden erfordern supra-physiologischen BMP2, was in der Regel in einem so genannten ersten Ausbruch-Release-Effekt, der mehrere schwere Nebenwirkungen hervorruft. Eine mögliche Strategie, um diese Probleme zu überwinden wäre, das Protein kovalent zum Schafott zu koppeln. Darüber hinaus sollten Kupplung in gewissem Sinne ortsspezifische durchgeführt werden, um einen reproduzierbaren Produkt Ergebnis zu garantieren. Deshalb haben wir eine BMP2 Variante, in der eine künstliche Aminosäure (Propargyl-L-Lysin) in den Reifen Teil des Proteins BMP2 Codon Usage Expansion (BMP2-K3Plk) eingeführt wurde. BMP2-K3Plk wurde an funktionalisierten Perlen durch Kupfer katalysierten Azid-Alkinen Cycloaddition (CuAAC) gekoppelt. Die biologische Aktivität des gekoppelten BMP2-K3Plk wurde in Vitro nachgewiesen und die knochenbildenden Aktivität der BMP2-K3Plk-funktionalisiert Perlen wurde in zellbasierte Assays nachgewiesen. Die funktionalisierten Perlen in Kontakt mit C2C12 Zellen konnten Expression der alkalischen Phosphatase (ALP) in lokal begrenzten Nähe des Wulstes induzieren. Damit, mit dieser Technik funktionalisierten Gerüste hergestellt werden können, können die Zelldifferenzierung in Richtung einer osteogene Abstammung auslösen. Darüber hinaus sind niedrigere BMP2 Dosen ausreichend durch die kontrollierte Ausrichtung der Site-verwiesene gekoppelten BMP2. Mit dieser Methode sind BMPs immer ihre Rezeptoren auf der Zelloberfläche in der entsprechenden Ausrichtung ausgesetzt, die nicht der Fall ist, wenn die Faktoren über Site-verwiesene Kopplungstechniken gekoppelt sind. Das Produkt Ergebnis ist höchst steuerbar und somit Ergebnisse in Materialien mit homogenen Eigenschaften, verbessern ihre Anwendbarkeit für die Reparatur von kritischen Größe Knochen Defekte.

Introduction

Das ultimative Ziel des Tissue Engineering und Knochen Knochenregeneration ist die Überwindung der Nachteile und Einschränkungen bei gemeinsamen Behandlungen der Pseudarthrose Frakturen auftreten. Auto oder allo-Transplantationen werden vorwiegend als aktuelle Therapiestrategien eingesetzt, obwohl sie beide mehrere Nachteile haben. Die ideale Knochentransplantat sollte Osteogenesis durch Osteoinduction sowie Osteokonduktion, führend zu die Osteointegration des Transplantats in den Knochen induzieren. Heute ist nur Auto-Transplantation als der "Goldstandard" betrachtet, da es alle Eigenschaften eines idealen Knochentransplantat bietet. Leider stellt es auch wichtige negative Aspekte, wie langen OP-Zeiten und eine zweite Trauma-Website, die in der Regel mehr Komplikationen (z.B., chronische Schmerzen, Hämatom Formationen, Infektionen, kosmetische Fehler, etc.) mit sich bringt. Allogene Transplantate, haben auf der anderen Seite suboptimale Eigenschaften für alle allgemeines1. Alternative Bone Graft Technologien wurden in den letzten Jahren, mit dem Ziel, die Gerüste herstellen osteoinduktiv, osteokonduktiv, biokompatibel, und bioresorbierbaren verbessert. Da viele Biomaterialien nicht all diese knochenbildenden Merkmale zeigen, wurden verschiedene Wachstumsfaktoren, vor allem BMP2 und BMP7, aufgenommen um das osteogene Potenzial des bestimmten Gerüst2zu verbessern.

Als ein wesentliches Kriterium sollten solche Wachstumsfaktor-Delivery-Systeme eine kontrollierte Dosis Version im Laufe der Zeit bereitstellen, um die wesentlichen Ereignisse wie Zelle Rekrutierung und Bindung, Zelle Einwachsen und Angiogenese zu erleichtern. Jedoch immobilisiert BMPs sowie andere osteogene Wachstumsfaktoren wurden häufig nicht kovalent3. Verlockende Falle und Adsorption Techniken erfordern den Einsatz von supra-physiologischen Mengen an Protein durch einen ersten Ausbruch-Freisetzung, führt zu schweren Nachteilen in-vivo, in der Regel Auswirkungen auf das umliegende Gewebe durch Induktion Knochen Wucherung, Osteolyse, Schwellung und Entzündung4. Somit kann die Beibehaltung der Wachstumsfaktoren an der Lieferstelle für längere Zeit durch kovalente Immobilisierung Methoden erreicht werden. BMP2 chemisch modifiziert (Succinylated5, Schimmelpilzschäden6 oder biotinylierte7) entwickelt Heterodimere8oder BMP2 abgeleiteten Oligopeptide9 entwickelt und verwendet, um die Beschränkungen zu überwinden wurden im Zusammenhang mit Absorption. Die Bio-Aktivität diese Konstrukte ist jedoch nicht vorhersehbar, da die Anordnung möglicherweise die Bindung des immobilisierten Liganden an den zellulären Rezeptoren hemmt. Wie zuvor dargestellt ist es wichtig, dass alle vier Rezeptor-Ketten beteiligt an der Gründung der aktivierten Ligand-Rezeptor-Komplexe mit den immobilisierten BMP2 interagieren, um vollständig alle nachgelagerten Signalisierung Kaskaden10aktivieren.

Um die Probleme der inhomogenen Produkt Ergebnis mit Einschränkungen in Bezug auf die Bioaktivität, Stabilität und Bioverfügbarkeit von immobilisierten Faktor zu überwinden, entwarfen wir eine BMP-Variante kovalent binden Gerüste in gewissem Sinne Seite gerichtet. Diese Variante, genannt BMP2-K3Plk umfasst eine künstliche Aminosäure, die durch genetische Codon Erweiterung11eingeführt wurde. Diese Variante wurde erfolgreich für Gerüste mit einer kovalenten Kupplung Strategie und gleichzeitig seine biologischen Aktivität verbunden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

(1) Herstellung von BMP2 Variante BMP2-K3Plk

  1. Klonen von BMP2-K3Plk von Site-verwiesene Mutagenese mittels PCR 12
    1. Menschliche Reife BMP2 zu verstärken (hmBMP2) aus einer p25N-hmBMP2-Vektor (siehe Tabelle der Materialien) mit einem forward Primer (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') und eine rückwärts-Primer (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') Einführung einer Bernstein Stop-Codon ( TAG) an der Position der ersten Lysin Reife Teil BMP2´s. Durchführung der PCR-Reaktion mit 33,5 µL H2O, 10 µL des PCR-Reaktion-Mix, 1,5 µL 10 µM dNTP Stammlösung, 1,5 µL forward Primer (10 Pmol/µL), 1,5 µL des rückwärts-Primer (10 Pmol/µL) 1 µL p25N-hmBMP2 (10 ng/µL) , und 1 µL DNA-Polymerase (siehe Tabelle der Materialien) in einem Thermocycler (Denaturierung bei 95 ° C für 5 min, 30 Zyklen der Denaturierung bei 95 ° C für 1 min, Glühen bei 60 ° C für 1 min, Dehnung bei 72 ° C für 1 min und eine letzte Verlängerung bei 72 ° C für 10 min).
    2. Das PCR-Produkt mit einem kommerziell erhältlichen Kit nach Empfehlungen des Herstellers zu reinigen (siehe Tabelle der Materialien).
    3. Das PCR-Produkt mit dem Restriktionsenzym NdeI bei 37 ° C für 45 min. mit 16 µL von H2O, 3 µL der Verdauung Puffer, 10 µL DNA zu verdauen (20 ng/µL) und 1 µL Restriktionsenzym. Hitze-inaktivieren das Enzym bei 65 ° C für 5 min. verdauen das PCR-Produkt mit dem Restriktionsenzym BamHI bei 37 ° C für 1 h mit 16 µL von H2O, 3 µL der Verdauung Puffer, 10 µL DNA (20 ng/µL) und 1 µL Restriktionsenzym. Inaktivieren Sie Hitze-Enzym bei 80 ° C für 5 min.
    4. Die pET11a-PyrtRNA-Vektor mit NdeI bei 37 ° C für 2 h 45 min mit 16 µL von H2O, 3 µL der Verdauung Puffer, 10 µL DNA zu verdauen (20 ng / µL), und 1 µL Restriktionsenzym. Hitze-inaktivieren bei 65 ° C für 5 min. verdauen den pET11a-PyrtRNA-Vektor mit BamHI bei 37 ° C für 1 h mit 16 µL von H2O, 3 µL der Verdauung Puffer, 10 µL DNA (20 ng/µL) und 1 µL Restriktionsenzym. Wärme bei 80 ° C für 5 min zu inaktivieren.
    5. Unverdaute Vektor den verdauten Vektor trennen und Verdauung Reste von Agarose gel Elektrophorese (0,8 % Agarose, 60 min bei 100 V). Verbinden Sie den verdauten BMP2-K3TAG-Einsatz mit verdaute pET11a-PyrtRNA Rückgrat bei Raumtemperatur (RT) für 2 h mit 100 ng pET11a PyrtRNA Rückgrat und 34,5 ng BMP2-K3TAG einfügen (molares Verhältnis 1:3). Das Reaktionsgemisch enthält das DNA-Rückgrat und einfügen "," 2 µL Ligase Puffer, 1 µL DNA Ligase und H2O auf ein Gesamtvolumen von 20 µL.
    6. Führen Sie eine Co-Transformation des pET11a-PyrtRNA-BMP2-K3Plk und pSRF-Duett-PyrtRNAsynth in BL21(DE3) Bakterien:
      1. Fügen Sie 50 ng jedes Plasmid für Bakterien, legen Sie die Mischung auf Eis für 30 min, Hitzeschock bei 42 ° C für 50 s, für 5 min auf Eis legen, 500 µL Lysogeny Brühe (LB)-Medium in der Mischung hinzufügen und bei 300 u/min 60 min schütteln.
      2. 100 µL der bakteriellen Mischung auf vorgewärmten Kanamycin (50 µg/mL) zu verbreiten / Ampicillin (100 µg/mL) Platten, und über Nacht bei 37 ° c inkubieren
  2. Expression und Reinigung von BMP2-K3Plk 13 , 14
    1. Propagieren Sie eine einzige Kolonie über Nacht in 50 mL LB-Medium mit 50 µg/mL Kanamycin und 100 µg/mL Ampicillin bei 37 ° C.
    2. Verdünnen Sie Übernachtung Kulturen 01:20 in 800 mL tolle Brühe (TB) Medium mit 50 µg/mL Kanamycin und 100 µg/mL Ampicillin ergänzt, und bei 37 ° C zu wachsen Sie, bis ein OD600 von 0,7 erreicht ist. Fügen Sie Propargyl-L-Lysin, eine Endkonzentration von 10 mM. Sammeln Sie 100 µL Probe aus der Kultur vor Isopropyl-β-D-1-Thiogalactopyranoside (IPTG) Induktion.
    3. Gen-Expression durch die Zugabe von IPTG in einer Endkonzentration von 1 mM zu induzieren. Wachsen Sie die Kultur bei 37 ° C in einem Orbitalschüttler mit 180 u/min 16 h. Sammeln Sie 100 µL Probe aus der Kultur.
    4. Zentrifugieren der ganzen Kultur 9000 X g für 30 min. verwerfen des Überstands und Aufschwemmen der bakteriellen Pellets in 30 mL TBSE Puffer (10 mM Tris, 150 mM NaCl, 1 mM Ethylenediaminetetraacetic Säure (EDTA)) mit 1: 1000 (V/V) 2-Mercaptoethanol (frisch hinzugefügt).
      Achtung: Griff 2-Mercaptoethanol unter dem Abzug. Vermeiden Sie Kontakt mit Haut und Augen. Vermeiden Sie das Einatmen von Dampf oder Nebel. Alle Schritte Wiederfreisetzung mit Puffern mit 2-Mercaptoethanol unter dem Abzug.
    5. Eine leere Zentrifuge Becher wiegen und die resuspendierte Pellet in den leeren Becher zu übertragen. Zentrifugieren bei 6.360 x g für 20 min. überstand verwerfen und wiegen das Becherglas mit dem Pellet. Ziehen Sie das Gewicht des leeren Bechers um das Gewicht des Geschosses zu berechnen.
      Hinweis: Das Protokoll kann hier angehalten werden. Frieren Sie die Pellets bei-20 ° C kurzfristig oder bei-80 ° C auf lange Sicht. Tauen Sie bei der Wiederaufnahme des Protokolls die Pellets bei RT
    6. Aufzuwirbeln Sie das Pellet in STE-Puffer (10 mM Tris pH 8,0; 150 mM NaCl; 1: 1000 (V/V) 2-Mercaptoethanol (frisch hinzugefügt), 1 mM EDTA, 375 mM Saccharose). Verwenden Sie 200 mL STE Puffer für je 10 g Pellets.
    7. Beschallen Sie die Suspension auf Eis (10 min mit 40 s Puls, 20 s-Bremse und 30 % Amplitude). Zentrifugieren bei 6.360 x g für 20 min. überstand verwerfen und wiegen das Pellet. Wiederholen Sie die Beschallung und Zentrifugation Schritte 4 Mal.
    8. Das Pellet in 100 mL TBS-Puffer (10 mM Tris, 150 mM NaCl) aufzuwirbeln. Zentrifugieren bei 6.360 x g für 20 min. überstand verwerfen und wiegen Pellet.
    9. Aufschwemmen das Pellet in Nuklease Puffer (100 mM Tris, 1 mM EDTA, 3 mM MgCl2) mit frisch hinzugefügten 80 U/mL Nuklease (z.B.Benzonase) mit 10 mL/g Pellets. Inkubieren Sie die Suspension über Nacht bei RT auf eine mitreißende Platte (30 u/min).
    10. Triton Puffer (60 mM EDTA, 1,5 M NaCl, 6 % (V/V) 4-(1,1,3,3-Tetramethylbutyl) Phenyl-Polyethylenglykol) an der Aufhängung. Das Volumen der Triton Puffer hinzufügen entspricht 0,5 Volumen Teil der Federung. 10 min bei RT (nicht gerührt) inkubieren. Zentrifugieren bei 6.360 x g für 20 min. überstand verwerfen und wiegen das Pellet.
    11. Aufschwemmen das Pellet in TE-Puffer (100 mM Tris, 20 mM EDTA) mit 8 mL/g Pellets. Zentrifugieren bei 6.360 x g für 20 min. überstand verwerfen und wiegen das Pellet.
    12. Aufschwemmen der Pellets durch Zugabe von 4 mL/g 25 mM NaAc pH 5,0 und 5 mL/g von 6 M GuCl mit 1 mM Dithiothreitol (DTT) (frisch hinzugefügt). Inkubieren Sie die Suspension über Nacht bei 4 ° C auf eine mitreißende Platte (30 u/min).
    13. 75.500 x g für 20 min zentrifugieren. Der Überstand enthält nun das entfaltete Monomere BMP2 Protein. Sammeln Sie die überstand und Konzentrat dieser Extrakt 20 OD/ml mit einer 3 kDa Molekulargewicht (MWCO) Cut-off Membran in einer Konzentration Zelle (siehe Tabelle der Materialien).
    14. Hinzufügen der konzentrierten Monomere in einzelne Tropfen des Renaturierung Puffers (2 M LiCI, 50 mM Tris, 25 mM CHAPS, 5 mM EDTA, 1 mM Glutathion-Disulfid (GSSG), 2 mM Glutathion (GSH)) rühren (30 u/min). 120 h im Dunkeln bei RT inkubieren.
      Hinweis: Während dieses Inkubationszeit Umfaltung Occours. Die Lösung von diesem Schritt ab enthält die gefalteten dimeres BMP2-K3Plk.
    15. Stellen Sie den pH-Wert der Lösung bis 3.0 mit konzentrierter HCl. Dialyze die Lösung gegen 1 mM HCl. Konzentrat der dialysierten Lösung mit einer 10 kDa Molekulargewicht (MWCO) Cut-off Membran in eine konzentrierende Zelle.
    16. Equilibrate die Lösung durch Zugabe von Puffer A (20 mM NaAc, 30 % Isopropanol). Fügen Sie ein Volumen von Puffer A entspricht einem 30 % Volumen der Lösung. Zentrifugieren Sie die Lösung bei 4700 X g für 15 min.
    17. Equilibrate der Spalte für Ionenaustausch auf ein schnelles Protein Flüssigkeitschromatographie (FPLC) System15 mit 150 mL Puffer A. Last die Proteinlösung auf die äquilibriert Säule. Brüche mit einem linearen Farbverlauf des Puffers B (20 mM NaAc, 30 % Isopropanol, 2 M NaCl) eluieren mit 100 mL Puffer B. sammeln 2 mL Fraktionen.
      Hinweis: Konzentrieren Sie sich das Protein vor der Verladung in die Spalte nach der Spalte "Gesamt" Volumen. Das endgültige Protein-Laufwerk sollte < 5 % der Spalte "Gesamt".
    18. 20 µL der einzelnen Fraktionen durch die SDS-Polyacrylamid-Gel (12 %)-Elektrophorese (SDS-PAGE) 16 und Coomassie Brilliant Blue Färbung17 (siehe Tabelle der Materialien) zu analysieren.
      Hinweis: Die Coomassie Brilliant Blue gebeizt SDS-PAGE Gel zeigt Brüche, Dimere (26 kDa) und Brüche mit Monomeren (13 kDa) enthalten.
    19. Dimer-haltige Fraktionen zu bündeln. Dialyse am Pool Dimer mit Fraktionen über Nacht bei 4 ° C gegen 1 mM HCl (5 Liter Volumen). Das fertige Produkt mithilfe einer 10 kDa Konzentration zentrifugale Filtereinheit zu konzentrieren (siehe Tabelle der Materialien). Analysieren Sie das Endprodukt durch SDS-Polyacrylamid (12 %) Gelelektrophorese (SDS-PAGE) und Coomassie Brilliant blau färben.
      Hinweis: Die Band auf die Coomassie Brilliant blau gebeizt SDS-PAGE Gel sollte nur ein Band auf 26 kDa zeigen. Dies ist das Endprodukt der BMP2-K3Plk.

2. Optimierung des Kupfers (I)-katalysierte Alkinen-Azid Cycloaddition (CuAAC) Bedingungen

  1. Wirkung von Natrium-Ascorbat (NaAsc) und Kupfer (II) Sulfat (CuSO 4 ) auf Wildtyp BMP2 (BMP2-WT)
    1. Inkubieren 20 µM BMP2-WT mit unterschiedlichen Seitenverhältnissen der NaAsc CuSO4. Verwenden Sie in einem Volumen von 50 µL 0,5 mM NaAsc und 0,5 mM CuSO4 (ab Konzentration). Fahren Sie mit der folgenden Verhältnissen von NaAsc mit CuSO4: (1:1), (1.7:1), (10:1), (20: 1), CuSO4 Konzentration bei 0,5 mM konstant zu halten und die Konzentration der NaAsc entsprechend anpassen. Führen Sie die Reaktion in H2O auf einem rotierenden Mischer (20 u/min) über Nacht bei RT
    2. Bereiten Sie reduzierte Proben vor, indem man laden Puffer mit 5 % 2-Mercaptoethanol und inkubieren Sie Probe bei 95 ° C 6 min. Analyze reduziert und nicht-reduzierte Proben von SDS-Polyacrylamid gel (12 %)-Elektrophorese (SDS-PAGE) und Coomassie Brilliant blau färben. Die Coomasie gebeizt SDS-PAGE Gelen zeigen Bands im Bereich von 13 kDa (reduzierte Conditons) 26 kDa und höherem Molekulargewicht (Bedingungen nicht reduziert).
  2. Wirkung von Tris(3-hydroxypropyltriazolylmethyl) Amin (THPTA) auf der CuAAC-Reaktion
    1. Inkubieren 20 µM BMP2-K3Plk mit unterschiedlichen Seitenverhältnissen der THPTA CuSO4. Verwenden Sie 5 mM NaAsc und 200 µM 3-Azido-7-Hydroxycoumarin (NaAsc und 3-Azido-7-Hydroxycoumarin konstant halten). Als Konzentrationen ab verwenden Sie 50 µM THPTA und 0,5 mM CuSO4 . Verwenden Sie unterschiedliche Verhältnisse der THPTA CuSO4: (7:1); (10:1); (12:1); (15:1); (20:1). Reaktion in H2O (50 µL Gesamtvolumen) für 24 h bei RT auf einem rotierenden Mischer (20 u/min) durchführen.
    2. Kupplung wird 3-Azido-7-Hydroxycoumarin ein Fluoreszenzfarbstoff. Proben in reduziert und nicht reduziert Bedingungen vorbereiten und Auswerten von SDS-PAGE. Visualisieren Sie die Gele unter der Erregung-Kanal mit der spezifischen Wellenlänge für die 3-Azido-7-Hydroxycoumarin (λabs = 404 nm; λEm = 477 nm).

(3) kovalente Kupplung Technik der BMP2-K3Plk zu Bleiazid funktionalisiert Agarose Korne

  1. 2 h bei RT auf eine rotie inkubieren Sie 20 µM BMP2-K3Plk oder BMP2-WT (verwendet als Negativkontrolle) mit 20 µL der Azid-aktivierte Agarose Korne in einem Gesamtvolumen von 500 µL in Reaktion Puffer (0,1 M HEPES pH 7,0, 3,9 M Harnstoff, 50 µM CuSO4, 250 µM THPTA, 5 mM Natrium Ascorbat) NG-Mixer (20 u/min). Stoppen Sie die Reaktion durch Zugabe von 5 mM EDTA (Endkonzentration).
  2. 15 min auf einem rotierenden Mischer (20 u/min) bei RT inkubieren. Zentrifugieren Sie Proben bei 20.000 x g für 1 min bei RT. sammeln die Überstände.
  3. Waschen Sie die Pellets mit Perlen dreimal mit 1.000 µL HBS500 Puffer (50 mM HEPES, 500 mM NaCl), dreimal mit 1.000 µL 4 M MgCl2und zwei Mal mit 1.000 µL Phosphat gepufferte Kochsalzlösung (PBS). Bei jedem Waschschritt Zentrifugieren bei 20.000 x g für 1 min bei RT und Überstände zu sammeln. Lagern Sie gekoppelte Perlen in 1.000 µL PBS bei 4 ° c
    Achtung: Bitte nicht stören Sie die Wulst Pellet beim Entfernen des Überstands.

4. überprüfen das Vorhandensein und die biologische Aktivität von immobilisierten BMP2-K3Plk mit Texas rot beschriftet BMP Rezeptor ich ein Ektodomäne (BMPR-IA EG )

  1. Inkubieren Sie 50 µL der BMP2-K3Plk funktionalisiert Perlen mit 1 µM Texas rot beschriftet BMPR-IAEG mit 150 µL HBS500 Puffer (50 mM HEPES, 500 mM NaCl) bei RT für 1 h auf einem rotierenden Mischer (20 u/min).
  2. Zentrifugieren Sie die Perlen bei 20.000 x g für 1 min bei RT. verwerfen der Überstand. Waschen Sie die Perlen mit 1000 µL HBS500 Puffer. Wiederholen Sie eine zusätzliche Waschschritt 3 Mal. Zentrifuge bei 20.000 x g für 1 min bei RT nach jedem Waschen Schritt.
  3. Die Perlen in 500 µL PBS Aufschwemmen und 50 µL auf einen Glasobjektträger Deckel pipette. Setzen Sie den Mikroskop-Filter zwischen 561 oder 594 nm. Texas Red – BMPR-IAEGzu erkennen – BMP2-K3Plk funktionalisiert Perlen mit Fluoreszenz-Mikroskopie und fotografieren.

5. Messung der alkalischen Phosphatase (ALP) Ausdruck, die In vitro- Bioaktivität der BMP2-K3Plk produziert vor und nach der Koppelung Reaktion zu beweisen.

  1. Alkalische Phosphatase (ALP) assay
    1. Kultur Promyoblastic C2C12 Zellen (ATCC CRL-172) in Dulbeccos geändert Eagle Medium (DMEM) mit 10 % fetalen Kalb Serum (FCS), 100 U/mL Penicillin G und 100 µg/mL Streptomycin bei 37 ° C in eine feuchte Atmosphäre um 5 % CO2.
    2. Samen Sie C2C12 Zellen bei einer Dichte von 3 × 104 Zellen/Brunnen in einer 96-Well-Mikrotestplatte. Lassen Sie Zellen, die über Nacht legen. Medium zu entfernen und inkubieren Sie C2C12 Zellen in Anwesenheit von 0,5-200 nM BMP2-WT oder BMP2-K3Plk in 100 µL/Well des DMEM (2 % FCS, 100 U/mL Penicillin G und 100 µg/mL Streptomycin) bei 37 ° C in eine feuchte Atmosphäre bei 5 % CO2 für 72 h.
    3. Entfernen Sie Medium zu und waschen Sie Zellen mit 100 µL PBS pro Bohrloch. Lösen Sie Zellen bei RT für 1 h mit 100 µL/Well der Lyse Puffer (1 % NP-40, 0,1 M Glycin, pH 9,6, 1 mM MgCl2, 1 mM ZnCl2) auf ein Schütteln Platte (220 u/min).
    4. Die Zelle lysate fügen Sie 100 µL/Well der ALP Puffer (0,1 M Glycin, pH 9,6, 1 mM MgCl2, 1 mM ZnCl2 hinzu) mit 1 mg/mL p-Nitrophenylphosphate (frisch hinzugefügt).
    5. Messung der Absorption bei 405 nm in einem multiplate Reader nach dem Hinzufügen der ALP-Puffer und alle 5 Minuten, bis die Entwicklung der Farbe abgeschlossen ist. Dosis-Wirkungs-Kurven und EC50-Werte mit einem logistischen Modell generieren y = A2 + (1-2) / (1 + (X/x0)p).
  2. Alkalische Phosphatase (ALP) Färbung
    1. Kultur Promyoblastic C2C12 Zellen (ATCC CRL-172) in Dulbeccos geändert Eagle Medium (DMEM) mit 10 % fetalen Kalb Serum (FCS), 100 U/mL Penicillin G und 100 µg/mL Streptomycin bei 37 ° C in eine feuchte Atmosphäre um 5 % CO2.
    2. Samen Sie C2C12 Zellen bei einer Dichte von 3 × 104 Zellen/Brunnen in einer 96-Well-Mikrotestplatte. Lassen Sie Zellen, die über Nacht legen. Entfernen Sie Medium zu, und fügen Sie 20 µL/Well BMP2-K3Plk gekoppelt Perlen. BMP2-K3Plk gekoppelt Perlen sind in 1000 µL einer PBS-Suspension.
    3. Bereiten Sie eine Lösung von 0,4 % niedriger Schmelzpunkt Agarose in DMEM. In der Mikrowelle (600 W für 3 min) schmelzen Sie und abkühlen Sie lassen in einem Wasserbad bei 37 ° C bis zur Verwendung.
    4. Fügen Sie 20 µL 0,4 % niedriger Schmelzpunkt Agarose in jede Vertiefung (Bedeckung Perlen und Zellen). Zentrifuge bei 2000 X g für 5 min bei 20 ° C. Fügen Sie 80 µL DMEM (2 % FCS, 100 U/mL Penicillin G und 100 µg/mL Streptomycin) und Inkubation bei 37 ° C in eine feuchte Atmosphäre bei 5 % CO2 für 72 h.
    5. Entfernen Sie Mittel, ohne dabei die erstarrten 0,4 % Agarose trennen. Hinzufügen von Schritt 1 NBT 100 µL/Well/Substratlösung BCIP (Nitro-blau-Tetrazolium-Chlorid, 5-bromo-4-chloro-3'-indolyphosphate p-Toluidin-Salz).
    6. Analysieren Sie alkalische Phosphatase Färbung mit Lichtmikroskopie, sofort nachdem die violette Färbung erkennbar wird. Verwenden Sie helle Nahfeldmikroskopie und fotografieren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In diesem Artikel beschreiben wir eine Methode, um eine neue Variante der BMP2, BMP2-K3Plk, kovalent an handelsüblichen Azid funktionalisiert Agarose Korne (Abbildung 1) zu koppeln. Die Bioaktivität der produzierten BMP2-K3Plk-Variante wurde durch die Induktion der Genexpression der alkalischen Phosphatase (ALP) in C2C12 Zellen überprüft. Der in-vitro- Test zeigt ähnliche ALP Ausdruck Ebenen induziert durch Wildtyp BMP2 (BMP2-WT) und BMP2-K3Plk (Abbildung 2).

Die Redox-Reaktionen zwischen Kupfer (II) Sulfat (CuSO4) und Natrium Ascorbat (NaAsc) generieren reaktive Sauerstoffspezies, die möglicherweise Auswirkungen auf die strukturelle Integrität und beeinträchtigen somit die Bioaktivität der BMP2-K3Plk. Um die strukturelle Integrität des Proteins zu überprüfen, führten wir eine Übernachtung Inkubation mit CuSO4 und NaAsc, zeigt BMP2-WT-Abbau in einer Konzentration-abhängigen Weise (visualisiert durch SDS-PAGE unter reduzierten Bedingungen (Abbildung 3A1 )) und die Bildung von Multimere oder Aggregate an ca. 40 kDa (Bedingungen nicht reduziert) sichtbar (Abb. 3A-2). Proteinabbau, Tris zu vermeiden (3-Hydroxypropyltriazolyl-Methyl) Amin (THPTA) diente als ein Schutzmittel (Abb. 3 b). Die Verwendung von THPTA verhindert BMP2 Fragmentierung, während die Bildung von höheren Molekulargewicht Strukturen durch die Zugabe von THPTA nicht verhindert werden konnte. Weitere Verbesserungen der Reaktion behandelt die Zusammensetzung des Puffers Reaktion, die Reaktionstemperatur und Reaktionszeit (Daten nicht gezeigt). Das Protokoll beschriebenen hier Einzelheiten der letzten Errungenschaften zur Reaktion Puffer Zusammensetzung, Temperatur und Reaktionszeit.

Um zu bestätigen, dass BMP2-K3Plk nach Kupplung Bioaktivität behält, verwendeten wir Eindringmittel beschrifteten Rezeptor Ektodomäne Protein des Typs ich Rezeptor (BMPR-IAEG) zu zeigen, dass das immobilisierte Protein noch an diesen Rezeptor binden kann. Perlen beschichtet mit BMP2-K3Plk über CuAAC Chemie ergab Fluoreszenz, wenn mit dem Farbstoff-markierten BMPR-IAEG (Abbildung 4) inkubiert. In Kontrast, unbeschichteten Perlen oder Kügelchen, die mit BMP2-WT zeigte keine Fluoreszenz inkubiert wurden Ebenen Signal über Hintergrund (Daten nicht gezeigt)14.

Nach der Bestätigung Rezeptor bindende Funktionen von immobilisierten Liganden in Vitro, haben wir auch getestet ob biologische Reaktionen durch die funktionalisierten Perlen in eine zellbasierte Assays ausgelöst werden können. ALP vermittelten Färbung nur in diesen Zellen, die in direktem Kontakt mit der BMP2-K3Plk-funktionalisiert Perlen (Abbildung 5) waren aufgetreten. Dies bestätigt, dass das Protein ist in der Tat kovalent verknüpft, die Perlen und nicht nur absorbiert, da eine mehr ausgebreiteten Färbung bei größeren Entfernungen, die Perlen sonst beobachtet haben würde.

Figure 1
Abbildung 1: Darstellung der BMP2-K3Plk. (A) Darstellung der BMP2-K3Plk-Variante mit der Lokalisierung von der eingeführten Aminosäure-Substitution. (B) Kopplung Schema: BMP2-K3Plk CuAAC Reaktion mit Natriumazid funktionalisiert Perlen. Nachdruck mit freundlicher Genehmigung von Tabisz Et Al(angepasst). (2017): Site-verwiesene Immobilisierung von BMP-2: zwei Ansätze für die Herstellung von innovativen osteoinduktiv Gerüste. Biomakromoleküle. 18 (3), 695-708. (Copyright 2017 American Chemical Society) Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Bioaktivität von BMP2-Varianten. Vergleich der Bioactivities (ALP-Assay) BMP2-K3Plk und Wildtyp BMP2 (BMP2-WT). Die x-Achse repräsentiert die Konzentration von BMP2-WT oder BMP2-K3Plk in der Assay verwendet. Die EC50-Daten stellen Mittelwerte und Standardabweichungen der 4 einzelnen Experimenten (N = 4). Nachdruck mit freundlicher Genehmigung von Tabisz Et Al(angepasst). (2017): Site-verwiesene Immobilisierung von BMP-2: zwei Ansätze für die Herstellung von innovativen osteoinduktiv Gerüste. Biomakromoleküle. 18 (3), 695-708. (Copyright 2017 American Chemical Society) Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Wirkung des Reduktionsmittels auf die Integrität der BMP2. (A) BMP2-WT unterschiedlichen molaren Verhältnissen von Natrium-Ascorbat (NaAsc), Kupfer (II) Sulfat (CuSO4) ausgesetzt war. Die Proben wurden von SDS-PAGE und Coomassie Brilliant Blue Färbung unter reduzierten (Abbildung A1) und nicht-reduzierte Bedingungen (Abbildung A2) analysiert. In den reduzierten Bedingungen (A1) repräsentieren die roten Pfeilen gespalten BMP2-WT. Die roten Pfeile zeigen in den nicht-reduzierte Bedingungen (A2) Multimeric BMP2-WT. Die Bands gespalten BMP2 Arten sind durch einen blauen Pfeil gekennzeichnet. Legende: NCR - reduziert BMP2-WT unbehandelt; NC - BMP2-WT unbehandelt; 1:1 zu 20:1 - zunehmende molare Verhältnis von Natrium-Ascorbat CuSO4. (B) BMP2-K3Plk wurde mit 3-Azido-7-Hydroxycoumarin gekoppelt mit CuAAC Reaktionsbedingungen mit THPTA ergänzt. Kupplung wird 3-Azido-7-Hydroxycoumarin ein Fluoreszenzfarbstoff. Legende: NC - reagierte BMP2-WT mit 3-Azido-7-Hydroxycoumarin; 7:1 und 20:1 molare Verhältnis von THPTA zu CuSO4erhöhen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Bioaktivität von immobilisierten BMP2-K3Plk in-vitro-. Repräsentatives Bild der Interaktion von immobilisierten BMP2-K3Plk mit Texas-rot-markierten BMPR-IAEG. Nachdruck mit freundlicher Genehmigung von Tabisz Et Al(angepasst). (2017): Site-verwiesene Immobilisierung von BMP-2: zwei Ansätze für die Herstellung von innovativen osteoinduktiv Gerüste. Biomakromoleküle. 18 (3), 695-708. (Copyright 2017 American Chemical Society) Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Bioaktivität von immobilisierten BMP2-K3Plk in eine zellbasierte Assays. (A) repräsentatives Bild der alkalischen Phosphatase (ALP) Färbung nach Behandlung mit Perlen mit BMP2-K3Plk funktionalisiert Perlen gekoppelt. (B) alkalische Phosphatase (ALP) Färbung nach Behandlung mit löslichen 25 nM BMP2-K3Plk. Abdruck mit freundlicher Genehmigung von Tabisz Et Al(angepasst). (2017): Site-verwiesene Immobilisierung von BMP-2: zwei Ansätze für die Herstellung von innovativen osteoinduktiv Gerüste. Biomakromoleküle. 18 (3), 695-708. (Copyright 2017 American Chemical Society) Bitte klicken Sie hier für eine größere Version dieser Figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tagged Protein Variantenbildung durch genetische Codon Expansion ermöglicht die Einführung von verschiedenen nicht-natürliche Aminosäure-Analoga prinzipiell an jeder Stelle die primäre Proteinsequenz. Im Falle von BMPs wie BMP2, gemeinsame Stichwörter wie ein 6-Histidin (His)-Tag kann nur N-Terminal eingeführt, da die Protein´s C-terminalen Ende ist innerhalb der tertiären Proteinstruktur begraben, und somit nicht von außen zugänglich ist. An anderen Positionen kann die Größe des eingeführten Tags sehr wahrscheinlich bauliche Veränderungen führen, die folglich die BMP´s Bioaktivität zu verwischen. Weiter, Einführung einer Mutation in die BMP2 Sequenz refolding Wirksamkeit beeinflussen kann, und kann auch andere Protein-Parameter wie dem isoelektrischen Punkt des modifizierten Proteins ändern. So müssen jeden einzelner Schritt in einem etablierten Protein-Produktion-Protokoll möglicherweise entsprechend den veränderten Protein Variant´s Eigenschaften angepasst werden. Die Produktion von BMP2-K3Plk benötigt in der Tat eine Änderung der etablierten Methode für den Ausdruck der Wildtyp BMP2. Unterschiedliche Kulturzeiten oder Propargyl-L-Lysin (Plk) Konzentrationen wurden getestet (Daten nicht gezeigt) um den höchsten Ausdruck Ertrag zu erreichen. Umfaltung, erforderten Trennung und Reinigung Schritte zum Glück nicht weitere Anpassungen. Wir haben bereits berichtet, dass bei anderen BMP2 Varianten in unserem Labor hergestellt, einige Protein-Eigenschaften erheblich verändert wurden die erforderliche Änderung der mehrere Schritte der BMP Produktion Methode18. Die produzierten BMP2-K3Plk zeigte biologischen Aktivität vergleichbar mit derjenigen der Wildtyp-Protein. Ein Unterschied tritt bei hohen Konzentrationen von BMP2, wahrscheinlich als Folge eine geringere Löslichkeit der BMP2-K3Plk Variante im Vergleich zum Wildtyp BMP2 Medium.

Trotz der bekannten Vorteile von Kupfer-katalysierte Azid-Alkinen Cycloaddition (CuAAC)19sollte CuAAC Reaktionen auf bestimmte Anwendungen sorgfältig angepasst werden. Wir haben gezeigt, wie BMP2 fragmentiert werden können, oder erstellen Sie Aggregate oder Multimere aufgrund der starken Reduzierung Reaktionsbedingungen. So mussten alle Reaktionsparameter im Detail analysiert werden, um Bedingungen zu finden, die das Protein unberührt lassen.

Unser Ansatz kovalent BMP2 Variante zu Bleiazid funktionalisiert Agarose Korne von Click Chemie koppeln konnte mit hohem Wirkungsgrad, wodurch funktionalisierten Perlen osteogene Differenzierung in-vitro-Triggerung realisiert werden. Als Wildtyp BMP2 Protein stattdessen bei der Reaktion mit den Perlen verwendet wurde, konnten wir beobachten, dass nur schwache Anfärbung der ALP Ausdruck, darauf hinweist, dass die Kupplung in der Tat sehr spezifisch über die Propargyl-L-Lysin-Reste der BMP2-K3Plk ist aufgetreten.

Diese Positionsdaten Kupplung Besonderheit spiegelt eine große Verbesserung im Vergleich zu der Immobilisierung Verfahren im Zusammenhang mit klassischen NHS/EDC-Chemie. In solchen Fällen tritt zufällig Kupplung, vor allem mit der primären Amin Gruppen im Lysin Rückstände vorhanden. Das gekoppelte Protein hat eine Variable knochenbildenden Aktivität aufgrund der Vielzahl der möglichen Verbindungen zum Schafott, führt zu unterschiedlichen Ausrichtungen des Proteins in Richtung Zell-Rezeptoren.

Die Verwendung von Website-Direct immobilisierten BMP2 könnte überwinden, die genannten Nachteile im Zusammenhang mit hohen Dosen von löslichen BMP2 die Knochenbildung induzieren benötigt werden. Darüber hinaus die Ergebnisse zeigen deutlich, dass bestimmte zellulären Reaktionen, wie z. B. die osteogene Differenzierung von C2C12 Zellen, werden völlig von immobilisierten BMP2 initiiert, obwohl neuere Studien, die behaupten, dass Signal Transduktion erfordert Endozytose von der Liganden/Ligand-Rezeptor-Komplex20,21. Unsere Ergebnisse sind in Übereinstimmung mit anderen Studien, die zeigen, dass BMP2, die kovalent verbunden (aber nicht Site-verwiesene) auf nicht-Endocytosable Oberflächen, noch Osteoblasten Differenzierung22induzieren kann.

Wenn man bedenkt, dass wir die Kupplung Reaktion supra-physiologischen Konzentrationen von BMP2 gearbeitet haben, könnte die Menge an immobilisierte BMP2 weiter reduziert werden, bei gleichzeitiger Einsparung noch die knochenbildenden Eigenschaften der Perlen. Vor solchen Optimierungsschritte muss jedoch das BMP2-K3Plk-funktionalisiert Gerüst in tierexperimentellen Studien beweisen seine osteogene Potenzial in Vivogetestet werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären keine konkurrierenden finanziellen Interessen.

Acknowledgments

Die Autoren danken Dr. M. Rubini (Konstanz, Deutschland), für die das Plasmid Pyrrolysyl-tRNA kodieren und für die Bereitstellung von pRSFduet-PyrtRNAsynth die entsprechende Aminoacyl-tRNA Synthestase Codierung.

Materials

Name Company Catalog Number Comments
Material
1-Step NBT/BCIP Thermo Fisher 34042 Add solution to cells
3-Azido-7-hydroxycoumarin BaseClick BCFA-047-1 Chemical used for click reaction
Agarose low melting point Biozym 840101 Agarose for ALP assay 
Azide agarose beads Jena Bioscience CLK-1038-2 Beads used for reaction
BamHI (Fast Digest enzyme) Thermo Fisher Scientific FD0054 Restriction enzyme
BMP receptor IA (BMPR-IAEC) -- -- Produced in our lab
Coomassie Brilliant Blue G-250 Dye Thermo Fisher Scientific 20279 Chemical used for Coomassie Brilliant blue staining of SDS PAGE
Copper (II) sulfate anhydrous (CuSO4) Alfa Aesar A13986 Chemical used for click reaction
DNA Polymerase and reaction buffer  Kapabiosystems KK2102 KAPA HiFi PCR Kit
Dulbecco’s modified Eagle’s medium (DMEM) GlutaMAX Gibco 61965-026 Cell culture media
ethylenediaminetetraacetic acid (EDTA) Sigma Aldrich GmbH E5134-1kg Chemical used to stop click reaction
Isopropyl ß-D-1-thiogalactopyranoside (IPTG) Carl Roth GmbH 2316.5 Bacteria induction (1mM final concentration) 
NdeI (Fast Digest enzyme) Thermo Fisher Scientific ER0581 Restriction enzyme
NHS-activated Texas Red Life technologies T6134 Coupled to receptor
P- Nitrophenyl Phosphate Sigma Aldrich GmbH N4645-1G Alkaline Phosphatase
p25N-hmBMP2  -- -- Plasmid kindly provided from Walter Sebald to J. Nickel
pET11a-pyrtRNA -- -- Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
propargyl-L-lysine (Plk) -- -- Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
pSRFduet-pyrtRNAsynth -- -- Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
Qiagen Gel Extraction Kit Qiagen 28704 Gel Purification
Qiagen PCR purification Kit Qiagen 28104 PCR Purification 
Sodium L-ascorbate Sigma Aldrich GmbH A7631-100G Chemical used for click reaction
T4 DNA Ligase ThermoScientific EL0011 Ligation 
tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) BaseClick BCMI-006-100 Chemical used for click reaction
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol Sigma Aldrich GmbH X100-1L Triton X 100 
Name Company Catalog Number Comments
Equipment
Amicon concentrating cell 400 ml  Merck KGaA UFSC40001 Concentrating unit
Amicon Ultra-15 Centrifugal Filter Units Merck KGaA UFC901024 Concentrating centrifugal unit
ÄKTA avant FPLC ÄKTA -- FPLC machine
Avanti J-26XP Beckman Coulter  393124 Centrifuge for bacterial culture
Bacterial Shaking Incubator Infors HT Shaking incubator for bacterial culture
FluorChem Q system proteinsimple -- Imaging and analysis system for SDS-PAGE
Fluorescent miscroscope Keyence BZ-9000 (BIOREVO)
Fractogel® EMD SO3- (M) Merck KGaA 116882 Ion Exchange Chromatography column material
Greiner CELLSTAR® 96 well plates Sigma M5811-40EA 96 well plates for cell culture (ALP Assay)
Heraeus Multifuge X1R ThermoScientific -- Centrifuge
M-20 Microplate Swinging Bucket Rotor ThermoScientific 75003624 Rotor for Microcentrifuge for plate during ALP staining
Microcentrifuge - 5417R Eppendorf -- Centrifuge
OriginPro 9.1 G  OriginLab -- software for stastic analysis of ALP assay data
Polysine Slides ThermoScientific 10143265 microscope slides
Rotor JA-10 Beckman Coulter  -- rotor for Avanti J-26XP centrifuge
Rotor JLA 8.1 Beckman Coulter  -- rotor for Avanti J-26XP centrifuge
Rotor JA 25.50 Beckman Coulter  -- rotor for Avanti J-26XP centrifuge
Tecan infinite M200 multiplate reader Tecan Deutschland GmbH -- Multiplate reader for ALP assay
Thermocycler - Labcycler Gradient SensoQuest GmbH -- PCR
TxRed - microscope filter Keyence Filter for fluorescent microscope 
Ultrafiltration regenerated cellulose discs 3 kDa Merck KGaA PLBC04310 used with amicon concentrating cell 400ml
Ultrafiltration regenerated cellulose discs 10 kDa Merck KGaA PLGC04310 used with amicon concentrating cell 400ml

DOWNLOAD MATERIALS LIST

References

  1. Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. Bone substitutes: An update. Injury. 36, Suppl 3. S20-S27 (2005).
  2. Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations. Biofactors. 40, (5), 459-481 (2014).
  3. Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. Localized delivery of growth factors for bone repair. Eur J Pharm Biopharm. 58, (2), 197-208 (2004).
  4. Haidar, Z. S., Hamdy, R. C., Tabrizian, M. Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery. Biotechnol Lett. 31, (12), 1817-1824 (2009).
  5. Hollinger, J. O., Uludag, H., Winn, S. R. Sustained release emphasizing recombinant human bone morphogenetic protein-2. Adv Drug Deliv Rev. 31, (3), 303-318 (1998).
  6. Uludag, H., et al. Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model. J Biomed Mater Res. 50, (2), 227-238 (2000).
  7. Uludag, H., Golden, J., Palmer, R., Wozney, J. M. Biotinated bone morphogenetic protein-2: In vivo and in vitro activity. Biotechnol Bioeng. 65, (6), 668-672 (1999).
  8. Aono, A., et al. Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer. Biochem Biophys Res Commun. 210, (3), 670-677 (1995).
  9. Suzuki, Y., et al. Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo. J Biomed Mater Res. 50, (3), 405-409 (2000).
  10. Knaus, P., Sebald, W. Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily. Biol Chem. 382, (8), 1189-1195 (2001).
  11. Wang, L., Xie, J., Schultz, P. G. Expanding the genetic code. Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).
  12. Costa, G. L., Weiner, M. P. Rapid PCR site-directed mutagenesis. CSH Protoc. 2006, (1), (2006).
  13. Kirsch, T., Nickel, J., Sebald, W. Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2. FEBS Lett. 468, (2-3), 215-219 (2000).
  14. Tabisz, B., et al. Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds. Biomacromolecules. 18, (3), 695-708 (2017).
  15. Duong-Ly, K. C., Gabelli, S. B. Using ion exchange chromatography to purify a recombinantly expressed protein. Methods Enzymol. 541, 95-103 (2014).
  16. Brunelle, J. L., Green, R. One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE). Methods Enzymol. 541, 151-159 (2014).
  17. Brunelle, J. L., Green, R. Coomassie blue staining. Methods Enzymol. 541, 161-167 (2014).
  18. Kirsch, T., Nickel, J., Sebald, W. BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II. EMBO J. 19, (13), 3314-3324 (2000).
  19. Hein, J. E., Fokin, V. V. Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides. Chem Soc Rev. 39, (4), 1302-1315 (2010).
  20. Alborzinia, H., et al. Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists. J Cell Sci. 126, (Pt 1), 117-127 (2013).
  21. Paarmann, P., et al. Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling. Int J Biochem Cell Biol. 76, 51-63 (2016).
  22. Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation. Acta Biomater. 8, (2), 772-780 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics