מגנטי תא לפעיל על-מיון אסטרטגיות כדי לבודד ולטהר Synovial נגזר הנוזלים בתאי גזע Mesenchymal ממודל ארנב

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

מאמר זה מציג פרוטוקול כלכלי ופשוט עבור בידוד ישיר וטיהור של גזע mesenchymal של ניו זילנד הארנב הלבן synovial נוזל.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

גזע mesenchymal (MSCs) הם המקור העיקרי תא לטיפול מבוססת-תא. MSCs מן נוזל במפרק synovial יכול לשמש באופן פוטנציאלי הנדסת רקמות הסחוס. MSCs מ synovial נוזל (SF-MSCs) היה נחשב מבטיח מועמדים התחדשות מפרקיות, התועלת הטיפולית הפוטנציאלית שלהם גרמה להם נושא מחקר חשוב של המנוח. SF-MSCs מ חלל הברך של הארנב ניו זילנד הלבן יכול להיות מועסק כמודל translational ממוטבת כדי להעריך רפואה רגנרטיבית אנושי. באמצעות מבוססי CD90 מגנטי הופעל תא מיון טכנולוגיות (מקינטוש), פרוטוקול זה בהצלחה משיג ארנב SF-MSCs (rbSF-MSCs) ממודל זה ארנב ועל בהמשך מדגים באופן מלא על פנוטיפ MSC של תאים אלה על ידי גרימת אותם כדי להבדיל את תאי העצם, adipocytes ו- chondrocytes. לכן, ניתן ליישם גישה זו מחקר ביולוגיה של התא, הנדסת רקמות בעזרת ציוד פשוט ונהלים.

Introduction

MSCs שהוצעו מקור רב ערך עבור רפואה רגנרטיבית, במיוחד עבור סחוס נגעים. MSCs, כולל chondrocytes, תאי העצם, adipocytes, השלד של תאי שריר, תאי סטרומה מהבטן, בהרחבה להרחיב את אזורי עבור השתלת תא גזע עקב שלהם הרחבה גבוהה קצב ואת שושלת היוחסין מרובה בידול פוטנציאליים1. MSCs ניתן לבודד השלד שריר, synovium, מח עצם, רקמת שומן2,3,4. הממצאים יש גם confirmed את הנוכחות של MSCs בנוזל synovial, מחקרים קודמים זיהתה MSCs נגזר נוזל synovial (SF-MSCs) מבטיח מועמדים התחדשות מפרקיות5,6.

עם זאת, מחקר וניסוי פרה על דגימות האנושי כפופים סוגיות אתיות רבות. במקום זאת, ארנבים, ממשיכים להיות הכי נפוץ מיני בעלי חיים כדי להדגים כי השתלת של MSCs ניתן לתקן נזק לסחוס. בשנים האחרונות, מספר גדל והולך של חוקרים חקרו ארנב בתאי גזע mesenchymal (rbMSCs) בשני במבחנה , ויוו, כמו תאים אלה הם MSCs דומה האדם בפיזיולוגיה ביולוגיה ורקמות הסלולר שלהם. באופן דומה, rbMSCs מסוגלים הקפדה על משטחי פלסטיק, הצגת ציר-פיברובלסט מורפולוגיה כמו MSCs אנושי. יתרה מזו, דגימות mesenchymal הארנב הם פשוט וקל לקבל7. בנוסף, הנקודות המכריעים הם rbMSCs אקספרס סמני פני השטח, כגון CD44, CD90, CD105, ו הבידול השושלת מרובה פוטנציאליים נשמר, שהוא מסכים עם הקריטריונים לזיהוי של אוכלוסיות MSC כמו מוגדרת על ידי האגודה הבינלאומית הסלולר8,9. בפרט, chondroprogenitors נוזלים synovial מסוגלים chondrogenesis שאינם היפרטרופית כאשר שנגזרות TGF-β1, ובכך הופך אותם מקורות תא מתאים עבור10,התחדשות הסחוס במפרק phenotypically11, 12.

עם זאת, בידודו של SF-MSCs שונה במידה רבה רקמות אחרות, כולל את חבל הטבור, רקמת שומן, דם היקפיים ו מח עצם. כיום, הגישות הנפוצות הטיהור ומיון של SF-MSCs הם cytometry זרימה ומיון immunomagnetic מבוסס-חרוז, למרות השיטה cytometry זרימה דורש סביבה ספציפיים עם מכשירים יקרים מאוד13.

מאמר זה מציג שגרה עבור האוסף פשוטה ולא פולשנית של דוגמיות של נוזל synovial מניו זילנד וארנבים לבנים. במהלך ההליך, rbSF-MSCs stably המורחב במבחנה , ואז מבודדים CD90 נהלים חיובי מבוסס-חרוז מגנטי. לבסוף, הפרוטוקול מראה כיצד להשיג MSCs עם טוהר גבוהה, הכדאיות מן המקורות תא שנקטפו.

ב פרוטוקול זה, מבודד rbSF-MSCs מאופיינים בהתבסס על המורפולוגיה שלהם, ביטוי של סמנים ספציפי, pluripotency של תאי גזע. Immunophenotyping מבוססי cytometry זרימה מגלה ביטוי חיובי משמעותי של CD44 ו- CD105, ואילו הביטוי של CD45 ו- CD34 הוא שלילי. לבסוף, וזמינותו במבחנה עבור rbSF-MSCs מדגים את הבידול osteogenic, adipogenic ו- chondrogenic של תאים אלה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל הניסויים נערכו בהתאם להנחיות ועדת האתיקה אזוריות ולאחר כל ההליכים בבעלי חיים אושרו על-ידי טיפול בעלי חיים מוסדיים ו שימוש הוועדה של שנג'ן השני של אנשים החולים, אוניברסיטת שנג'ן.

1. לבודד, תרבות rbSF-MSCs

  1. ההכנות לקראת ההליך בעלי חיים
    1. להתכונן לבגרות skeletally הנשי ניו זילנד וארנבים לבנים האוסף של rbSF-MSCs. לבצע בדיקה קלינית של הארנבים יום אחד לפני ההליך arthrocentesis והרדמה.
      הערה: בדיקות גופניות צריך לכלול משקל (2.0-2.5 ק"ג), מגדר (נקבה), ואת טמפרטורת הגוף, קצב נשימה, קצב הלב. פרמטר מרווחי לארנבים קלינית בריא הם 30-50 דקות עבור קצב נשימה, 220-280 דקות עבור קצב הלב, 38-39 מעלות צלזיוס על טמפרטורת הגוף.
    2. מהר החיות במשך 6 שעות לפני ההרדמה.
  2. ההכנות וההליך לקבלת ההרדמה בעלי חיים
    1. לרסן את הארנב. כלוב (ראה טבלה של חומרים), ואת להזריק 3% סודיום פנטוברביטל לווריד אוזן שולי במינון של 1 מ"ל/ק"ג על הרדמה כללית.
    2. הצב את הארנב בתנוחה הגבי-שכיבה נוחה.
    3. לנטר את קצב הנשימה, קצב הלב, טמפרטורת הגוף של הארנב במהלך הרדמה.
    4. השתמש משחה ophthalmologic את עיניו כדי למנוע יובש במהלך הרדמה.
    5. להעריך את עומק מההרדמה שאחרי הסיווג של Guedel14.
  3. הכנה MSCs בידוד והטיפוח -תרגול
    1. לטפח rbSF-MSCs, הכנת 500 מ"ל של מדיום תרבות מסחרית (ראו טבלה של חומרים) בתוספת 10% מסחרי תוספת (ראה טבלה של חומרים), 10% עוברית שור סרום (FBS), ו 1% פניצילין-סטרפטומיצין.
    2. דגירה המדיום תרבות ב 37 מעלות צלזיוס בתוך אמבט מים.
    3. היכונו 500 מ"ל תמיסת מאגר פוספט (PBS) בידוד תא, התא כביסה.
    4. היכונו 100 מ ל תמיסת מלח מול ההליך arthrocentesis חלל הברך.
  4. אוסף של מפרקיות fl synovial uid מתוך הברך של הארנב
    1. בחר אזור כ 5 x 5 ס מ בגודל סביב הברך, לגלח את השיער ארנב מהאזור הזה באמצעות גילוח של בטיחות.
    2. לסירוגין, לחטא האתר הליך 3 x עם povidone יוד פתרון ו- 75% אתנול. לאחר מכן, להחיל תחבושות חיטוי לאחר האזור ביסודיות יבש.
    3. להזריק 1-2 מ ל תמיסת מול, באמצעות מחט תת-עורית סטרילי (2 מ"ל), לתוך חלל משותף הברך מן המרחב מפרקיות לרוחב, להזיז את הברך 3-4 x ולאחר מכן למצוץ כל הנוזל synovial בטמפרטורת החדר.
    4. לסנן את fluid synovial דרך מסננת תא ניילון מיקרומטר 40 כדי להסיר את כל הלכלוך בתוך 4 שעות.
  5. תרבות של rbSF-MSCs
    1. לאסוף את fluid המסוננות ב 50 מ ל צנטריפוגה צינורות, צנטריפוגה-1,500 סל ד 10 דקות בטמפרטורת החדר.
    2. למחוק את תגובת שיקוע לאחר צנטריפוגה, לשטוף את גלולה עם PBS, resuspend בגדר עם המדיום תרבות שלמה ולאחר מכן צלחת המדיום במנות 100 מ מ.
    3. דגירה כל המנות של 37 ° C באווירה humidified, המכילה 5% CO2.
    4. לאחר 48 שעות, לחדש את הכלים בינונית טרייה כדי להסיר תאים שאינם מחסידי. החלף את המדיום פעמיים בשבוע במשך שבועיים כמו המעבר 0 (P0).
      הערה: צריך להיות בערך 1 x 104 תאים חסיד. תאים למ"ל קיימא ב- SF הן בערך 2 x 102/mL.
    5. אחרי 14 יום לאחר ציפוי הראשונית של מושבות רבות צריך יצרו במנות תרבות. בחר את המושבות הגדולים מ- 2 מ מ קוטר. לסמן היכן ממוקמים המושבות שנבחר ע י איתור שלהם היקף בתחתית צלחת.
    6. למחוק את המושבות < 2 מ מ רחב, באמצעות תא מגרדים. לעכל את המושבות שנבחרו עם µL כ-5 של 0.25% טריפסין, באמצעות צילינדר שיבוט, ולהעביר את המושבות תבשיל חדש כמו מעבר 1 (P1).
  6. לאחר הניתוח טיפול בבעלי חיים
    1. בצע את ההליכים הפעלה מוסדי רגיל עבור ניטור שלאחר הניתוח של ההתאוששות מן ההרדמה.
    2. לעקוב אחר הסימנים החיוניים של הארנב כל 10 דקות עד שזה שהכרתו. לבסוף, העברת החיה בהכרה לכלוב. אל תשיבו ארנב עבר ניתוח החברה של בעלי חיים אחרים עד זה הוא החלים לחלוטין.
    3. פעולה-מאוחרת, לחטא את האתר עם 0.1% povidone יוד, 2 x ביום למשך 3 ימים.

2. CD90-חיוביות מגנטי הופעל התא מיון (מקינטוש) של rbSF-MSCs והתרבות העיקריים

  1. הכנת הדוגמא
    1. כאשר התאים מגיעים בסביבות 80% confluency, תשאף המדיום, ולאחר מכן להוסיף 1-2 מ של 0.25% טריפסין-EDTA על כל מנה.
    2. דגירה המנות למשך 2-3 דקות לאפשר ניתוק התא.
    3. ברגע התאים מנותקים, להוסיף כמות שווה של המדיום תרבות כדי להשבית את טריפסין.
    4. עוברים התליה תא דרך מסננת תא 40 µm, לאסוף את פילטרט של צינור 15 מ"ל, ואז לסובב את התאים ב g 600 × 10 דקות בטמפרטורת החדר.
    5. Resuspend בגדר תא במקינטוש הפעלת מאגר (PBS, pH 7.2, אלבומין שור 0.5%, ו- 2 מ מ EDTA), ואז לספור את התא.
  2. תיוג מגנטי
    הערה: למיין את rbSF-MSCs עם תא מגנטי מופעל מיון קיט המכיל עמודות, דוכן, מפרידים (ראה טבלה של חומרים).
    1. לקבוע את מספר התא באמצעות של hemocytometer.
    2. Centrifuge התליה תא ב 300 גרם × 10 דקות ב 4 º C. לגמרי מחוק לגמרי את תגובת שיקוע.
    3. הוסף µL 80 resuspension מאגר לכל 10 תאים סה כ7 .
    4. עבור 107 הכולל תאים, להוסיף 20 µL של גרגרי מצומדת עם נוגדן CD90 monoclonal אנטי-ארנב.
    5. לערבב את beads מגנטי תאים בשכבה אחידה הצינורות ולאחר מכן דגירה אותם ב 4 מעלות צלזיוס למשך 15 דקות בחושך.
    6. להוסיף 1 מ"ל של מאגר לכל 107 תאים הצינור ולאחר מכן centrifuge זה ב 300 גרם × 10 דקות ב 4 ° C כדי לשטוף את התאים. למחוק את תגובת שיקוע לאחר צנטריפוגה.
    7. Resuspend בגדר ב 500 µL מאגר לכל 107 תאים.
  3. הפרדה מגנטית
    1. מקם את העמודה המכילה הכנפיים עמודה לחזית לתוך השדה המגנטי למפריד מגנטי.
    2. יש לשטוף את העמודה מפריד מגנטי (MS) עם 500 µL מאגר לכל 107 תאים.
    3. העברת התליה תא בודד לתוך העמודה. תן התאים שלילי לעבור דרך השדה המגנטי כדי למחוק את התאים האלה ללא תווית.
    4. לשטוף את עמודת x 1-2 עם µL 500 מאגר לכל 107 תאים וזורקים את הזרימה דרך.
    5. להעביר את העמודה לתוך שפופרת צנטרפוגה (15 מ"ל).
    6. להוסיף 1 מ"ל של המאגר לכל 107 תאים בעמודה, ולאחר מכן לדחוף מיד על הבוכנה לתוך העמודה כדי. להוריד את התאים שכותרתו מגנטית.
    7. חזור על הפעולות הנ עם עמודה MS השני כדי להגדיל את הטוהר של CD90+ תאים, אשר יכולים להעשיר את השבר eluted.
    8. Centrifuge התליה תא ב 300 גרם × 10 דקות, וארוקן את תגובת שיקוע, resuspend זה עם המדיום תרבות.
  4. תרבות של CD90+ rbSF-MSCs
    1. לחסן את התאים במנות 100 מ מ לאחר המיון תא מגנטי הופעל.
    2. דגירה כל המנות של 37 מעלות צלזיוס חממה תא humidified עם 5% CO2.
    3. כאשר הנהרות 80-90% של התרבות העיקרי מושגת, על 7-10 ימים, לעכל את תאים חסיד עם 0.25% טריפסין-EDTA ומעבר אותם לדילול 1:2 לבצע מעבר 2 (P2).
    4. להשתמש באותה השיטה כדי להעביר את התאים כדי מעבר 3 (P3), אשר יכול לשמש את מבחני במבחנה .
      הערה: לאחר תת התרבות ועל טיהור, בערך 1 x 107 rbSF-MSCs מתקבלים.

3. זיהוי של rbSF-MSCs

  1. סמן משטח אישור rbSF-MSCs מאת cytometry זרימה
    1. כאשר MSCs 80-90% confluent-P3, לשטוף את התאים עם PBS ולטפל בהם עם 1 מ"ל של 0.25% טריפסין-EDTA. לאחר מכן, דגירה של MSCs ב 37 מעלות צלזיוס למשך 2-3 דקות עד התאים הם צמודי קרקע.
    2. לקצור את התאים באמצעות 10 מ"ל ל- PBS, להעביר אותם לתוך צינור חרוטי (15 מ ל), centrifuge אותם ב g × 300 במשך 5 דקות בטמפרטורת החדר.
    3. למחוק את supernatants. Resuspend בגדר תא ב- 500 µL ל- PBS והעבר אותו לתוך צינור 1.5 מ.
    4. דגירה לדילול מטריים FITC מצומדת ו PE מצומדת נוגדנים (isotype, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) עבור h 1 בחושך ב 4 º C.
    5. Centrifuge תערובת זו ב g × 300 במשך 5 דקות בטמפרטורת החדר, לשטוף את התאים פעמיים עם PBS על ידי צנטריפוגה ב g × 300 במשך 5 דקות בכל פעם. למחוק את supernatants.
    6. Resuspend תאי µL 500 ל- PBS, העברת התליה תא לתוך צינור עגול-התחתון (5 מ"ל) ולנתח אותו באמצעות cytometer של זרימה.
      הערה: לרכוש נתונים cytometer מצויד בשני ערוצים זריחה: 533/30 ו- 585/40. עבור כל זריחה isotype, להשתמש בפקד isotype כדי להתאים את המתח לייזר המתאימים, להגדיר את עוצמת המינימלי הדרוש כדי לקבל היסטוגרמה פלורסצנטיות המציג הן השמאליים והימניים של הפסגה. לאסוף למינימום של 10,000 לאירועים ניתוחים סטטיסטיים.
  2. Multidifferentiation של rbSF-MSCs
    הערה: שימוש P3 rbSF-MSCs עבור במבחנה מבחני multidifferentiation.
    1. בידול osteogenic
      1. להכין המדיום אינדוקציה osteogenic: DMEM basic (1 x) המכיל 50 מ מ של אסקורבית L חומצה-2-פוספט, 10 מ מ של α-glycerophosphate ו- 100 ננומטר של דקסאמתאזון.
      2. זרע תאי-10 תאים/ס מ3 2 בצלחת תרביות רקמה 6-ובכן, תרבות אותם במדיום אינדוקציה osteogenic.
      3. לשנות את המדיום אינדוקציה כל 3 ימים למשך 3 שבועות.
      4. לתקן את התאים עם 4% פורמלדהיד למשך 30 דקות בטמפרטורת החדר לאחר השלמת את הבידול, מכתים את התאים עם 1% רד Alizarin במשך 5 דקות ולאחר מכן לשטוף אותם 3 x עם PBS15.
    2. בידול Adipogenic
      1. להכין המדיום אינדוקציה adipogenic: DMEM basic (1 x) בהיקף של 100 מ מ של indomethacin 10 מ"ג/מ"ל של אינסולין רקומביננטי אנושי, 1 מ מ דקסאמתאזון, 0.5 מ מ 3-איזובוטיל-1-methylxanthine.
      2. פנקו את rbSF P3-MSCs למשך 3 שבועות במדיום אינדוקציה adipogenic.
      3. לאחר 3 שבועות, כתם של וקואלות השומנים נייטרלי באמצעות שמן אדום O כדי לאשר את הבידול adipogenic. לתקן את התאים בפתרון פורמלדהיד 4% למשך 30 דקות בטמפרטורת החדר, ולאחר מכן לשטוף אותם 3 x עם PBS16.
    3. בידול Chondrogenic
      1. להכין המדיום אינדוקציה chondrogenic: DMEM basic (1 x) בהיקף של 10 ננוגרם למ"ל של TGFβ1, 1% תוספת שלה, 0.35 מ מ L-פרולין, 100 ננומטר של דקסאמתאזון, 50 מ מ של אסקורבית L חומצה-2-פוספט, ו- 1 מ מ של נתרן פירובט.
      2. השתמש צניפה culturing עבור אינדוקציה chondrogenic. צנטריפוגה 5 × 105 P3 rbSF-MSCs ב 1500 סל ד 10 דקות צינור פוליפרופילן (15 מ ל) כדי ליצור גלולה.
      3. תרבות כדורי למשך 3 שבועות עם המדיום אינדוקציה chondrogenic.
      4. לשנות את המדיום כל 3 ימים למשך 3 שבועות.
      5. לאחר 3 שבועות אינדוקציה, להטביע בגדר תא עם פרפין, סעיף זה פרוסות 4 מ מ, כתם אותם באמצעות 0.1% טולדין כחול למשך 30 דקות-בטמפרטורת החדר17.
  3. סה כ החילוץ-RNA וניתוח מאת כמותיים בזמן אמת תגובת שרשרת פולימראזית (PCR לרביעיית)
    1. לנתק הרנ א הכולל של התאים לאחר אינדוקציה 3 שבועות בידול באמצעות החילוץ RNA מסחרי קיט (ראה טבלה של חומרים).
      1. להסיר את המדיום תרבות בצלחת תרבות ולאחר מכן להוסיף 1 מ"ל של ריאגנט בידוד.
      2. Lyse בתאים על-ידי pipetting חוזרות ונשנות עד שהתמיסה אחידה. דגירה זה בטמפרטורת החדר במשך 3 דקות.
      3. להעביר את התא lysate לתוך צינור microcentrifuge 1.5 mL.
      4. להוסיף 100 µL של כלורופורם, לנער את זה על ידי יד 15 x, דגירה התערובת בטמפרטורת החדר במשך 3 דקות.
      5. Centrifuge את הצינור ב g × 12,000 למשך 15 דקות ב 4 º C. להעביר את supernatants לתוך צינור 1.5 מ ל microcentrifuge.
      6. להוסיף 500 µL של אלכוהול איזופרופיל, לזרז את הרנ א 10 דקות בטמפרטורת החדר.
      7. צנטריפוגה ב 12,000 × g עבור 10 minat 4 ° C. בגדר RNA צריך להיות גלוי בחלק התחתון של הצינור.
      8. הסר את תגובת שיקוע ולאחר מכן להוסיף 500 µL של 75% אתנול. בקצרה לסובב את הצינור למשך מספר שניות לשטוף את בגדר RNA. Centrifuge זה ב 7,500 g × במשך 5 דקות ב 4 º C.
      9. הסר האתנול שיורית.
      10. להמיס בגדר RNA ב 10 µL DEPC מים ומניחים הצינורות על קרח.
    2. הפוך לתמלל RNA הכולל לתוך cDNA לסינתזת DNA קיט (ראה טבלה של חומרים).
      הערה: ביצוע כל ההליכים הבאים על קרח.
      1. מכינים את תערובת הבסיס של שעתוק במהופך.
      2. להוסיף 25 µL של RNA שטופלו DNase כל שפופרת עם µg 1 של RNA.
      3. דגירה התערובת בטמפרטורות הבאות באמצעות הצנטרפוגה תרמי של ה-PCR: 26 ° C 10 דקות (כדי לאפשר את hexamers אקראי anneal), 42 º C למשך 45 דקות (שעתוק במהופך) ו- 75 מעלות צלזיוס למשך 10 דקות (להשבית את רוורס טרנסקריפטאז).
      4. מיד לנתח את cDNA שנוצר על ידי ה-PCR כמותי בזמן אמת, או לאחסן אותו ב-20 ° C.
    3. לבצע את ניתוח ביטוי גנטי עם מערכת ה-PCR כמותי בזמן אמת.
      1. השתמש מיקס מאסטר לרביעיית-PCR (ראה טבלה של חומרים) כדי לבצע PCR. צבעי יסוד PCR GAPDH, Runx2, קנאה, PPARγ מפורטות בטבלה 1.
      2. לחשב ביטוי גנים בשיטתΔΔCT 2.
      3. לבצע ניתוח סטטיסטי באמצעות תוכנה סטטיסטית סטנדרטי. להשתמש במבחן t מדגם עצמאית כדי להשוות את האמצעים קבוצה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

בידוד, טיהור והתרבות של rbSF-MSCs:
פרוטוקול זה משתמש מקינטוש לבודד rbSF-MSCs, מבוסס על הביטוי של סמן משטח MSC CD90. תזרים תהליך של rbSF-MSCs בידוד, טיהור, אפיון ואת פרוטוקול תרבות במבחנה מוצג באיור1.

מורפולוגיה תאים לאחר מגנטי תא מופעל מיון (מקינטוש) עם CD90:
ראשית, עבור MACS, immunolabel MSCs עם חרוזים מגנטי CD90. לאחר צנטריפוגה, resuspend לכל היותר 107 תאים ב- 80 µL של מאגר מיון precooled, ולאחר מכן להוסיף µL 20 חרוזים מגנטי CD90, ואחריו vortexing, דגירה ב 4 מעלות צלזיוס למשך 15 דקות. לאחר מכן, לשטוף את התאים עם 1 מ"ל של המאגר מיון, resuspend אותם ב- 500 µL של המאגר המיון. לפני שתמשיך עם המיון המגנטי, חזור על השלב כביסה. הליך זה קריטי מוצג באיור2.

לפני מיון, האוכלוסיות תא נוזלים synovial ארנב חסיד שתוצג מורפולוגיה הטרוגנית, המכילה סוגי תאים שונים וגדלים (איור 3 א). בעקבות MACS, האוכלוסיות תא הציג מורפולוגיה הומוגנית. המספר הסלולרי היה גדל עם תת תרבות (איור 3D-F).

פני השטח rbSF-MSCs מועשרת מאפיינים של מקינטוש:
לפעיל על-ידי קרינה פלואורסצנטית התא מיון (FACS) בוצע כדי לנתח את העשרת של rbSF-MSCs על ידי מקינטוש עם CD90. לפני MACS, האוכלוסייה תא כללה כ 40% MSCs (איור 4Cיח; isotype את הפקדים איור 4A,B). בעקבות MACS, האוכלוסייה מועשר הכיל כ > 99% MSCs (איור 4E,F). שושלת hematopoietic התא סמני CD34 ו CD45 היו, 0.318%, שניהם רק לעתים רחוקות הביע לאחר MACS, שזה ירידה שלהם הביטוי הראשונית ב- 25.9%. לפני בחירה, היו כ-28% CD90+ תאים (איור 4G); לאחר טיהור, בערך 98 אחוזים CD90+ תאים התקבלו (איור 4 H).

Multilineage בידול פוטנציאלי של rbSF-MSCs:
כדי לאפיין את הקיבולת של rbSF-MSCs כדי להתמיין שושלות שונות כגון osteogenic, adipogenic, תאים chondrogenic, rbSF-MSCs מועשרים מקינטוש היו בו זמנית תרבותי במדיום בידול מסוים ואת בידול בינונית ללא ציטוקין לשמש כפקדי. עם השלמת תנאי הגיוס, היוחסין הספציפי סמני נותחו על ידי צביעת ו- RT-PCR. Alizarin אדום צביעה של תרכובות סידן הוכיח כי על בסיס מינרלים מן גושים גיבש ב rbSF-MSCs לאחר 3 שבועות בתנאים אינדוקציה osteogenic (איור 5A). לאחר 3 שבועות של אינדוקציה adipogenic, הצטברות של שומנים בדם-עשיר וקואלות יכול יזוהו על-ידי תאיים O אדום שמן מכתים (איור 5B). במשך 21 ימים האינדוקציה chondrogenic, היה בגדר תא בהיסטולוגיה לבדיקה עם טולדין כחול מכתים. תאים חיוביים עבור צביעת (כדי פרוטאוגליקן) היו נחשבים תאים, כמו chondrocyte (איור 5C). בדומה תוצאה זו, ניתוח כמותי של ביטוי גנים של בידול פוטנציאליים גם הוכיח יכולת התמיינות של תאים אלה. רמות הביטוי של קנאה (סמן chondrocyte), PPARγ (סמן adipogenic) Runx2 (סמן אוסטאובלסט) היו upregulated בתנאים המושרה. נתונים אלה הוכיח את יכולת התמיינות multipotent rbSF-MSCs לתוך trilineages (איור 5D).

Figure 1
איור 1: מלא תיאור סכמטי של בידוד, טיהור, ואפיון של SF-MSCs ניו זילנד הלבן ארנבים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: פרוטוקול מגנטי תא מופעל מיון (מקינטוש) עם CD90. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: מורפולוגיה של טפט תרבותי rbSF-MSCs לפני, והפכתי לאחר MACS כפי שנבדקו תחת רגיל מיקרוסקופ. A-C) לפני מיון, האוכלוסיות תא נוזלים synovial ארנב חסיד להציג הטרוגניות. הם מכילים סוגי תאים שונים וגדלים, כגון אליפסה, ארוך-קנים, קצר-קנים, מורפולוגיה stellate. המבנה העיקרי של P2 ו- P6 הוא מורפולוגיה פלך (א: P2, B: P3, ג: P6). D-F) בעקבות מקינטוש עם CD90, האוכלוסיות תא התערוכה של מורפולוגיה הומוגנית. עם תת תרבות, גדל מספר התא (D: P2, E: P3, F: P6). סרגל קנה מידה = 100 מיקרומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: זיהוי של סמני פני השטח rbSF-MSC. באמצעות ניתוח cytometry זרימה, rbSF-MSCs הן חיוביות עבור הסמנים MSC CD44 ו- CD105, בעוד שלילי עבור דה מרקר תא אנדותל CD34 ו- the marker תא hematopoietic CD45. לפני MACS, תאים אלה יש שיעור נמוך של חיוביות עבור CD44 ו- CD105. עם זאת, לאחר MACS, הקצב של הגישה החיובית היה גבוה. A, B) אלה שתי תמונות העליון להציג את הנתונים בפקד isotype. C, D) תוצאות אלו מראה כי לפני MACS האוכלוסייה rbSF-MSC מורכב של-40% MSC תאים. E, F) לאחר MACS, האוכלוסייה מועשר מכיל > 99% MSC תאים. G, H) תמונות אלה הראה לי את הניתוח cytometry זרימה של CD90+ מרקר, (G) לפני ו- (ג) לאחר MACS מיון. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: ניתוח של שושלת היוחסין הספציפי סמנים על ידי צביעת ו- RT-PCR. A) Alizarin מכתים אדום מדגים כי על בסיס מינרלים מן גושים טופס תחת אינדוקציה osteogenic למשך 3 שבועות. B) לאחר 3 שבועות של אינדוקציה adipogenic, ההצטברות של שומנים בדם-עשיר וקואלות מזוהה על ידי צביעת שמן אדום O תאיים. C) למשך 3 שבועות האינדוקציה chondrogenic, בגדר תא היה לבדיקה בהיסטולוגיה עם טולדין כחול מכתים. תאים חיוביים עבור צביעת (כדי פרוטאוגליקן) היו נחשבים תאים, כמו chondrocyte. סרגל קנה מידה = 100 מיקרומטר. D) לאחר culturing למשך 3 שבועות, ה-mRNA יחסית הביטוי של סמנים אוסטאובלסט (Runx2), סמני adipogenic (PPARγ) chondrogenic סמנים (Agg) הוא זוהה. עבור כל ניתוח, p ערכים < 0.01 נחשבו סטטיסטית הבדלים משמעותיים באמצעות מבחן Kruskal-איי ווליס (כמוצג * *). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

גנים קדימה פריימר (5' – 3') הפוך פריימר (5' – 3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
קנאה GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

טבלה 1: רשימת גנים, תחל השתמשו במחקר זה עבור ה-PCR כמותי בזמן אמת-

Subscription Required. Please recommend JoVE to your librarian.

Discussion

קיומו של MSCs בנוזל synovial מספק אלטרנטיבה לטיפול מבוססת-תא. מחקרים קודמים הראו כי פגיעה האתרים מכילים כמויות גבוהות של גזע mesenchymal בנוזל synovial שלהם, אשר עשוי להיות בקורלציה עם התקופה לאחר פציעה5. MSCs בנוזל synovial עשוי להיות מועיל לרקמות לשיפור ריפוי ספונטני לאחר18,פגיעה19. לעתים נדירות כבר מכוסה היישום הקליני של SF-MSCs בספרות, בעיקר בגלל המנגנון של SF-MSCs במפרקים נשאר לא מוגדר20. ג'ונס ואח. 21 דיווחו כי המספרים hSF-MSC המפרקים בברך להגדיל באופן משמעותי 7-fold כבר בשלבים המוקדמים של דלקת מפרקים ניוונית (OA). הם חשבו כי SF-MSCs מוגבר יכול לתרום שמירה על הומאוסטזיס פיזיולוגיים של המפרקים.

במודל חיה אידיאלית היא כלי הכרחי בפיתוח של ניצול רפואה רגנרטיבית ו translational הרפוי. למרות הבדלים ברורים בין בני אדם, ארנבים, הארנב משמש בהרחבה כמודל בעלי חיים לצורך המחקר של רקמות התחדשות7, ובכך ומעודדת אותנו להאמין לבחור בו כמודל עבור המחקר שלנו של SF-MSCs. אחד המכשולים מרתיעה יותר במאמץ הזה הוא כי הבידוד של SF-MSCs לעיתים קרובות התוצאה אחוזי הצלחה מגוונת תדרי מושבת נמוך, כפי שדווח במחקר קודמות5. לכן, חוקרים רבים התמקדו שיעורי ההצלחה ואופטימיזציה של הבידוד של MSCs מאתר SF.

Studyeffectively זו משמשת הליך MACS טוהר מיון גבוהה הכדאיות של CD90+ MACSs של הארנב נוזל synovial22. מערכת זו MACS מנצל מגנטי. גרגרי מצומדת כדי נוגדנים ספציפיים מאוד מצמידים אנטיגן פני לתא מסוים, CD90 במקרה זה, ומאפשר הבחירה של סוג התא יעד מסוים, כלומר התאים מבטאים CD90. לפני הטיהור עם גרגרי CD90, אנחנו בדרך כלל תרבות rbSF את ראשי-MSCs למשך 14 ימים. במהלך תקופה זו, מושבות רבות נוצרות במנות תרבות. פרוטוקול זה מצביע על בחירת המושבות הגדולים מ- 2 מ מ קוטר. בעת שימוש הגליל השכפול עבור הבחירה המושבה, אנחנו בקפידה התבוננו בו תחת המיקרוסקופ. המושבה יחיד נוספת הופץ לטיהור.

במהלך התהליך של הפרדה וטיהור, התאים מבטאים CD90 מגנטית עם תווית נמשכים על-ידי השדה המגנטי למפריד בעמודה, ואילו התאים ללא תווית זורמת דרך. לאחר תהליך הכביסה, העמודה תוסר מן השדה המגנטי למפריד, תאי היעד הם eluted מן העמודה. גישה microbead MACS ספציפית זו מאפשרת את ניתוקה של rbSF-MSCs במיוחד שביטא את תאי השטח סמני CD44 ו- CD105, הוכחת כי תאים מבודדים אלה הם גזע mesenchymal מאשר תאים hematopoietic23. RbSF-MSCs מטוהרים אלה יכולים להיות בתרבית במבחנה לאורך זמן ללא שינוי משמעותי של תכוניות מורפולוגיות, סמן ביטוי. יתר על כן, rbSF-MSCs מועשרים MACS להפגין יכולת התמיינות multipotent של השושלת מרובה תאים, כולל לתוך chondrogenic, adipogenic ותאים osteogenic.

הפעולה של מקינטוש הוא פרוטוקול קל לביצוע, והוא יכול להיעשות על הספסל23. בנוסף, לנו המזון והתרופות האמריקני (FDA) אישר הטכנולוגיה מבוססת microbead MACS, לכן קל לביצוע עבור יישומים קליניים24. CD90 הוא סמן משטח של גזע mesenchymal, החוקרים הראו כי MSCs חיובי CD90 יש יותר chondrogenic בידול יכולת25,26. Pluripotency של MSCs מאפיין מבוסס על הביטוי של סמנים ספציפי עבור תאי גזע27ומורפולוגיה.

מחקר זה יש מספר מגבלות. חסרונה הראשון של פרוטוקול זה קשור את סמני פני שבדקנו. על סמך הצהרה על ידי האגודה הבינלאומית עבור טיפול הסלולר (ISCT), מינימלי הקריטריונים להגדרת multipotent MSCs היא חיובית עבור CD90, CD105, CD44, CD73, שלילי עבור CD11b, CD14, CD34 או CD45, ו- CD79a או ד ר הלע28. עם המטרה של מקלים את המאמץ וההוצאה נדרש לבחון את כל הלוח, החוקרים במחקר זה שנבחרו בקפידה שני סמנים שליליים, שני סמנים חיובי מומלץ. שנית, זה לוקח זמן רב כדי ליצור את המושבות ייבחרו ללימוד נוסף. בנוסף, היפרטרופיה היא בעיה רצינית במהלך chondrogenic אינדוקציה של SF-MSCs במבחנה. על הבמה מאוחר יותר, קולגן מסוג אקספרס תמיד X chondrocytes היפרטרופית (COLX), מטריקס מטאלו-פרוטאינאז 13 (MMP13), אלקליין פוספטאז (ALP), תמלול הקשורות ננס פקטור (Runx2) 229. מחקרים מראים כי התרבות צניפה תלת מימדי (3D), מערכות תרבות דינמית את coculture עם chondrocytes הן לתועלת MSC stably chondrogenic בידול30,31. במחקר זה, מערכת תרבות צניפה שומש chondrogenic אינדוקציה של MSC כדי להימנע היפרטרופיה.

לסיכום, יש הוקמה שיטה פשוטה כדי להפוך את הבידוד טיהור של MSCs מן הנוזל שטיפה חלל מפרקיות ואנו שאפיינה את MSCs שהושג בו. פרוטוקול זה סיפקה פלטפורמה על חקר ועל החקירה של מפרקיות synovial נגזר נוזל MSCs של השירות פוטנציאל התחדשות משותפת הרומן אסטרטגיות.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים כי יש להם אינטרסים כלכליים אין מתחרים.

Acknowledgments

מחקר זה מבחינה כלכלית נתמך על ידי המענקים הבאים: יסודות מדעי הטבע של סין (מס 81572198; מס ' 81772394); הקרן לבנייה מלימודי הרפואה ברמה גבוהה של שנז'ן יוניברסיטי (מספר 2016031638); קרן המחקר הרפואי של בפרובינצית גואנג-דונג, סין (מס ' A2016314); שנג'ן המדע ואת הטכנולוגיה פרויקטים (מס ' JCYJ20170306092215436; לא. JCYJ20170412150609690; לא. JCYJ20170413161800287; לא. SGLH20161209105517753; לא. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics