Надежные ДНК изоляции и высокопроизводительного секвенирования строительство библиотеки для образцов гербария

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Эта статья демонстрирует подробный протокол для изоляции ДНК и высокопроизводительного секвенирования библиотека строительство из материалов гербариев, включая спасение исключительно низкого качества ДНК.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Гербариев являются незаменимым источником растительного материала, который может использоваться в различных биологических исследований. Использование образцов гербария связано с рядом проблем, включая пример сохранения качества, деградации ДНК и разрушительной выборки редких образцов. Для того, чтобы более эффективно использовать гербарий материал в большой последовательности проектов, необходим надежный и масштабируемый метод подготовки ДНК изоляции и библиотека. Этот документ демонстрирует надежный, начало в конец протокол для ДНК изоляции и высок объём библиотека строительства от образцов гербария, не требуют изменений для отдельных образцов. Этот протокол является специально для низкого качества сушеных растений материала и принимает преимущество существующих методов путем оптимизации измельчения тканей, изменения выбора размера библиотеки и представляя шаг необязательный reamplification для низкой урожайностью библиотек. Reamplification библиотек ДНК низкой урожайностью может спасти образцов, полученных от образцов незаменимым и потенциально ценный гербарий, отрицая необходимость дополнительных деструктивных выборки и без внесения заметных последовательности смещения для общего Филогенетические приложений. Протокол был протестирован на сотни видов травы, но ожидается быть адаптированы для использования в других линий завода после проверки. Этот протокол может быть ограничено путем крайне деградировавших ДНК, где фрагментов нет нужного размера в диапазоне размеров, и вторичных метаболитов в некоторых растительных материалов, которые препятствуют чистый изоляции ДНК. В целом этот протокол вводит быстрый и всеобъемлющий метод, который позволяет для изоляции ДНК и библиотека подготовка 24 проб в меньше чем 13 h, с только 8 h активного практического времени с минимальными изменениями.

Introduction

Гербарий коллекции являются потенциально ценным источником как видов, так и геномного разнообразия для исследований, включая филогенетики1,2,3, популяционной генетики4,5, сохранению Биология6, инвазивные виды биологии7и черта эволюции8. Возможность получения богатого разнообразия видов, популяций, географических точках, и моменты времени подчеркивает «сундук»9 это гербария. Исторически деградированных характер гербарий, полученных ДНК препятствовало ПЦР-проектов на базе, часто relegating исследователей с использованием только маркеры в высокой копии, например регионов геномом хлоропластов или внутренней трансляции распорку (СТС) о рибосомных РНК. Качества образцов и ДНК широко зависят методы сохранения9,10, с двуцепочечные разрывы и фрагментации от жары, используемых в процессе сушки, будучи наиболее распространенных форм ущерба, создание так называемые 90% ДНК карцер, заполнена на основе ПЦР исследования11. Помимо фрагментации второй наиболее распространенной проблемой в гербарий геномики является загрязнение, такие как, производный от эндофитные грибов13 или грибов приобрел посмертных после сбора, но до монтажа в гербарий12, хотя Эта проблема может быть выполнено bioinformatically, учитывая право грибковых базы данных (см. ниже). Третий и менее распространенные, проблема изменения последовательности через цитозина дезаминирование (C/G→T/A)14, хотя он считается низкой (~ 0.03%) в гербарий образцов11. С появлением высокопроизводительного секвенирования (HTS) вопрос о фрагментации может быть преодолена с короткой читает и последовательности глубины12,15, позволяя геномных данных приобретение от многочисленных образцов с низким качеством ДНК и иногда даже разрешительные весь геном последовательности15.

Гербарий образцы становится все более часто используются и более крупный компонент филогенетических проектов16. Текущий вызов с использованием образцов гербария для HTS неизменно является получение достаточных двойной мель ДНК, является необходимым условием для последовательность протоколов, от многочисленных видов своевременно, без необходимости оптимизации методов для отдельных образцы. В этом документе протокол для экстракции ДНК и библиотека подготовки образцов гербария показано что использует преимущества существующих методов и изменяет их для быстрого и воспроизводимые результаты. Этот метод позволяет для полной обработки от образца к библиотеке 24 пробы в 13 h, с 8 h практическое время, или 16 h, с 9 ч практический время, когда требуется дополнительный reamplification шаг. Одновременная обработка более образцов является достижимым, хотя ограничивающим фактором является мощности центрифуг и технических навыков. Протокол призван требовать только в типичных лабораторное оборудование (Термоциклер, центрифуги и магнитные стенды) вместо специализированного оборудования, такие как распылитель или sonicator, для сдвига ДНК.

Размер фрагментов ДНК качество и количество сдерживающими факторами для использования образцов гербария в высокопроизводительного секвенирования экспериментов. Другие методы для изоляции гербарий ДНК и создания высокопроизводительного секвенирования библиотек продемонстрировали полезность использования как мало, как 10 нг16ДНК; Однако они требуют экспериментально определить оптимальное количество PCR циклов, необходимых для подготовки библиотеки. Это становится нецелесообразным, когда решения с весьма небольшим количеством жизнеспособных двойной мель ДНК (dsDNA), как некоторые образцы гербарий производят только достаточное количество ДНК для приготовления одной библиотеки. Метод, представленные здесь использует единый количество циклов независимо от качества образцов, поэтому не ДНК теряется в шагов оптимизации библиотеки. Вместо этого шаг reamplification вызывается, когда библиотеки не соответствуют минимальной суммы, необходимой для виртуализации. Многие образцы гербарий редки и имеют мало материала, что делает его трудно оправдать разрушительной выборки во многих случаях. Чтобы противостоять этому, представленный протокол позволяет dsDNA ввода размеров менее 1,25 нг в процесс подготовки Библиотека, расширение сферы применения жизнеспособных образцов для высокопроизводительного секвенирования и свести к минимуму потребность в разрушительной выборки образцов.

Следующий протокол оптимизирован для трав и протестированы на сотни различных видов из образцов гербария, хотя мы ожидаем, что протокол может применяться для многих других групп растений. Она включает в себя шаг необязательный восстановления, который может использоваться для сохранения низкого качества или редких образцов. Основываясь на более чем двух сотен гербарий образцов испытания, этот протокол работает на образцах с низкой ткани ввода и качества, позволяя для сохранения редких образцов через минимальным разрушительным выборки. Здесь показано, что этот протокол может обеспечить высокое качество библиотек, которые можно упорядочивать для проектов на базе phylogenomics.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. до начала

  1. Сделать свежий цетиловый триметиламмония бромид (CTAB) буфера17 , добавив 20 g CTAB, 10 g поливинилпирролидона (ПВП) 40, 100,0 мл 1 М трис рН 8,0, 40 мл 0,5 М Этилендиаминтетрауксусная кислота (ЭДТА) рН 8,0, 280.0 мл 5 М NaCl и 400.0 мл реактива воды вместе и довести общий объем до 1 Л, с использованием реагентов класс воды. Отрегулируйте пэ-аш до 8.0.
    Примечание: Дополнительные реагенты могут добавляться к CTAB в зависимости от вторичных соединений в отдельных таксонов. См Allen et al. 18 для тщательного список добавка реагентов.
  2. 10 мкл β-меркаптоэтанол 5 мл CTAB буфера.
    Примечание: это может быть подготовлен в пакеты по 50 мл и хранится при комнатной температуре 3 – 4 недель.
    1. CTAB раствор в ванну с водой 65 ° C тепла.
  3. Холод ступок и пестиков в-20 ° C по меньшей мере 20 мин.
  4. Метка 4 комплекта 2 x n 2-мл пробирок (где n = число выборок). Положите 1 комплект помечены трубы на льду.
  5. Холод изопропиловый спирт на льду или в морозильной камере-20 ° С.
  6. Удаления твердой фазы реверсивные иммобилизации (ОСПР) бисер (см. Таблицу материалы) из холодильника и дать им возможность сбалансировать до комнатной температуры (по крайней мере 30 минут).
  7. Подготовка 80% этанола.
  8. Выберите образцы гербарий для добычи и извлечения ~ 1 см2или 10 мг, ткани в образец, предпочтительно листовой материал.

2. ДНК добыча

  1. Растереть2 ~ 1 см предварительно гербарий ткани с помощью prechilled ступок и пестиков. Добавьте жидкого азота и стерилизовать 30 – 50 мг песка. Растереть до ткани превращается в мелкий порошок.
    Примечание: желательно 10 мг или больше ткани, но менее также работал в некоторых случаях. После испарения жидкого азота, добавьте больше при необходимости до тех пор, пока ткань полностью землю. Другой общий метод для подрыва клеток и тканей является использование било шарик. Однако этот метод оказался не хорошо работать для образцов, используемых в этих экспериментах.
  2. Перевод замороженных порошка на два 2 мл пробирок (добавить не более половины объема трубки). 600 мкл теплым раствором CTAB к каждой пробке и смешайте трубы тщательно путем инверсии и vortexing.
    Примечание: Поскольку количество и качество материалов гербариев зачастую является низким, выполнение изоляции ДНК в двух повторений помогает получить более высокие урожаи.
  3. Проинкубируйте образцы в ванну водой 65 ° C для 1 – 1,5 ч, vortexing каждые 15 мин.
  4. Супернатант центрифуги образцы на 10000 x g для 5 минут передать свежий набор помечены трубы (~ 500 мкл). Выбросите Пелле, с использованием стандартной нехлорированные удаления процедуры.
  5. 4 мкл РНКазы-A (10 мг/мл) к каждой пробке и смешайте переворачивать или закупорить. Проинкубируйте образцы при 37 ° C тепла блок или водой ванну 15 мин.
  6. Добавьте одинаковый объем (~ 500 мкл) 25:24:1 фенола: хлороформ: изоамилового алкоголя смеси, когда трубы достигла комнатной. Смесь тщательно закупорить вверх и вниз и/или с инверсией. Центрифуга трубы на g 12000 x 15 мин передача водный слой (верхний слой) на свежий набор помечены трубы (~ 400 мкл). Отказаться от органического слоя в контейнер хлорсодержащих отходов.
    Примечание: Шаг 2.6 может быть повторен если ожидается большое количество вторичных соединений в растительному материалу.
  7. Добавьте одинаковый объем (~ 400 мкл) 24:1 хлороформ: изоамилового алкоголя смеси. Смесь тщательно закупорить вверх и вниз и/или с инверсией. Центрифуга трубы на g 12000 x 15 мин передача водный слой (верхний слой) на новый набор prechilled, помечены трубы (~ 300 мкл). Отказаться от органического слоя в контейнер хлорсодержащих отходов.
  8. Добавьте одинаковый объем (~ 300 мкл) prechilled изопропанол и 12 мкл ацетат натрия 2,5 М для каждой трубы. Проинкубируйте образцы при-20 ° C за 30-60 мин.
    Примечание: Время инкубации может быть продлен (до ночи инкубации), но качество ДНК будет уменьшаться, чем дольше Проинкубируйте образцы.
  9. Брать пробы из морозильника и центрифуги трубы на 12000 g x 15 мин снимите и выбросьте супернатант нежно не нарушая гранулы. Помыть лепешка, подвеска с свежими 70% этанола (примерно 300 – 500 мкл). Для каждого образца, удвоилось Объедините два отдельных гранул в один с сопутствующими этанола.
    Примечание: Образцы должны быть объединены в одну трубку, сначала с использованием этанола и затем продолжить. Это не надо мыть каждый образец с этанолом отдельно.
  10. Центрифуга для трубы на 12000 g x 10 мин удалить и отбросить супернатант нежно не нарушая гранулы. Воздух сухой гранулы.
    Примечание: Образцы могут быть высушено быстрее с помощью блока сухого тепла (не превышает 65 ° C). Убедитесь, что образцы не слишком сухой, как это может уменьшить окончательный выход ДНК.
  11. Приостановите изолированной ДНК в 50 мкл 1 x TE. Хранить в морозильной камере-20 ° C для длительного хранения или 4 ° C для использования на следующей неделе.

3. контроль качества (КК)

  1. Побегите гель агарозы для проверки качества.
    1. Подготовьте 1 x буфер Tris/Борат/ЭДТА (КЭ), добавляя 54 g Tris база, 27,5 г борной кислоты и 3.75 g ЭДТА динатриевая соль, в результате чего общий объем до 5 Л, с использованием реагентов класса воды.
    2. Подготовить гель агарозы 1%, добавив агарозы 1 г на 100 мл 1 x TBE. СВЧ решения до тех пор, пока не агарозы является видимым. Добавить 0,01% нуклеиновой кислоты геля краситель (см. Таблицу материалы). Пусть прохладно колбу, пока она теплая на ощупь. Смешайте хорошо помешивая. Вливают каппу для геля агарозы и дайте ему сидеть до тех пор, пока он твердеет.
    3. Смешайте 3 мкл пример, 2 мкл Реагента класс воды и 1 мкл 6 x загрузки красителя. Загрузите образцы в матрице геля, отметив их порядок.
    4. Запуск образцов для 60 – 70 мин на 60 – 70 V. изображение гель под УФ светом с правильной экспозиции и фокус.
      Примечание: Наличие четкой высокомолекулярного группы является признаком высокого качества ДНК, хотя мазки обычно указывают деградации ДНК. Большинство образцов гербария деградации.
  2. Запустить анализ количественной dsDNA (см. таблицу материалы), чтобы определить количество двойных мель ДНК.
    1. Используйте 2 мкл пример для анализа.
      Примечание: Разведения не требуются для количественной оценки анализа материалов гербариев, поскольку они, как правило, быть в минимальных количествах. Успешное библиотеки были сделаны из как 1.26 всего dsDNA нг от этого шага.

4. Стрижка ДНК

Примечание: Это оптимизированная версия коммерческого fragmentase двуцепочечной протокола (см. Таблицу материалы).

  1. Место dsDNA фрагментации фермент на льду после vortexing для 3 s.
  2. В стерильные 0,2 мл полимеразной цепной реакции (ПЦР) трубку микс 1 – 16 мкл изолированных ДНК с 2 мкл сопутствующих буфер реакции фрагментации. Довести объем до 18 мкл путем добавления нуклеиназы свободной воды. 2 мкл dsDNA фрагментации фермента и вихревой смесь для 3 s.
    Примечание: Количество ДНК необходимы варьируется в зависимости от концентрации ДНК (цель для 200 ng всего в трубе).
  3. Проинкубируйте образцы при 37 ° C 8.5 мин. Затем добавьте 5 мкл 0,5 М ЭДТА трубы.
    Примечание: Этот шаг необходимо выполнить только как инкубационный период над прекратить реакции и предотвращения чрезмерного сдвига образцы ДНК.

5. шарик очистки

  1. Однородный Спри бусы, vortexing.
  2. Довести объем стриженый ДНК до 50 мкл, добавив 25 мкл нуклеиназы свободной воды. Мкл 45 комнатной температуре Спри бусины (90% объема) для 50 мкл стриженый ДНК и перемешать тщательно, закупорить вверх и вниз.
    Примечание: Добавление бусы на 90% от объема общей выборки производится для удаления маленьких фрагментов ДНК, часто ниже 200 пар оснований.
  3. Пусть Проинкубируйте образцы для 5 минут поставил трубы на магнитные пластины и пусть сидят в течение 5 мин тщательно снимите и выбросьте супернатант.
    Примечание: Будьте осторожны чтобы не мешать бисер, как они содержат желаемых целей ДНК.
  4. Добавьте 200 мкл свежие 80% этанола в трубы на магнитную подставку. Инкубации при комнатной температуре за 30 s и затем осторожно снимите и выбросьте супернатант. Повторите этот шаг один раз. Воздух сухой Бусины для 5 мин при трубки магнитного стенд с открытой крышкой.
    Примечание: Избегайте чрезмерного высыхания бисер. Это может привести к нижней восстановления ДНК.
  5. Удаление трубы от магнита. Элюировать ДНК из бисера в 55 мкл 0.1 x TE и тщательно перемешать, закупорить вверх и вниз. Инкубации при комнатной температуре для 5 минут место трубы на магнитную подставку и ждать решения превратить ясно (~ 2 мин).
  6. Стащить 52 мкл супернатант. Запустите анализ количественной оценки ДНК на образцы для проверки восстановления и начальной концентрации, которая переходит в библиотеки преп.
    Примечание: Библиотеки были сделаны с общей dsDNA оценкам, менее 1,25 нг, хотя в каждом случае reamplification требовалось.

6. Библиотека подготовка

Примечание: Это модифицированная версия коммерчески доступные библиотеки комплекта (см. Таблицу материалов протокол).

  1. Конец Prep
    1. Добавьте 3 мкл эндонуклеазы и фосфат, хвостохранилища ферментов и 7 мкл сопутствующих реакции буфера до 50 мкл очищены, стриженый ДНК. Тщательно перемешать, закупорить вверх и вниз. Спин трубы для удаления пузырьков.
      Примечание: Общий объем должен быть 60 мкл.
    2. Поместите образцы в Термоциклер с следующей программы: 30 мин при 20 ° C, 30 мин при температуре 65 ° C, затем провести на 4 ° C.
      Примечание: С подогревом крышка было присвоено ≥75 ° C
  2. Перешнуровка переходник
    1. Разбавить адаптер 25 – 50 раз (работает адаптер концентрации 0,6 – 0,3 мкм). Добавьте 30 мкл лигирование мастер смеси, 1 мкл лигирование усилитель и 2,5 мкл адаптер для короткого чтения последовательности высок объём трубки.
      Примечание: Общий объем должен быть 93.5 мкл.
    2. Тщательно перемешать, закупорить вверх и вниз. Спин трубы для удаления пузырьков. Инкубируйте трубы при 20 ° C на 15 мин.
    3. 3 мкл коммерческой смеси урацила ДНК glycosylase (UDG) и VIII эндонуклеазы glycosylase лиазы ДНК (см. Таблицу материалы) для трубы. Убедитесь, что общий объем составляет 96,5 мкл. тщательно перемешать и инкубировать при 37 ° C 15 мин с использованием Термоциклер.
      Примечание: Крышки должно быть присвоено ≥47 ° C. Оригинальная версия коммерческого протокола имеет выбор размера после адаптер лигирование шага, следуют шарик очистки в качестве последнего шага. Этот протокол, который достигает более высокой урожайности, переключает порядок этих шагов и реализует выбор размера в качестве последнего шага.
  3. Очистка для удаления ферментов и небольшие фрагменты
    1. Однородный магнитные бусы, vortexing.
    2. 78 мкл Спри магнитные бусы (80% объема) и тщательно перемешать, закупорить вверх и вниз.
      Примечание: Добавление бусы на 80% объема общей выборки производится для удаления маленьких фрагментов ДНК, которые часто короче, чем 250 пар оснований. Более строгие удаление небольших фрагментов ДНК является (i) удалить излишки адаптеров и (ii) подчеркивают амплификации более крупных фрагментов в следующих шагах.
    3. Пусть образцы Инкубируйте 5 минут положить трубы на магнитные пластины для 5 минут осторожно снимите и выбросьте супернатанта, содержащий ДНК вне диапазона желаемого размера.
      Примечание: Будьте осторожны, чтобы не мешать шарики, которые содержат желаемых целей ДНК.
    4. Добавьте 200 мкл свежие 80% этанола в трубы на магнитную подставку. Инкубации при комнатной температуре за 30 s и затем осторожно снимите и выбросьте супернатант. Повторите этот шаг один раз. Воздух сухой бусы на 5 мин, пока трубка на магнитного стенд с открытой крышкой.
      Примечание: Избегайте более сушки бисер. Это может привести к нижней восстановления ДНК.
    5. Удаление трубы от магнита. Элюировать ДНК целевой из бисера, добавив 17 мкл 0.1 x TE и тщательно перемешать, закупорить вверх и вниз.
    6. Инкубации при комнатной температуре для 5 минут место трубы на магнитную подставку и ждать решения превратить ясно (~ 2 мин).
    7. Стащить 15 мкл супернатант.
  4. Амплификации PCR
    1. Добавьте 25 мкл высокой верности ПЦР мастер смеси, 5 мкл короткий читать высокопроизводительного секвенирования библиотека приготовительный 5' грунтовка и 5 мкл высок объём короткие последовательности чтения библиотеки приготовительный 3' грунтовки, 15 мкл уборка лигируют адаптер ДНК.
      Примечание: Общий объем должен быть 50 мкл.
    2. Смешайте хорошо vortexing. Поместите образцы в Термоциклер с помощью параметров в таблице 1: Термоциклер Усилительная установка.
      Примечание: Из-за низкой количество входных ДНК требуется большое количество циклов.
Шаг цикла Темп. Время Циклы
Первоначальный денатурации 98 ° C 30 s 1
Денатурация 98 ° C 10 s 12
Отжиг/расширение 65 ° C 75 s 12
Окончательное расширение 65 ° C 5 мин 1
Удерживайте 4 ° C

Таблица 1: ПЦР протокола денатурации, отжиг и расширение раз и температур. Температура и время были оптимизированы для реагентов, представленные в настоящем Протоколе. Если изменяются реагентов, температура и время должны быть оптимизированы снова.

  1. Выбор размера для желаемого библиотека размера
    Примечание: Этот шаг шарик будет удалить фрагменты выше и ниже целевого показателя.
    1. Однородный Спри бусы, vortexing.
    2. Добавить 25 мкл (50% объема) комнатной температуре магнитные бусы и тщательно перемешать, закупорить вверх и вниз. Пусть Проинкубируйте образцы для 5 минут поставил трубы на магнитные пластины и пусть сидят в течение 5 мин тщательно удалить и передать новый набор помечены трубы супернатант.
      Примечание: Этот объем может корректироваться основаны на размер желаемого библиотеки. Супернатант содержит фрагменты ДНК желаемого размера. В первой инкубации из бисера бусин являются обязательными большие библиотеки фрагментов. Они удаляются, чтобы сосредоточиться на тех, кто в диапазоне 400 – 600 пар. Супернатант содержит небольшие фрагменты.
    3. Мкл 6 комнатной температуре Спри бусины в надосадке и смесь тщательно, закупорить вверх и вниз. Пусть Проинкубируйте образцы для 5 минут поставил трубы на магнитные пластины и пусть сидят в течение 5 мин.
      Примечание: Этот объем может корректироваться основаны на размер желаемого библиотеки в соответствии с шагом 6.5.2.
    4. Осторожно снимите и выбросьте супернатант.
      Примечание: Будьте осторожны, чтобы не мешать шарики, которые содержат нужный ДНК. В инкубации второй бусины бисер являются обязательными фрагменты, оставшееся после первоначального удаления крупнейших ДНК фрагментов. Этот набор фрагментов обычно находится в диапазоне желаемого размера.
    5. Добавьте 200 мкл свежие 80% этанола в трубы на магнитную подставку. Инкубации при комнатной температуре за 30 сек, затем осторожно снимите и выбросьте супернатант. Повторите эти действия. Воздух сухой бусы на 5 мин, пока трубка на магнитного стенд с открытой крышкой.
      Примечание: Избегайте чрезмерного высыхания бисер. Это может привести к нижней восстановления ДНК.
    6. Удаление трубы от магнита. Элюировать ДНК целевой из бисера в 33 мкл 0.1 x TE и тщательно перемешать, закупорить вверх и вниз.
    7. Инкубации при комнатной температуре для 5 минут место трубы на магнитную подставку и ждать решения превратить ясно (~ 2 мин). Снять 30 мкл супернатант и передачи в 2 мл трубки (см. Таблицу материалы) для хранения.
      Примечание: Библиотеки могут храниться на уровне-20 ° c для длительного хранения.
  2. Контроль качества
    1. Контроль качества теста на ДНК библиотек. Обратитесь к шагам 3.1 и 3.2.
      Примечание: Для библиотек ДНК, Побегите гель для ~ 45 мин на 96 V.
  3. Библиотека reamplification: необязательный, если количество библиотека не является достаточным.
    Примечание: Образцы с библиотека концентрации ниже 10 Нм можно reamplified с помощью следующих шагов. Reamplification низкой концентрации библиотек можно добиться реальных результатов для секвенирования, но reamplification может привести к скромным сдвиг в разнообразии базового состава, хотя собрал данные (Таблица 3) указывают, что это является незначительным для некоторых показателей .
    1. Разбавьте Грунтовки универсальные reamplification, 10 раз с помощью 0.1 x TE.
    2. Добавьте 25 мкл высокой верности ПЦР мастер смеси, 5 мкл разбавленного универсальный reamplification праймера 1 (AATGATACGGCGACCACCGA) и 5 мкл разбавленного универсальный reamplification грунтовка 2 (CAAGCAGAAGACGGCATACGA) в 15 мкл низкой концентрации библиотек. Примечание: Общий объем должна быть на 50 мкл.
    3. Смешайте хорошо vortexing. Поместите образцы в Термоциклер с помощью параметров в таблице 1: Настройка усиления Термоциклер
      Примечание: Из-за низкой количество входных ДНК требуется большое количество циклов.
    4. Очистке бисера
    5. Однородный Спри бусы, vortexing. 45 мкл комнатной температуре Спри бусины (90% объема) и тщательно перемешать, закупорить вверх и вниз.
    6. Пусть образцы Инкубируйте 5 минут поставил трубы на магнитные пластины на 5 мин.
    7. Осторожно снимите и выбросьте супернатанта, который содержит нежелательные ДНК.
      Примечание: Будьте осторожны, чтобы не мешать шарики, которые содержат желаемых целей ДНК.
    8. Добавьте 200 мкл свежие 80% этанола в трубы на магнитную подставку. Инкубации при комнатной температуре за 30 сек, затем тщательно удалить и удалить супернатант. Повторите этот шаг один раз.
    9. Воздух сухой Бусины для 5 мин при трубки магнитного стенд с открытой крышкой.
      Примечание: Избегайте чрезмерного высыхания бисер. Это может привести к нижней восстановления целевого ДНК.
    10. Удаление трубы от магнита. Элюировать ДНК целевой из бисера в 33 мкл 0.1 x TE и тщательно перемешать, закупорить вверх и вниз.
    11. Инкубации при комнатной температуре для 5 минут место трубы на магнитную подставку и ждать решения превратить ясно (~ 2 мин).
    12. Снять 30 мкл супернатант. Библиотеки могут храниться при температуре-20 ° C для длительного хранения.
  4. Контроль качества
    1. Контроль качества теста на ДНК библиотек. Обратитесь к шагам 3.1 и 3.2. Для библиотек ДНК Побегите гель для ~ 45 мин на 96 V.
      Примечание: Если двойной полосы рассматривается в гель, это скорее всего является следствием истощения грунт от reamplification шаг. Полосы могут быть удалены путем повторения 6.9, но с использованием только одного цикла в программе PCR, изображены в таблице 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Изоляции ДНК и окончательный библиотека доходность
В этом исследовании была продемонстрирована эффективность протокола для изоляции гербарий ДНК и восстановления высокого качества последовательности библиотек, пятидесяти различных образцов с помощью старых от 1920 и самым молодым из 2012 (Таблица 2). Для каждого образца примерно 10 мг ткани листа был использован для изоляции ДНК. Зеленой ткани листа было оказано, если таковые имеются, и был выбран не ткани с очевидным грибкового заражения. Успешной изоляции может производиться с помощью желтого или коричневого ткани, хотя доходность, как ожидается, должна быть ниже. Всего двойной мель ДНК (dsDNA) от первоначального изоляции, варьировались от 3.56 нг 2,610 нг. Как и ожидалось, ДНК, полученных из образцов гербария сильно деградированных (рис. 1A, дополнительный Рисунок 1). Часть из этих способов изоляции были использованы для ферментативного стрижка (1.26 – 464 нг). Хотя гербарий ДНК уже стриженый через процесс сохранения, Оптимизация протокола требует дополнительных сдвига для повышения урожайности общей библиотеки. Общее восстановление после стрижки dsDNA варьировались от < 1% до 51% ввода dsDNA, что приводит к менее менее 1,25 нг начиная ДНК для подготовки библиотека и максимум 328 нг. Экстремальный потеря ДНК в некоторых образцах может объясняться уже небольшой фрагмент размер большая часть ДНК до ферментативные наклон (рис. 1A, дополнительная цифра 1). Использование очистки бисера 90% объема на стриженый ДНК намеренно удалены маленьких фрагментов ДНК для обогащения для более крупных, более желательным фрагмент размеров. Эти небольшие фрагменты особенно были замечены в образцах, TK463, TK657 и TK694, как обозначено интенсивной сигнала на отметке 100 пар (рис. 1A).

Общее количество выбор размера библиотеки пост варьировались от 1.425 нг 942.5 нг (Таблица 2, справочная таблица 1). Для 23 образцов, подготовка добычи и библиотека не дают достаточное количество библиотеки (< 10 Нм; Таблица 2, справочная таблица 1), поэтому эти образцы были подвергнуты reamplification и восстановление действия протокола, что приводит к 14 – 680 x увеличение общей библиотеки (Таблица 2, справочная таблица 1). Окончательный библиотек привели в полосе между 350 и 500 пар оснований (рис. 1B, дополнительный Рисунок 2). Время от времени, был замечен второй группы, которая была больше, чем размер ожидаемых библиотека (рис. 1B, дополнительный Рисунок 2). Это произошло, когда reamplification ПЦР исчерпаны имеющиеся грунты и начал отжига библиотека адаптеры не гомологичных фрагментов ДНК. Это создает молекулы, где заканчивается (адаптеров) должным образом отжига, но Вставка ДНК не. Этот «обрабатывать» молекулы появилось больше на геле, как он переехал более медленно через матрицы геля. Эти отжига ошибки были исправлены путем подготовки другого reamplification реакции в библиотеке уже reamplified и запустить его для одного цикла. Это один цикл представили грунтовки для надлежащего отжига и усиления, удаление второй группы (Дополнительные рис. 3).

Reamplification библиотек способствовала окончательный библиотека концентрации по крайней мере 10 Нм. Эти концентрации допускается библиотек для разбавлять равным Молярность и объединения в равного представительства, помогая инвертировать вопросы, которые возникли бы с неравным образец качества и последовательности библиотеки урожайности. Если цель проекта геномом хлоропластов последовательности, затем общее количество последовательности необходимо будет меняться как различных линий и ткани отличаются в общий процент чтений, которые происходят из хлоропласта ДНК19. Как правило 50-100 x прогнозируемых освещение геномом хлоропластов достаточна для Ассамблеи, и бежит последовательности можно объединить включить как 70 человек в зависимости от вида и метода секвенирования.

Тестирование на загрязнение, предвзятости и изменения, вызванные Reamplification
Заметное беспокойство для секвенирования HTS является введение предвзятости в библиотеки через обширные амплификации PCR20. Чтобы проверить действие reamplification и выявлять потенциальные смещения в общем филогенетических приложения гербарий материала, мы сравнили успешно виртуализированного библиотека (TK686) с же библиотека разводят 1:5 и reamplified (назначенный TK686-R). Оба TK686 и TK686-R были соответственно виртуализации на Illumina HiSeq4000 в Университете Иллинойса Рой J. Карвер центр биотехнологий и поддержки технологии Мичиганского государственного университета научно-исследовательский центр, с помощью парных конце 150 пары читает (см Таблица 3 для секвенирования детали). Сырые читает сдали в NCBI SRA (SRP128083). Чтений были очищены с помощью Trimmomatic v.0.3621 включая адаптер обрезки с помощью НЭБ адаптер последовательность, качество фильтрации на среднем phred балл 20 за пару 10 base, раздвижные окна, и как минимум отрезать размер 40 пар нуклеотидов. Как один из основных вопросов с образцами гербарий грибковых загрязнение, загрязнение оценивалась путем сопоставления считывает против часть JGI MycoCosm грибковых генома базы данных22 (312 ядерной геномов и 79 митохондриальных геномов) с помощью bowtie2 v . 2.2.923 с помощью параметра «очень чувствительных местный». Библиотеки TK686 и TK686-R были неразличимы в ядерного заражения грибковой (9.24% и 9,68%, соответственно) и митохондриальной грибковых загрязнения (0,94% и 0.8%) (Таблица 3). Хотя это только один пример, это предположить, что грибковые контаминации образцов гербария не является незначительным и должны быть удалены перед использованием последовательности гербарий, полученных данных. База данных и команды, используемые для идентификации и удаления грибковых загрязнения можно найти в хранилище GitHub м. р. McKain гербарий геномики24.

Секвенирование генома хлоропласта обычно используется для филогенетических анализов, и образцов гербария все чаще используются в качестве исходного материала12. Для того чтобы проверить верность reamplification в Ассамблее геномом хлоропластов, хлоропласта геномов для TK686 и TK686-R были собраны с помощью быстро-пласт v.1.2.525 параметры по умолчанию с бабочкой индексом, равным Злакоцветные. TK686-r был получен полный хлоропласта генома, но геномом хлоропластов TK686 был смонтирован в семь Сахалинской из-за более низких чтения глубины. Сахалинской TK686 были собраны вручную после McKain и др. 26 полностью собранный хлоропласта геномов были согласованы друг с другом в программное обеспечение на основе GUI выравнивание (см. Таблицу материалы) и оценить различия между сборками. В общей сложности 12 полиморфизмов и один indel были выявлены между хлоропласта сборок для TK686 и TK686-R. Для каждого варианта охват оценивалась в чтение наборы из TK686 и TK686-R. Во всех случаях наиболее распространенный вариант был же между двумя библиотеками. TK686 продемонстрировал один T→C, один G→A, одно G→T, одно G→-, один C→A, один T→A и четыре варианта C→A. Пять из этих вариантов произошли в строке гомополимер, предполагая, что их включение в Ассамблее были результатом ошибки последовательности и низкий общий охват. Возможно, другие были результатом хлоропласта гаплотип вариации, виртуализации ошибка или цитозин дезаминирование, или некоторая комбинация этих факторов. TK686-R был один C→T, один G→T и одна A→G. Варианты C→T и G→T были найдены в гомополимер, как указано выше. В конечном счете идентичные полный хлоропласта геномов были определены от обоих чтения. Одного хлоропласта генома от TK686 был Аннотированная используя зеленые21 и по сравнению с другими членами племени Andropogoneae. Все стандартные хлоропласта функции были Аннотированная: 8 теорией, 38 tRNAs и 84 кодирования генов белков. Геном полный хлоропласта доступен от GenBank (MF170217) и зеленеющих27.

Потенциальные смещения от reamplification библиотек также определялась путем оценки процентов GC и содержание всего примерно transposon. Процент GC оценивалась с использованием пользовательского сценария24. Различия в GC содержание двух образцов были незначительными, с GC 49,7% в TK686 и 51,2% GC в TK686-R. Transposon состав оценивалась с использованием Transposome28. Для обеих библиотек 100000 чтений были случайно subsampled и transposon состав оценивалась с использованием процент личности 90, часть покрытия 0.55, размер кластера из 100, и RepBase 21.10 трава повторить ссылку установить29. Это было повторено в 100 раз выполнять загрузку на transposon оценки из этих наборов данных. Процент всего генома для крупных подсемейств транспозонов были извлечены из Transposome вывода, и среднее и стандартное отклонение этих 100 реплицирует были оценены. Все сценарии, используемые для создания этих мероприятий можно найти в хранилище Github м. р. McKain транспозонов30, и все результаты сдали в Дриада (doi:10.5061/dryad.r8t2m). Используя два наиболее распространенных подсемейства transposon как индикаторы (Copia и цыганской длинные концевые повторить retrotransposons), результаты были почти идентичны с Copia 33.52 4.00 ± % и 31,68 ± 2,94% цыган 24.83 ± 2.72% и 24.00 ± 2,35% в TK686 и TK686-R, соответственно (Таблица 3). Эти результаты тестов показывают, что reamplification шаг настоящего Протокола не создавать значимые последовательности смещения для высокого уровня генома метрики. Следует, однако, отметить, что это один пример не может быть полностью представительным из всех библиотек reamplified. Этот один тест показывает, что reamplification шаг не был изначально стабилизатор генома метрики в TK686/TK686-R. Введено смещения не повлияет на Ассамблее дано достаточное освещение секвенирования генома хлоропластов, но рекомендуется, что эксперименты, как представлено в этом исследовании с TK686/TK686-R, проводятся на целевых линий для проверки, что уклон не является происходит во время исследования, расследование транспонированная элемент разнообразия.

Figure 1
Рисунок 1: образы гель агарозы A) изоляции ДНК и B) окончательные последовательности библиотеки из десяти образцов гербария. Для каждой полосы был использован 3 мкл ДНК или библиотеки. (A) ДНК был деградировали в всех гербарий изоляции как общий мазок. (B) окончательные последовательности библиотеки изображают основная полоса 300-500 пар с более широкого распространения 200-1000 пар; Последний является более распространенным в reamplified библиотек. Полосы для обоих (A) и (B) были определены в образце и можно сравнить с результатами в таблице 2. Размер лестница была изображена в пар оснований (ВР). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Круговой участок Schizachyrium мётловидный (TK686) геномом хлоропластов с заметкой. Полностью собранный генома от ружья секвенирования ДНК, гербарий, полученных выставлены общей протяженностью 139,296 пар оснований (ВР), большой единой копии региона (LSC) 81,401 bp, Перевернутый Повторите региона (IR) 22,669 bp и небольшой Поэкземплярная региона (SSC) 12,557 BP. В аннотации были определены все стандартные белка кодирование генов, tRNAs и теорией для членов племени Andropogoneae. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Таблица 2: ДНК результаты добычи и библиотека подготовки десять образцов гербария и четыре reamplified библиотек. Всего двойной мель ДНК на различные шаги в протоколе продемонстрировали как переменная качество может быть, особенно при фильтрации для размера. Пожалуйста, нажмите здесь, чтобы скачать эту таблицу.

Таблица 3: Виртуализация статистики для TK686 и reamplified TK686R. Reamplification не влияет на общий показатель заражения грибковой генома, GC содержание оценки, оценки состава transposon или возможность собрать весь хлоропласта геномов. Пожалуйста, нажмите здесь, чтобы скачать эту таблицу.

Справочная таблица 1: ДНК добычи и библиотека подготовки результаты сорок дополнительных гербарий образцов, включая двадцать reamplified библиотек. Всего двойной мель ДНК на различные шаги в протоколе продемонстрировали как переменная качество может быть, особенно при фильтрации для размера. Пожалуйста, нажмите здесь, чтобы скачать эту таблицу.

Дополнительные рисунок 1: изображения гель агарозы сорока дополнительной изоляции ДНК от образцов гербария. Оба (А) и (.B) изображают 20 отдельных изоляции ДНК и продемонстрировать характерный деградации ДНК гербарий производные. Для каждой полосы был использован 3 мкл ДНК. Полосы для обоих (A) и (B) были определены в образце и можно сравнить с результатами в дополнительной таблице 1. Лестница размер изображен в пар оснований (ВР). Белые пятна на изображении обусловлены артефакты в тепловизор гель, который не может быть удален с очистки. Пожалуйста, нажмите здесь, чтобы скачать этот показатель.

Дополнительные рисунок 2: изображения гель агарозы сорока библиотек дополнительные последовательности ДНК, Гербарий производный. Для каждой полосы был использован 3 мкл библиотеки. Окончательный последовательности библиотеки находятся в обоих (A) и (B) с средним размером 300-500 пар. Вторичные полосы, видели в некоторых образцах, усиленные предложить «восходящей» библиотек. Полосы для обоих (A) и (B) обозначаются образца и можно сравнить с результатами в дополнительной таблице 1. Лестница размер изображен в пар оснований (ВР). Пожалуйста, нажмите здесь, чтобы скачать этот показатель.

Дополнительная цифра 3: изображение гель агарозы удаления вторичного группы с шагом еще одного цикла PCR. Пожалуйста, нажмите здесь, чтобы скачать этот показатель.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Протокол, представленные здесь является всеобъемлющий и надежный метод для изоляции ДНК и последовательности подготовки библиотеки из образцов сухих растений. Согласованность метода и минимальная потребность изменить его на основе образца качества делают его масштабируемость для больших последовательности на основе гербарий проектов. Включение факультативного reamplification шаг для низкой урожайностью библиотек позволяет включение низкого качества, малое количество, редкие или исторически важные образцы, которые в противном случае не будут пригодны для виртуализации.

Важность первоначального ДНК доходности
Гербарий, полученных ДНК часто снижается вследствие первоначальный образец сохранение11, с ДНК образцов менее 300 лет старый как деградации ДНК, изолированных от останков животных, которые являются несколько сотен тысяч лет31 , 32. Следовательно, оптимизации доходности первоначальных ДНК имеет жизненно важное значение в получении dsDNA достаточно высокого качества для подготовки успешной виртуализации библиотеки. Трава зверобоя оптимальной урожайности достигается за счет комбинированного использования стерилизованные песка и жидкий азот в первоначального помола шаг, обеспечивая более полное уничтожение клеточной стенки и выпуска нуклеиновых кислот. Такой подход увеличивает желательно больших dsDNA и нежелательных небольших фрагментов (рис. 1, дополнительная цифра 1, Таблица 2, справочная таблица 1). Последующие шарик очистки шаги изолировать и обогатить фрагментов размера подходит для виртуализации (300 – 500 пар оснований), значительно уменьшая восстановления, но и обогащает больше фрагментов (Таблица 2, справочная таблица 1). Изменения первоначальных шагов изоляции ДНК могут потребоваться на основании линии выборки с целью уменьшения воздействия вторичных метаболитов на обработке18.

Оптимизация библиотеки адаптеров
Концентрация адаптеров, используемых для перевязки имеет прямое влияние на количество димер адаптер в готовых библиотек. Димеры адаптер результатом адаптер самолигирование при недостаточной выборки и загрязнять последовательность работает33. Относительно низкая общая dsDNA доступны от образцов гербария требует разбавления адаптеров до перевязки. Адаптеры могут быть ослаблены 50-fold от запасов концентрации 15 мкм (см. Раздел протокола) облегчение подготовки высок объём библиотека без необходимости индивидуально измерять и разбавленных адаптер для каждого образца (в таблице 2, дополнительные таблицы 1). Хотя в принципе насыщенность адаптеров может уменьшить общую библиотеку урожайности, маловероятно, что гербарий образцов даст dsDNA в такой избыток адаптер.

Различия в шарик, уборка шаги для повышения урожайности
Выбор размера в подготовке последовательности библиотек обычно делается после перевязки адаптер, позволяющие амплификация фрагментов, главным образом в пределах желаемого размера; Это делается путем удаления фрагментов, которые больше и меньше целевого размера. Низкое количество гербарий производные dsDNA библиотека подготовки усугубляется после выбора размера на этот шаг, что приводит к unworkably низкой общей dsDNA и в конечном итоге низкая урожайность в библиотеке окончательный. Путем проведения стандартных шарик Очистка шаг, используя 90% объема бусы после перевязки, больше всего dsDNA остается для обогащения в шаг амплификации. Очень маленькие фрагменты ДНК преференциально удаляются с помощью 90% объем бусины. Выбор размера проводится на заключительном этапе на усиленные Библиотека, которая обеспечивает обогащение размеров нужный фрагмент. Общие объемы бисера может настраиваться для выбора нужного диапазона, хотя двухэтапный томов 25 мкл и 6 мкл бисера оптимизированы для извлечения библиотеки 400-500 пар вставок в рамках настоящего Протокола (Рисунок 1B, дополнительный рисунок 2).

Пример спасения через Reamplification библиотек
Несмотря на передовой практики изоляции ДНК и библиотека подготовки окончательный концентрации последовательности библиотек могут быть недостаточными для дальнейшей виртуализации. Деструктивный характер отбора проб и зачастую ограниченным расходных материалов из образцов гербария не всегда позволяют повторять изоляции ДНК. В reamplifying библиотеке до 12 дополнительных циклов PCR, даже исключительно плохой библиотеки могут быть сохранены. Для усиления, который совместим с протоколами, либо один или два индексированных библиотека используется стандартный грунтовка пара. Главной проблемой reamplification является введение предвзятости, часто путем сокращения в ГК богатыми части генома20. С помощью высокоточных полимеразы (см. Таблицу материалы), эти потенциальные предубеждения потенциально избежать. Это проявляется через минимальный вариации содержания GC виртуализированного библиотек TK686 и TK686-R (Таблица 3). Как второй проверки transposon содержание TK686 и TK686-R был оценкам и показал никаких заметных различий (Таблица 3). Наконец весь хлоропласта генома этого присоединения был собран из TK686 и TK686-R, что привело к идентичные последовательности после тесного инспекции SNP вариации между двумя сборками (Рисунок 2, Таблица 3). Эти тесты показывают что стандартные геномной метрики, такие как GC содержание и состав transposon и возможность собрать полный хлоропласта геномов, не могут быть затронуты reamplification. Это открывает возможность включения гербарий, который образцов считается слишком деградации или не хватает материала в phylogenomic исследования без заботы для введено смещения через PCR. Эти reamplified библиотеки могут также использоваться для захвата последовательности34, хотя следовало бы проверить ли SNP вызова является предвзятым. Рекомендуется, что испытания малых масштабах предвзятости проводиться с каждого проекта, чтобы проверить, что уклон не вводится в последовательности библиотеки.

Ограничения и возможные модификации
Даже несмотря на то, что этот протокол работал на сотни образцов гербария, плохо сохранились тканей может по-прежнему не на любом этапе. Это, однако, чрезвычайно редкая для библиотек не из тканей с успешным экстракции ДНК, особенно после спасения библиотеки через reamplification. Шаги выбора размера могут быть изменены для различных размера фрагментов или уменьшить широкий спектр фрагментов, видели в некоторых окончательного библиотек. Как с все протоколы извлечения растительных, шаги могут быть необходимы для удаления lineage конкретных вторичных соединений, которые могут препятствовать общий протокол. Как они представлены, этот протокол предоставляет стандартный метод для изоляции и высок объём ДНК библиотека подготовки образцов гербария травы и путем проверки и экспериментов, вероятно, быть исправимый для других линий завода.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что они имеют не конкурирующие интересы.

Acknowledgments

Мы благодарим Тейлор Обечон-старший, Teisher Иордании и Кристина Zudock для помощи в выборки образцов гербария и ботанический сад Миссури для доступа к гербарий образцов для разрушительных выборки. Эта работа была поддержка грант от национального научного фонда (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics