Robusto de ADN y la secuenciación de alto rendimiento biblioteca construcción de especímenes de herbario

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este artículo muestra un protocolo detallado para el aislamiento de ADN y la secuenciación de alto rendimiento biblioteca construcción de material de herbario incluyendo rescate del ADN de muy mala calidad.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbarios son una fuente valiosa de material vegetal que se puede utilizar en una variedad de estudios biológicos. El uso de especímenes de herbario está asociado con un número de desafíos, incluyendo calidad de preservación de la muestra ADN degradado y muestreo destructivo de especímenes raros. Para utilizar más eficazmente material de herbario en proyectos grandes de la secuencia, es necesario un método confiable y escalable de ADN aislamiento y biblioteca de preparación. Este documento muestra un protocolo robusto, de principio a fin para ADN aislamiento y alto rendimiento biblioteca construcción de especímenes de herbario que requieren modificación para muestras individuales. Este protocolo se adapta para baja calidad secado planta material y toma ventaja de los métodos existentes mediante la optimización de tejido pulido, modificar la selección de tamaño de la biblioteca y presentando un paso de Reamplificación opcionales para las bibliotecas de bajo rendimiento. Reamplificación de bibliotecas de ADN de bajo rendimiento puede rescatar muestras derivadas de especímenes de herbario insustituible y potencialmente valiosa, negando la necesidad de muestreo destructivo adicional y sin introducir sesgo de secuencia perceptible común aplicaciones filogenéticas. El protocolo ha sido probado en cientos de especies de gramíneas, pero se espera que sea adaptable para el uso en otros linajes de la planta después de la verificación. Este protocolo puede ser limitada por ADN muy degradado, donde fragmentos no existen en la gama del tamaño deseado, y por metabolitos secundarios presentes en un material de planta que inhiben el aislamiento de ADN limpio. En general, este protocolo presenta un método rápido y completo que permite la extracción de ADN y preparación de la biblioteca de 24 muestras en menos de 13 horas, con solo 8 h de tiempo práctica activa con modificaciones mínimas.

Introduction

Colecciones de herbario son una fuente potencialmente valiosa de especies y diversidad genómica de estudios incluyendo phylogenetics1,2,3, genética de poblaciones4,5, conservación Biología6, de la biología de las especies invasoras7y rasgo evolución8. La capacidad para obtener una rica diversidad de especies, poblaciones, regiones geográficas y momentos destaca el "tesoro"9 que es el herbario. Históricamente, la naturaleza degradada del ADN derivado de herbario ha obstaculizado los proyectos basados en PCR, a menudo relegando los investigadores a usar sólo los marcadores encontrados en copia alta, como las regiones del genoma de cloroplasto o el espaciador transcrito interno (ITS) de la ribosomal ARN. Calidad de las muestras y ADN varían ampliamente en base a métodos de conservación9,10, con las roturas de doble hebra y fragmentación de calor utilizado en el proceso de secado siendo las formas más comunes de daños, la creación de la supuesto 90% ADN calabozo que ha gravado estudios basados en PCR11. Aparte de fragmentación, lo segundo más frecuente en la genómica de herbario es contaminación, tales como que derivado de los hongos endófitos13 u hongos adquirieron post mortem después de la recolección, pero antes de montar en el herbario12, aunque este problema puede ser solucionado bioinformatically dado la derecha fungicida base de datos (véase abajo). Un problema terceros y menos común, es modificación de la secuencia a través de citosina desaminación (G→T/C/A)14, aunque se estima que bajo (~ 0,03%) en ejemplares de herbario11. Con el advenimiento de secuenciación de alto rendimiento (HTS), la cuestión de la fragmentación puede superarse con lecturas cortas y secuenciación profundidad12,15, permitiendo la adquisición de datos de nivel genómico de numerosas muestras con baja calidad ADN e incluso a veces permitiendo que todo el genoma secuencia15.

Muestras de herbario son cada vez más frecuente y son un componente más grande de proyectos filogenética16. Un reto actual de la utilización de especímenes de herbario para HTS constantemente es obtener suficiente ADN de trenzado doble, un requisito previo necesario para los protocolos de la secuencia, de numerosas especies de manera oportuna, sin necesidad de optimizar los métodos para el individuo muestras. En este documento, un protocolo para la extracción de ADN y biblioteca preparación de especímenes de herbario se demuestra que se aprovecha de los métodos existentes y modifica para permitir resultados rápidos y reproducibles. Este método permite el completo procesamiento del espécimen a una biblioteca de 24 muestras 13 h, con el tiempo práctico 8 h o 16 h, con tiempo práctica 9 h, cuando se requiere el paso de Reamplificación opcional. Proceso simultáneo de muestras más es factible, aunque el factor limitante es la centrifugadora de la capacidad y habilidad técnica. El protocolo está diseñado para requerir sólo típico equipo de laboratorio (termociclador, centrífuga y soportes magnéticos) en lugar de equipo especializado, como un nebulizador o un sonicador, para el corte de ADN.

Calidad de ADN, el tamaño de fragmento y cantidad son limitantes para el uso de ejemplares de herbario en experimentos de secuenciación de alto rendimiento. Otros métodos para aislar ADN de herbario y crear bibliotecas de secuenciación de alto rendimiento han demostrado la utilidad de utilizar tan poco como 10 ng de ADN16; sin embargo necesitan determinar experimentalmente el número óptimo de PCR ciclos necesarios para la preparación de la biblioteca. Esto se hace impracticable cuando tratar con muy pequeñas cantidades de viable doble trenzado DNA (dsDNA), como algunos ejemplares de herbario producen sólo suficiente ADN para la preparación de una sola biblioteca. El método presentado aquí utiliza un número de ciclos independientemente de la calidad de la muestra, por lo que no hay ADN se pierde en los pasos de optimización biblioteca. En cambio, un paso de Reamplificación se invoca cuando las bibliotecas no cumplen con los montos mínimos necesarios para la secuencia. Muchas muestras de herbario son raras y poseen poco material, lo que hace difícil justificar muestreo destructivo en muchos casos. Para contrarrestar esto, el protocolo presentado permite dsDNA entrada tamaños menos de 1.25 ng en el proceso de preparación de la biblioteca, ampliando el alcance de las muestras viables de alto rendimiento de secuenciación y minimizando la necesidad de muestreo destructivo de muestras.

El siguiente protocolo ha sido optimizado para las hierbas y probado en cientos de diferentes especies de muestras de herbario, aunque esperamos que el protocolo se puede aplicar a muchos otros grupos de plantas. Incluye un paso de recuperación opcional que puede utilizarse para salvar a baja calidad o especímenes raros. Basado en más de 200 especímenes de herbario probados, este protocolo trabaja en especímenes con entrada baja de tejido y calidad, lo que permite la preservación de especímenes raros a través de un mínimo muestreo destructivo. Aquí se demuestra que este protocolo puede proporcionar bibliotecas de alta calidad que pueden ser secuenciadas para proyectos basados en la filogenómica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. antes de que arranque

  1. Hacer fresco cetil trimetilamonio bromuro (CTAB) buffer17 añadiendo 20 g de CTAB, 10 g de polivinilpirrolidona (PVP) 40, 100,0 mL 1 M Tris pH 8.0, 40 mL de 0,5 M etilendiaminotetracético pH ácido (EDTA) 8.0, 280,0 mL de 5 M de NaCl y 400,0 mL agua de reactivo juntos y llevar el volumen a 1 L con grado de reactivo agua. Ajustar el pH a 8.0.
    Nota: Reactivos adicionales pueden agregarse a CTAB dependiendo de compuestos secundarios de taxa individuales. Ver Allen et al. 18 para una lista completa de aditivos reactivos.
  2. Añadir 10 μl de β-mercaptoetanol por 5 mL de buffer CTAB.
    Nota: esto puede ser preparado en lotes de 50 mL y almacenado a temperatura ambiente durante 3-4 semanas.
    1. La solución CTAB en un baño de agua de 65 ° C de calor.
  3. Chill morteros y morteros en-20 ° C durante al menos 20 minutos.
  4. Etiqueta 4 sets de 2 x tubos con 2 mL de n (donde n = el número de muestras). Puesto 1 juego de tubos etiquetados en el hielo.
  5. Isopropanol frío en hielo o en un congelador de-20 ° C.
  6. Quitar granos de inmovilización reversible (SPRI) de fase sólida (véase Tabla de materiales) de la nevera y permitirles que alcancen la temperatura ambiente (por lo menos 30 min).
  7. Preparación de etanol al 80%.
  8. Seleccionar a especímenes de herbario para la extracción y recuperar ~ 1 cm2, o 10 mg, de los tejidos por muestra, preferentemente material de la hoja.

2. extracción de ADN

  1. Muela de ~ 1 cm2 de tejido herbario preseleccionadas utilizando morteros y morteros prechilled. Añadir nitrógeno líquido y arena esterilizada de 30 – 50 mg. Moler hasta que el tejido se convierte en polvo fino.
    Nota: 10 mg o más tejido es deseable, pero también menos ha trabajado en algunos casos. Una vez que el nitrógeno líquido se evapore, agregar más según sea necesario hasta que el tejido es totalmente de tierra. Otro método común para alterar las células y tejidos es el uso de una batidora de grano. Sin embargo, este método se encontró que no funciona bien para los especímenes utilizados en estos experimentos.
  2. Transferir el polvo helado en dos tubos de 2 mL (agregar no más de la mitad del volumen del tubo). Añadir 600 μl de solución CTAB tibia a cada tubo y mezclar los tubos completamente por Vortex e inversión.
    Nota: Puesto que la cantidad y calidad del material de herbario suele ser baja, realizando extracción de ADN en dos repeticiones ayuda a obtener mayores rendimientos.
  3. Incubar las muestras en un baño de agua de 65 ° C por 1 a 1,5 h, Vortex cada 15 minutos.
  4. Muestras de centrifugar a 10.000 x g por 5 min transferir el sobrenadante a un nuevo conjunto de tubos etiquetados (~ 500 μl). Deseche los pellets usando un procedimiento estándar de eliminación no clorados.
  5. Añada 4 μL de Rnasa A (10 mg/mL) a cada tubo y mezcle por inversión o por pipeteo. Incubar las muestras a 37 ° C en un baño de bloque o de calor durante 15 minutos.
  6. Añadir un volumen igual (~ 500 μl) de una mezcla de alcohol de fenol: cloroformo: isoamílico 25:24:1 una vez que los tubos han llegado a temperatura ambiente. Mezclar bien mediante pipeteo arriba y abajo o con la inversión. Centrifugar los tubos a 12.000 x g durante 15 min. traslado la capa acuosa (capa superior) a una nueva serie de tubos etiquetados (~ 400 μL). Deseche la capa orgánica en un contenedor de residuos clorado.
    Nota: Paso 2.6 puede repetirse si se esperan grandes cantidades de compuestos secundarios en material vegetal.
  7. Añadir un volumen igual (~ 400 μL) de una mezcla de alcohol cloroformo: isoamílico 24:1. Mezclar bien mediante pipeteo arriba y abajo o con la inversión. Centrifugar los tubos a 12.000 x g durante 15 min. traslado la capa acuosa (capa superior) a una nueva serie de tubos etiquetados prechilled (~ 300 μL). Deseche la capa orgánica en un contenedor de residuos clorado.
  8. Añadir un volumen igual (~ 300 μL) de isopropanol prechilled y 12 μl de acetato de sodio de 2,5 M a cada tubo. Incubar las muestras a-20 ° C durante 30 – 60 min.
    Nota: Los tiempos de incubación pueden ser extendidos (hasta la incubación durante la noche), pero la calidad de DNA disminuye cuanto más tiempo se incuban las muestras.
  9. Tomar las muestras fuera del congelador y centrifugar los tubos a 12.000 x g durante 15 minutos retiren y descarte el sobrenadante con cuidado sin perturbar el pellet. Lavar el precipitado por suspensión con etanol al 70% fresco (aproximadamente 300 – 500 μl). Para cada muestra se duplicó, consolidar las pelotillas individuales dos en uno con el acompañamiento de etanol.
    Nota: Las muestras deben consolidarse en un tubo usando etanol primero y luego proceden. No es necesario lavar por separado cada muestra con etanol.
  10. Centrifugar los tubos a 12.000 x g durante 10 minutos, retire y descarte el sobrenadante con cuidado sin perturbar el pellet. Secar el pellet.
    Nota: Las muestras pueden secarse más rápido usando un bloque de calor seco (no exceder 65 ° C). Asegúrese de que las muestras no demasiado seca, ya que esto puede disminuir el rendimiento final del ADN.
  11. Suspender el ADN aislado en 50 μl de TE 1 x. Almacenar en el congelador de-20 ° C para almacenamiento a largo plazo o 4 ° C para su uso en la semana siguiente.

3. Control de calidad (QC)

  1. Correr un gel de agarosa para control de calidad.
    1. Preparar un buffer de borato/Tris/EDTA (TBE) de 1 x agregando 54 g Tris base, el ácido bórico 27,5 g y 3.75 g EDTA sal disódica, que el volumen total de 5 L con agua de grado reactivo.
    2. Preparar un gel de agarosa al 1% mediante la adición de 1 g agarosa a 100 mL de 1 x TBE. La solución en el microondas hasta que la agarosa no es visible. Añadir a 0.01% gel de ácido nucleico de la mancha (véase Tabla de materiales). Deje que el matraz se enfríe hasta que esté caliente al tacto. Mezclar bien por agitación. Verter la agarosa en una bandeja de gel y lo deje reposar hasta que se solidifica.
    3. Mezclar 1 μl de 6 x carga colorante, 3 μl de muestra y 2 μl de agua de grado reactivo. Cargar las muestras en el gel de la matriz, tomando nota de su pedido.
    4. Ejecutar los ejemplos de 60 a 70 min en 60 – 70 V. imagen el gel bajo luz UV con el enfoque y la exposición correcta.
      Nota: Presencia de una banda clara de alto peso molecular es una muestra de ADN de alta calidad, mientras que los borrones de transferencia generalmente indican degradación del ADN. La mayoría de especímenes de herbario son degradados.
  2. Realizar un análisis de cuantificación de dsDNA (véase tabla de materiales) para determinar la cantidad de doble trenzado DNA.
    1. Utilice 2 μl de muestra para análisis.
      Nota: Las diluciones no son necesarios para el análisis de cuantificación de material de herbario como suelen ser en cantidades mínimas. Bibliotecas exitosas se han hecho de tan sólo 1,26 ng dsDNA total de este paso.

4. DNA de corte

Nota: Esta es una versión optimizada de un comercial fragmentase bicatenario protocolo (véase Tabla de materiales).

  1. Enzima de fragmentación de dsDNA de lugar en el hielo después de Vortex 3 s.
  2. En un tubo de reacción en cadena (PCR) polimerasa 0,2 mL estéril, mezcla 1 – 16 μl había aislado ADN con 2 μl de tampón de reacción fragmentación de acompañamiento. Llevar el volumen total a 18 μL agua libre de nucleasa. Añadir 2 μl de enzima de fragmentación de dsDNA y agitar la mezcla de 3 s.
    Nota: La cantidad de ADN necesitada varía dependiendo de la concentración de ADN (aim 200 total de ng en el tubo).
  3. Incubar las muestras a 37 ° C 8,5 minutos. Luego añadir 5 μl de EDTA de 0,5 M en los tubos.
    Nota: Este paso debe realizarse tan pronto como el período de incubación es en terminar la reacción e impedir el exceso de corte de muestras de ADN.

5. grano de limpiar

  1. Homogeneizar las cuentas SPRI con un vórtex.
  2. Llevar el volumen total de la DNA esquilado a 50 μl añadiendo 25 μl de agua libre de nucleasa. Añadir 45 μl de granos de SPRI la temperatura ambiente (90% del volumen) a 50 μl de esquilado ADN y mezclar bien mediante pipeteo arriba y abajo.
    Nota: Agregar cuentas al 90% del volumen total de la muestra se realiza para quitar el más pequeño de los fragmentos de DNA, a menudo por debajo de 200 pares de bases.
  3. Dejar las muestras incuban 5 minutos poner los tubos en una placa magnética y dejarlos reposar 5 min cuidadosamente retire y descarte el sobrenadante.
    Nota: Tenga cuidado de no perturbar los granos, ya que contienen los blancos de DNA deseados.
  4. Añadir 200 μL de etanol al 80% fresco en los tubos en el soporte magnético. Incubar a temperatura ambiente durante 30 s y cuidadosamente retire y descarte el sobrenadante. Repita este paso una vez. Secar los granos para 5 min mientras que el tubo está en el soporte magnético con su tapa abierta.
    Nota: Evitar que se sequen demasiado los granos. Esto puede resultar en la baja recuperación de ADN.
  5. Retirar los tubos del imán. Eluir el ADN de los granos en 55 μl de 0,1 x TE y homogeneizar mediante pipeteo arriba y abajo. Incubar a temperatura ambiente durante 5 minutos tubos de lugar sobre el soporte magnético y esperar a que la solución activar claro (~ 2 minutos).
  6. Tire 52 μl del sobrenadante. Realizar un análisis de cuantificación de ADN en las muestras para comprobar la recuperación y la concentración inicial que entra en la preparación de la biblioteca.
    Nota: Las bibliotecas se han hecho con total dsDNA estima que menos de 1.25 ng, aunque en cada caso Reamplificación fue requerida.

6. Biblioteca preparación

Nota: Esta es una versión modificada de un kit de biblioteca disponibles en el mercado (ver protocolo de Tabla de materiales ).

  1. Preparación para el final
    1. Agregar 3 μl de endonucleasa y fosfato enzimas de jales y 7 μl de acompañamiento tampón de reacción de 50 μl de ADN limpio, esquilado. Mezclar bien mediante pipeteo arriba y abajo. Girar los tubos para eliminar las burbujas.
      Nota: El volumen total debe ser 60 μL.
    2. Coloque las muestras en un termociclador con el siguiente programa: 30 minutos a 20 ° C, 30 min a 65 ° C, después llevar a cabo a 4 ° C.
      Nota: Tapa calentada se estableció en ≥75 ° C
  2. Ligadura de adaptador
    1. Diluir el adaptador de 25 a 50 veces (trabajo concentración adaptador de 0.6-0.3 μm). Añadir 30 μl de la mezcla principal de ligadura, 1 μl de potenciador de ligadura y 2,5 μl de adaptador para la secuencia de lectura corta de alto rendimiento en los tubos.
      Nota: El volumen total debe ser μl 93.5.
    2. Mezclar bien mediante pipeteo arriba y abajo. Girar los tubos para eliminar las burbujas. Incubar los tubos a 20 ° C durante 15 minutos.
    3. Agregar 3 μl de la mezcla comercial de uracil ADN glicosilasa (UDG) y la DNA glicosilasa-liasa Endonuclease VIII (véase Tabla de materiales) a los tubos. Asegúrese de que el volumen total es de 96.5 μl. mezclar bien e incubar a 37 ° C durante 15 minutos utilizando un termociclador.
      Nota: La tapa debe ajustarse a ≥47 ° C. La versión original del Protocolo comercial cuenta con selección de tamaño después del paso de la ligadura de adaptador, seguido de una limpieza de grano como el paso final. Este protocolo, que logra un mayor rendimiento, cambia el orden de estos pasos e implementa la selección del tamaño como paso final.
  3. Limpieza para eliminar enzimas y pequeños fragmentos
    1. Homogeneizar los granos magnéticos con un vórtex.
    2. Añadir 78 μl de granos magnéticos de SPRI (80% del volumen) y homogeneizar mediante pipeteo arriba y abajo.
      Nota: Agregar cuentas al 80% del volumen total de la muestra se realiza para eliminar los fragmentos de ADN más pequeños, que son a menudo menos de 250 pares de bases. El retiro más estricto de pequeños fragmentos de ADN es (i) quitar adaptadores sobrantes y (ii) enfatizar la amplificación de fragmentos más grandes en los siguientes pasos.
    3. Dejar que incuban las muestras durante 5 minutos poner los tubos en un plato magnético para 5 minutos Retire con cuidado y deseche el sobrenadante que contiene el ADN fuera del rango del tamaño deseado.
      Nota: Tenga cuidado de no molestar a los granos que contienen los blancos de DNA deseados.
    4. Añadir 200 μL de etanol al 80% fresco en los tubos en el soporte magnético. Incubar a temperatura ambiente durante 30 s y cuidadosamente retire y descarte el sobrenadante. Repita este paso una vez. Secar los granos para 5 min mientras que el tubo está en el soporte magnético con tapa abierta.
      Nota: Evitar el sobre secado de los granos. Esto puede resultar en la baja recuperación de ADN.
    5. Retirar los tubos del imán. Eluir el destino del ADN de los granos mediante la adición de 17 μl de TE x 0,1 y homogeneizar mediante pipeteo arriba y abajo.
    6. Incubar a temperatura ambiente durante 5 minutos tubos de lugar sobre el soporte magnético y esperar a que la solución activar claro (~ 2 minutos).
    7. Sacar 15 μl del sobrenadante.
  4. Amplificación por PCR
    1. Añadir 25 μl de la mezcla principal de PCR de alta fidelidad, 5 μl de alto rendimiento corta lectura biblioteca prep 5' cartilla de secuenciación y 5 μl de alto rendimiento corta secuencia lectura biblioteca prep 3' cartilla, a 15 μl del ADN ligada adaptador limpieza.
      Nota: El volumen Total debe ser 50 μl.
    2. Mezclar bien todo con un vórtex. Coloque las muestras en un termociclador con la configuración que se encuentra en la tabla 1: ajuste de amplificación de termociclador.
      Nota: Un gran número de ciclos es necesaria debido a la baja cantidad de ADN de entrada.
Paso de ciclo A la temperatura. Tiempo Ciclos de
Desnaturalización inicial 98 ° C 30 s 1
Desnaturalización 98 ° C 10 s 12
Recocido/extensión 65 ° C 75 s 12
Extensión final 65 ° C 5 min 1
Mantenga 4 ° C

Tabla 1: Protocolo de PCR desnaturalización, recocido y extensión de tiempos y temperaturas. Temperatura y los tiempos fueron optimizados para los reactivos presentados en el presente Protocolo. Si los reactivos son alterados, temperaturas y tiempos deben optimizarse otra vez.

  1. Selección de tamaño para el tamaño deseado de la biblioteca
    Nota: Este paso de grano eliminará fragmentos tanto por encima como por debajo del rango de destino.
    1. Homogeneizar los granos SPRI con un vórtex.
    2. Añada 25 μl (50% del volumen) de granos magnéticos de la temperatura ambiente y homogeneizar mediante pipeteo arriba y abajo. Dejar las muestras incuban 5 minutos poner los tubos en una placa magnética y dejarlos reposar 5 min cuidadosamente retirar y transferir el sobrenadante a un nuevo conjunto de tubos etiquetados.
      Nota: Este volumen puede ajustarse en base a tamaño de la biblioteca deseada. El sobrenadante contiene fragmentos de ADN del tamaño deseado. En la primera incubación de grano, los granos son vinculantes fragmentos más grandes de la biblioteca. Estos son removidos para centrarse en las de la gama de pares de 400 – 600. El sobrenadante contiene fragmentos más pequeños.
    3. Añadir 6 μl de granos de SPRI la temperatura al sobrenadante y mezclar cuidadosamente mediante pipeteo arriba y abajo. Deje que las muestras incuban 5 minutos poner los tubos en una placa magnética y dejarlos reposar 5 minutos.
      Nota: Este volumen puede ajustarse en base a tamaño de la biblioteca deseada según paso 6.5.2.
    4. Cuidadosamente retire y descarte el sobrenadante.
      Nota: Tenga cuidado de no molestar a los granos que contienen el ADN deseado. En la segunda incubación de grano, los granos son vinculantes a los fragmentos a la izquierda después de la eliminación inicial de ADN más grande fragmentos. Este conjunto de fragmentos está generalmente en la gama del tamaño deseado.
    5. Añadir 200 μL de etanol al 80% fresco en los tubos en el soporte magnético. Incubar a temperatura ambiente durante 30 s, luego con cuidado Remueva y descarte el sobrenadante. Repetir. Secar los granos para 5 min mientras que el tubo está en el soporte magnético con tapa abierta.
      Nota: Evitar que se sequen demasiado los granos. Esto puede resultar en la baja recuperación de ADN.
    6. Retirar los tubos del imán. Eluir el destino del ADN de los granos en 33 μl de 0,1 x TE y homogeneizar mediante pipeteo arriba y abajo.
    7. Incubar a temperatura ambiente durante 5 minutos tubos de lugar sobre el soporte magnético y esperar a que la solución activar claro (~ 2 minutos). Sacar 30 μL del sobrenadante y transferencia a tubos con 2 mL (véase Tabla de materiales) para el almacenamiento.
      Nota: Las bibliotecas pueden conservarse a-20 ° c para almacenamiento a largo plazo.
  2. Control de calidad
    1. Ejecutar una prueba de control de calidad en las bibliotecas de ADN. Consulte los pasos 3.1 y 3.2.
      Nota: Para las bibliotecas de ADN, correr el gel ~ 45 min a 96 V.
  3. Reamplificación de biblioteca: opcional si la cantidad de la biblioteca no es suficiente.
    Nota: Las muestras con concentraciones de biblioteca debajo de 10 nM se puede reamplificada siguiendo estos pasos. Reamplificación de bibliotecas de baja concentración puede alcanzar resultados viables para secuenciación y Reamplificación puede causar un cambio modesto en la diversidad de composición de base, aunque se reunieron datos (tabla 3) indican que esto es insignificante para ciertas métricas .
    1. Diluir los cebadores universal Reamplificación usando 10 veces 0,1 x TE.
    2. Añadir 25 μl de la mezcla principal de PCR de alta fidelidad, 5 μl de cebador de Reamplificación universal diluido 1 (AATGATACGGCGACCACCGA) y 5 μl de cebador de Reamplificación universal diluido 2 (CAAGCAGAAGACGGCATACGA) a 15 μl de bibliotecas de baja concentración. Nota: Volumen Total debe estar a 50 μl.
    3. Mezclar bien todo con un vórtex. Coloque las muestras en un termociclador con la configuración que se encuentra en la tabla 1: ajuste de amplificación de Termociclador
      Nota: El gran número de ciclos es necesaria debido a la baja cantidad de ADN de entrada.
    4. Limpiar el grano
    5. Homogeneizar los granos SPRI con un vórtex. Añada 45 μl de granos de SPRI la temperatura ambiente (90% del volumen) y homogeneizar mediante pipeteo arriba y abajo.
    6. Deje que las muestras incube durante 5 minutos, poner los tubos en una placa magnética durante 5 minutos.
    7. Cuidadosamente retire y descarte el sobrenadante que contiene el ADN no deseado.
      Nota: Tenga cuidado de no molestar a los granos que contienen los blancos de DNA deseados.
    8. Añadir 200 μL de etanol al 80% fresco en los tubos en el soporte magnético. Incubar a temperatura ambiente durante 30 s, cuidadosamente Quite y descarte el sobrenadante. Repita este paso una vez.
    9. Secar los granos para 5 min mientras que el tubo está en el soporte magnético con su tapa abierta.
      Nota: Evitar que se sequen demasiado los granos. Esto puede resultar en menor recuperación de la blanco de la DNA.
    10. Retirar los tubos del imán. Eluir el destino del ADN de los granos en 33 μl de 0,1 x TE y homogeneizar mediante pipeteo arriba y abajo.
    11. Incubar a temperatura ambiente durante 5 minutos tubos de lugar sobre el soporte magnético y esperar a que la solución activar claro (~ 2 minutos).
    12. Sacar 30 μL del sobrenadante. Las bibliotecas pueden almacenarse a-20 ° C para almacenamiento a largo plazo.
  4. Control de calidad
    1. Ejecutar una prueba de control de calidad en las bibliotecas de ADN. Consulte los pasos 3.1 y 3.2. Para las bibliotecas de ADN, corren el gel ~ 45 min 96 V.
      Nota: Si se observa una doble banda en el gel, esta es probablemente una consecuencia del agotamiento de la cartilla del paso de Reamplificación. Las bandas pueden eliminarse repitiendo 6.9, pero usando sólo un ciclo en el programa PCR representado en la tabla 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Aislamiento de ADN y rendimiento Final de la biblioteca
En este estudio, se demostró la eficacia del protocolo para el aislamiento de la DNA del herbario y la recuperación de las bibliotecas de la secuencia de alta calidad con cincuenta muestras diferentes la más antigua de 1920 y el más joven de 2012 (tabla 2). Para cada muestra, se utilizó aproximadamente 10 mg de tejido foliar para el aislamiento de ADN. Tejido foliar más verde se vio favorecido si está disponible, y no tejido con evidente contaminación fúngica fue seleccionado. Éxito aislamientos se pueden hacer con tejido amarillo o marrón, aunque rendimiento debe esperarse que sea menor. Total doble trenzado DNA (dsDNA) desde el aislamiento inicial varió de 3,56 ng a 2.610 ng. Como era de esperar, ADN obtenido de muestras de herbario fue altamente degradada (figura 1A, suplementales figura 1). Una porción de estos aislamientos fueron utilizados para el corte enzimático (GN 1.26-464). Aunque herbario ADN ya está cortado a través del proceso de preservación, optimización del protocolo requiere de corte adicional para mejorar el rendimiento de la Biblioteca General. La recuperación total del dsDNA la corte varió de < 1% a 51% de entrada dsDNA, resultando en un mínimo de menos de 1.25 ng de DNA de partida para la preparación de biblioteca y un máximo de 328 ng. La extrema pérdida de ADN en algunas muestras puede atribuirse al tamaño ya pequeño fragmento de gran parte de la DNA antes enzimática corte (figura 1A, suplementario Figura 1). El uso de una limpieza de grano 90% del volumen en la DNA esquilada quitado deliberadamente los fragmentos más pequeño del ADN para enriquecer para los tamaños del fragmento más grande, más deseable. Estos pequeños fragmentos se observaron especialmente en muestras de TK463, TK657 y TK694, como se indica por una señal intensa en la marca de 100 pares (figura 1A).

La cantidad total de la selección de tamaño de mensaje de biblioteca oscilan entre 1.425 ng a 942.5 ng (tabla 2, suplemento tabla 1). Para 23 de las muestras, la preparación inicial de la extracción y la biblioteca no dió una cantidad adecuada de biblioteca (< 10 nM; Suplemento tabla 1 tabla 2), por lo que estas muestras se sometieron a las Reamplificación y recuperación los pasos del Protocolo, dando por resultado un 14 – 680 x aumento de biblioteca total (tabla 2, suplemento tabla 1). Bibliotecas finales dio lugar a una banda de entre 350 y 500 pares de bases (figura 1B, suplementales figura 2). A veces, se observó una segunda banda que era más grande que el tamaño esperado de la biblioteca (figura 1B, suplementales figura 2). Esto ocurrió cuando la Reamplificación PCR había agotado cartillas disponibles y comenzó recocido adaptadores biblioteca de fragmentos de ADN no homólogos. Esto crea una molécula donde los extremos (los adaptadores) fueron correctamente recocido, pero no el inserto de DNA. Esta molécula "burbujas" parecía más grande en un gel, como se movió más lentamente a través de la matriz de gel. Estos errores de recocido se fijaron preparando otra reacción de Reamplificación de la biblioteca ya reamplified y funcionando para un solo ciclo. Este ciclo solo proporciona cartillas para recocido correcto y amplificación, quitando la segunda banda (suplementario Figura 3).

Reamplificación de bibliotecas facilita concentraciones biblioteca final de menos de 10 nM. Estas concentraciones permitidas bibliotecas diluir igual molaridad y agrupados en una representación equitativa, ayudando a negar cuestiones que habrían surgido con la calidad de la muestra desigual y secuenciación de rendimiento de la biblioteca. Si el objetivo del proyecto es genoma de cloroplasto secuenciación, entonces la cantidad total de la secuencia necesaria variará como diversos linajes y tejidos difieren en el porcentaje total de Lee que se originan del cloroplasto DNA19. Por lo general, 50 – 100 x cobertura proyectada del genoma del cloroplasto es suficiente para el montaje, y ejecuta la secuencia puede combinarse para incluir a tantos como 70 personas según especies y el método de secuenciación.

Pruebas de contaminación, sesgo y variación causada por Reamplificación
Una notable preocupación por secuenciación de HTS es introducción de sesgo en las bibliotecas a través de extensa de amplificación PCR20. Para probar los efectos de Reamplificación e identificar posibles aplicaciones en común phylogenetic sesgos de material de herbario, comparamos una biblioteca con éxito secuenciada (TK686) con la misma biblioteca diluido 1:5 y reamplificado (designado TK686-R). Tanto TK686 y TK686-R fueron ordenados en un Illumina HiSeq4000 en el centro de biotecnología de la Universidad de Illinois Roy J. Carver y la Michigan estado Universidad de tecnología de apoyo Centro de investigación, respectivamente, utilizando 150 pares emparejados final Lee (ver Tabla 3 para los detalles de la secuencia). Lee cruda ha sido depositada en la SRA NCBI (SRP128083). Lee fueron limpiada usando Trimmomatic v.0.3621 incluyendo ajuste del adaptador utilizando NEB adaptador secuencia, calidad de filtrado para una puntuación promedio phred de 20 para un par de base 10 ventana de desplazamiento, y un mínimo corte tamaño de 40 pares de bases. Como uno de los temas principales con ejemplares de herbario contaminación fúngica, la contaminación se estimó mediante la asignación de lecturas contra una porción del JGI MycoCosm hongos genoma base de datos22 (312 genoma nuclear y genoma mitocondrial 79) con bowtie2 v . 2.2.923 usando el parámetro "muy-sensible-local". Bibliotecas de TK686 y TK686-R eran indistinguibles en la contaminación de hongos nuclear (9.24% y 9,68%, respectivamente) y la contaminación fúngica mitocondrial (0.94% y 0,8%) (Tabla 3). Aunque esto es sólo un ejemplo, sugieren que la contaminación fúngica de muestras de herbario no es despreciable y debe quitarse antes de usar datos de la secuencia de origen herbario. La base de datos y comandos utilizados para identificar y eliminar la contaminación fúngica pueden encontrarse en el repositorio de GitHub de M. R. McKain herbario genómica24.

Secuenciación del genoma del cloroplasto es comúnmente utilizado para los análisis filogenéticos, y ejemplares de herbario se utilizan cada vez más como material de fuente12. Para probar la fidelidad de Reamplificación en la Asamblea del genoma de cloroplasto, genoma de cloroplasto para TK686 y TK686-R fueron ensamblada con rápido-Plast v.1.2.525 bajo por defecto con el índice de bowtie en Poales. Se obtuvo un genoma de cloroplasto completo para TK686-R, pero el genoma del cloroplasto TK686 fue montado en siete contigs debido a la menor profundidad de lectura. Los contigs de TK686 fueron montadas manualmente siguiendo McKain et al. 26 genomas completamente montado cloroplasto fueron alineados uno al otro en un software de alineación basadas en GUI (véase Tabla de materiales) y se evaluó la variación entre asambleas. Se identificó un total de 12 SNP y un indel entre las Asambleas de cloroplasto para TK686 y TK686-R. Para cada variante, se evaluó la cobertura en sistemas de lectura de TK686 y TK686-R. En todos los casos, la variante más común era el mismo entre las dos bibliotecas. TK686 demostró una T→C, una G→A, un G→T, uno G→-, una C→A, una T→A y cuatro variantes C→A. Cinco de estas variantes se produjo dentro de una cadena de homopolímero, lo que sugiere que su incorporación a la Asamblea pudo haber sido el resultado de error de secuencia y baja cobertura total. Los otros pueden haber sido el resultado de la variación de haplotipo de cloroplasto, error de la secuencia o desaminación de la citosina, o alguna combinación de estos factores. TK686-R tenía un C→T, una G→T y una A→G. Las variantes C→T y G→T fueron encontradas en un homopolímero como arriba. En última instancia, se identificaron genoma de cloroplasto completo idéntico de ambos conjuntos leerlas. Un genoma de cloroplasto único de TK686 fue anotado usando verde21 y Comparado con otros miembros de la tribu Andropogoneae. Todas las características estándar del cloroplasto fueron anotadas: 8 rRNAs y 38 tRNAs 84 genes de codificación de la proteína. El genoma del cloroplasto completo está disponible en GenBank (MF170217) y verdes27.

Posibles sesgos de la Reamplificación de las bibliotecas se determinan a través de la estimación del % GC y contenido total estimado transposon. Porcentaje GC se estimó mediante una secuencia de comandos personalizada24. Las diferencias en el contenido de GC de las dos muestras fueron insignificantes, con 49,7% GC en TK686 y 51.2% GC en TK686-R. Composición de Transposon se estimó mediante Transposome28. Para ambas bibliotecas, 100.000 lecturas fueron aleatoriamente subsampled composición transposon se estimó mediante una identidad por ciento de los 90, una cobertura de fracción de 0.55, un tamaño de cluster de 100 y la referencia repetida RepBase 21.10 hierba conjunto29. Esto fue repetido 100 veces para realizar arranque en estimación de transposon de estos conjuntos de datos. Porcentajes de genoma total de subfamilias principales de transposones se extrajeron de salida Transposome, y se calcularon la media y desviación estándar de éstos para las 100 repeticiones. Todos los scripts usados para generar estas salidas se pueden encontrar en el repositorio de Github de M. R. McKain transposones30, y todos los resultados han sido depositados en Dríade (doi:10.5061/dryad.r8t2m). Utilizando las dos subfamilias de transposones más prevalentes como indicadores (Copia y gitana terminal larga repetición de retrotransposones), los resultados fueron casi idénticos con Copia a 33,52 ± 4.00% y 31,68 ± 2.94% y gitana en 24.83 ± 2.72% y 24.00 ± 2,35% en TK686 y TK686-R, respectivamente (tabla 3). Estos resultados de las pruebas sugieren que el paso de Reamplificación del presente Protocolo no creó sesgo de secuencia significativa para métricas de alto nivel del genoma. Sin embargo, cabe señalar que este ejemplo solo puede no ser totalmente representativo de todas las bibliotecas reamplified. Esta prueba solo demuestra que el paso de Reamplificación no fue inherentemente de polarización métricas del genoma en TK686/TK686-R. Sesgo introducido no afectaría a la Asamblea de una dado suficiente cobertura de secuenciación del genoma de cloroplasto, pero es recomendable que, como se presenta en este estudio con TK686/TK686-R, son experimentos en linajes de destino para verificar que el sesgo no es que ocurre durante los estudios que investigan la diversidad de elementos transponibles.

Figure 1
Figura 1: imágenes de gel de agarosa del) de ADN y la secuencia B) final bibliotecas de diez ejemplares de herbario. Para cada carril, se usó 3 μl de ADN o una biblioteca. (A) ADN fue degradado en todos los aislamientos de herbario en el borrón de transferencia general. Bibliotecas de secuencia Final (B) representan un grupo primario de 300-500 pares de bases con una distribución más amplia de 200-1.000 pares de bases; Este último es más frecuente en bibliotecas reamplificadas. Carriles para ambos (A) y (B) se identificaron por la muestra y puede ser comparado con resultados en la tabla 2. Tamaño de la escalera fue representado en pares de bases (PB). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Parcela circular de Schizachyrium scoparium Genoma de cloroplasto (TK686) con anotación de. El genoma completamente ensamblado de secuencia de escopeta de la DNA derivados herbario exhibió una longitud total de 139.296 pares de bases (bp), una región de gran copia (LSC) de 81.401 bp, una región de repetición invertida (IR) de 22.669 bp y una región pequeña sola copia (SSC) de 12.557 BP. Se identificaron todos los genes de codificación de proteínas estándar, tRNAs y rRNAs para miembros de la tribu Andropogoneae en la anotación. Haga clic aquí para ver una versión más grande de esta figura.

Tabla 2: Resultados de preparación de DNA extracción y biblioteca diez muestras de herbario y cuatro bibliotecas reamplificadas. El total doble trenzado DNA en varios pasos en el protocolo puede ser demostrada calidad como variable, especialmente cuando filtra por tamaño. Haga clic aquí para descargar esta tabla.

Tabla 3: estadísticas de secuenciación para el TK686 y el TK686R reamplified. Reamplificación no afecta la incidencia global de contaminación micótica genoma, estimación de contenido de GC, estimación de composición de transposon o la capacidad para ensamblar genomas enteros cloroplasto. Haga clic aquí para descargar esta tabla.

Suplemento tabla 1: resultados de ADN extracción y biblioteca de preparación de cuarenta muestras de herbario adicionales, incluyendo veinte bibliotecas reamplificadas. Total doble trenzado DNA en varios pasos en el protocolo puede ser demostrada calidad como variable, especialmente cuando filtra por tamaño. Haga clic aquí para descargar esta tabla.

Suplementario Figura 1: imágenes de gel de agarosa de cuarenta aislamientos adicionales de ADN de ejemplares de herbario. Ambos (A) y (B) representar veinte aislamientos separados de ADN y demostrar la degradación característica de la DNA derivados herbario. Para cada carril, 3 μl de ADN se utilizó. Carriles para ambos (A) y (B) se identificaron por la muestra y puede ser comparado con resultados en la tabla adicional 1. Tamaño de la escalera se representa en pares de bases (PB). Blanco manchas en la imagen se deben a artefactos en el reproductor de imágenes de gel que no se pudo quitar con la limpieza. Haga clic aquí para descargar esta figura.

Suplementario Figura 2: imágenes de gel de agarosa de cuarenta bibliotecas de adicional de la secuencia de la DNA derivados herbario. Para cada carril, 3 μl de biblioteca fue utilizado. Bibliotecas de la secuencia final se encuentran en ambos (A) y (B) con un tamaño promedio de 300-500 pares de bases. Bandas secundarias en algunas muestras amplificadas sugieren "burbujas" de las bibliotecas. Carriles para ambos (A) y (B) se identifican por la muestra y puede ser comparado con resultados en la tabla adicional 1. Tamaño de la escalera se representa en pares de bases (PB). Haga clic aquí para descargar esta figura.

Suplementario Figura 3: imagen de gel de agarosa del retiro de la banda secundaria con un paso de la polimerización en cadena de ciclo único adicional. Haga clic aquí para descargar esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El protocolo presentado aquí es un método integral y robusto para aislamiento de DNA y la secuencia de preparación de biblioteca de muestras de la planta seca. La consistencia del método y mínima necesidad de alterarlo según el ejemplar calidad hacen que escalable para proyectos grandes secuenciación basada en herbario. La inclusión de un paso de Reamplificación opcionales para las bibliotecas de bajo rendimiento permite la inclusión de baja calidad, baja cantidad, rara o históricamente importantes muestras que de lo contrario no sería convenientes para la secuencia.

Importancia de la producción de ADN inicial de
DNA derivado herbario se a menudo degrada como consecuencia inicial de la muestra preservación11, con el ADN de las muestras menos de 300 años de edad como degradado como ADN de restos de animales que son varios cientos de miles de años31 , 32. en consecuencia, es vital en la obtención de suficiente dsDNA de alta calidad para la preparación de la biblioteca de secuenciación exitosa optimización de rendimiento de ADN inicial. Para especies de gramíneas, un rendimiento óptimo se consigue mediante el uso combinado de arena esterilizada y nitrógeno líquido en la molienda inicial paso, proporcionando una más completa destrucción de las paredes celulares y la liberación de los ácidos nucleicos. Este enfoque aumenta dsDNA más deseable y fragmentos más pequeños no deseados (figura 1, suplementario Figura 1, tabla 2, suplemento tabla 1). Pasos de limpieza de grano posterior aislar y enriquecen para fragmentos de un tamaño adecuado para la secuencia (300 – 500 pares de bases), reduciendo enormemente la recuperación pero también enriqueciendo de más fragmentos (tabla 2, suplemento tabla 1). Alteraciones en los pasos de aislamiento de ADN iniciales pueden ser necesarios basado en el linaje de ser muestreado para reducir los efectos de metabolitos secundarios en procesamiento descendente18.

Optimización de los adaptadores de la biblioteca
La concentración de los adaptadores utilizados para ligadura tiene un efecto directo sobre la cantidad de dímero de adaptador en bibliotecas terminadas. Adaptador dímeros como resultado de la uno mismo-ligadura de adaptador cuando muestra insuficiente y contaminan la secuencia funciona33. El dsDNA total relativamente baja de especímenes de herbario requiere dilución de adaptadores antes de la ligadura. Adaptadores pueden ser diluidos 50 veces de la concentración stock de 15 μm (véase la Sección de protocolo) facilitar preparación de biblioteca de alto rendimiento sin la necesidad de medir individualmente y diluir adaptador para cada muestra (tabla 2, tabla suplementaria 1). aunque en principio saturación de adaptadores podría disminuir producción Biblioteca General, es poco probable que especímenes de herbario cederá dsDNA en tal exceso de adaptador.

Variación en los pasos de limpieza para un mayor rendimiento de grano
Preselección en la preparación de quimiotecas de secuenciación se realiza después de la ligadura del adaptador, que permite la amplificación de fragmentos principalmente dentro de la gama del tamaño deseado; Esto se hace mediante la eliminación de fragmentos que son más grandes y más pequeños que el tamaño deseado. La baja cantidad de dsDNA derivado herbario para la preparación de la biblioteca se exacerba después de la preselección en este paso, lo que opinaban baja dsDNA total y, en definitiva, bajo rendimiento en la biblioteca final. Mediante la realización de un paso de limpieza de grano estándar usando 90% volumen granos después de la ligadura, más dsDNA total sigue siendo para el enriquecimiento en la etapa de AMPLIFICACION. Extremadamente pequeños fragmentos de ADN se extraen preferentemente usando 90% volumen granos. Selección del tamaño se lleva a cabo en el paso final en la biblioteca amplificado, que garantiza el enriquecimiento de los tamaños del fragmento deseado. Volumen total de granos puede ajustarse para seleccionar el rango deseado, aunque los volúmenes de dos etapas de 25 μl y 6 μl de granos están optimizados para obtener las bibliotecas de 400-500 pares insertos dentro de este protocolo (figura 1B, suplementario Figura 2).

Rescate de la muestra a través de Reamplificación de bibliotecas
A pesar de las mejores prácticas en preparación de biblioteca y de ADN, concentraciones finales de las bibliotecas de la secuencia pueden ser insuficientes para seguir la secuencia. La naturaleza destructiva de muestreo y a menudo limitado material de uso de especímenes de herbario no siempre permite repetición de ADN. Por reamplifying la biblioteca hasta 12 ciclos adicionales de PCR, incluso excepcionalmente pobres bibliotecas pueden guardarse. Un par de primer estándar se utiliza para la amplificación, que es compatible con cualquiera de los dos protocolos de biblioteca indexadas doble o individual. Una preocupación primaria para Reamplificación es la introducción de sesgo, a menudo mediante la reducción de las porciones ricas en GC del genoma20. Mediante el uso de una polimerasa de alta fidelidad (véase Tabla de materiales), potencialmente se evitan los sesgos potenciales. Esto es demostrado a través de la mínima variación de contenido de GC de las bibliotecas de secuenciadas TK686 y TK686-R (tabla 3). Como segunda verificación, el contenido de transposon de TK686 y TK686-R fue estimado y no mostró ninguna diferencia apreciable (tabla 3). Por último, el genoma del cloroplasto todo de esta adhesión fue montado de TK686 y TK686-R, que dio lugar a secuencias idénticas después de la inspección cerca de variación SNP entre los dos conjuntos (figura 2, tabla 3). Estas pruebas sugieren métricas estándar de genómica, tales como contenido de GC y composición de transposon y la capacidad para ensamblar genomas completos del cloroplasto, no pueden verse afectadas por la Reamplificación. Esto abre la posibilidad de incorporar herbario muestras cree que se degrada demasiado o falta de material en phylogenomic estudios sin preocupación por el sesgo introducido por PCR. Estas bibliotecas reamplified podrían utilizarse también para la secuencia de captura34, aunque sería necesario comprobar llamadas SNP es parcial. Se recomienda que las pruebas a pequeña escala de sesgo realizar con cada proyecto para verificar que bias no es introducido en las bibliotecas de la secuencia.

Limitaciones y posibles modificaciones
Aunque este protocolo ha trabajado en cientos de ejemplares de herbario, mal conservado tejidos todavía pueden fallar en cualquier paso. Sin embargo, es excesivamente raro para las bibliotecas no de tejidos con extracciones exitosas de ADN, especialmente después del rescate de la biblioteca a través de Reamplificación. Los pasos de selección de tamaño se pueden modificar a fragmentos de tamaño diferentes o para reducir la amplia gama de fragmentos vistos en algunas bibliotecas finales. Como con todos los protocolos de extracción basados en plantas, pasos pueden ser necesaria para eliminar el linaje-específicas compuestos secundarios que pueden impedir el protocolo general. Tal como se presenta, este protocolo proporciona un método estándar para la preparación de ADN aislamiento y alto rendimiento de biblioteca para especímenes de herbario hierba y a través de verificación y experimentación es probable que sea modificable a otros linajes de la planta.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses que compiten.

Acknowledgments

Agradecemos a Taylor AuBuchon-anciano, Jordania Teisher y Kristina Zudock asistencia en ejemplares de herbario de muestreo y el jardín botánico de Missouri para el acceso a los especímenes de herbario para muestreo destructivo. Este trabajo fue el apoyo de una beca de la National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics