आंतों बाधा उल्लंघन के बाद माइक्रोबियल व्युत्पंन उत्पादों के प्रवेश द्वार नकल करने के लिए चूहों में Lipopolysaccharide के इंजेक्शन

Immunology and Infection
 

ERRATUM NOTICE

Summary

यहां एक प्रोटोकॉल आंतों बाधा उल्लंघन के बाद बैक्टीरियल व्युत्पंन यौगिकों के प्रवेश की नकल करने के लिए प्रस्तुत किया है । lipopolysaccharide के एक कम घातक खुराक चूहों में प्रणालीबद्ध इंजेक्ट किया गया था, जो 24 एच के बाद इंजेक्शन के लिए निगरानी की गई. समर्थक भड़काऊ साइटोकिंस की अभिव्यक्ति तिल्ली, जिगर, और बृहदांत्र में कई समय बिंदुओं पर निर्धारित किया गया था ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

आंत्र उपकला बाधा microbiota कि आम तौर पर सहन या नजरअंदाज कर दिया है से मेजबान अलग । इस बाधा का उल्लंघन बैक्टीरिया या बैक्टीरिया के प्रवेश में परिणाम-व्युत्पंन उत्पादों की मेजबानी में, मेजबान परिसंचरण और भीतरी अनियंत्रित सूजन के लिए अग्रणी अंगों तक पहुंचने के रूप में भड़काऊ आंत्र रोग (आईबीडी) के साथ रोगियों में मनाया, कि एक वृद्धि हुई आंत्र उपकला पारगम्यता की विशेषता है.

मेजबान में जीवाणु-व्युत्पन्न यौगिकों के प्रवेश की नकल करने के लिए, एक endotoxemia मॉडल अपनाया गया है जिसमें lipopolysaccharide (एलपीएस), ग्राम के बाहरी कोशिका दीवार के एक घटक नकारात्मक बैक्टीरिया, चूहों में इंजेक्ट किया गया. इस अध्ययन में, एलपीएस की एक घातक खुराक intraperitoneally इंजेक्शन था और चूहों के बाद 8 एक रोग स्कोर का उपयोग कर एच के लिए निगरानी की गई. इसके अलावा, भड़काऊ साइटोकिंस की अभिव्यक्ति का स्तर Il6, Il1b, और Tnfa तिल्ली, जिगर और बृहदांत्र में qPCR द्वारा अलग समय अंक पोस्ट एलपीएस इंजेक्शन में विश्लेषण किया गया । यह मॉडल सूक्ष्मजीवों या जीवाणु-व्युत्पंन शरीर की एक बाधा उल्लंघन की वजह से उत्पादों के आक्रमण के बाद प्रतिरक्षा प्रतिक्रियाओं की जांच को शामिल अध्ययन के लिए उपयोगी हो सकता है सतहों ।

Introduction

मानव आंत सूक्ष्मजीवों कि microbiota, जो विकास के दौरान मेजबान के साथ एक पारस्परिक रूप से लाभप्रद संबंध विकसित किया है रूपों के एक बड़े संघ के साथ बृहदांत्र है । इस रिश्ते में, मेजबान microbiota के लिए एक सुरक्षित जगह प्रदान करता है, जबकि microbiota विटामिन, पोषक तत्व पाचन और मेजबान है, जहां microbiota1रहता है रोगजनकों से सुरक्षा प्रदान करता है । जब मेजबान और microbiota के बीच यह लाभकारी संबंध अशांत होता है, तो रोग विकसित हो सकते हैं, जैसे भड़काऊ आंत्र रोग (आईबीडी) । आईबीडी दो प्रमुख रूपों, Crohn की बीमारी (सीडी) और अल्सरेटिव कोलाइटिस (यूसी) में होते हैं कि आनुवंशिक और पर्यावरणीय कारकों की वजह से आंत की एक multifactorial पुरानी भड़काऊ बीमारी है । दो आईबीडी रूपों के बीच समानता के बावजूद, वे स्थान और भड़काऊ संशोधनों की प्रकृति में कुछ मतभेदों की विशेषता है । सीडी एक retransmural भड़काऊ विकार है कि संभवतः जठरांत्र संबंधी मार्ग के किसी भी हिस्से को विस्तार कर सकते है, जबकि यूसी गैर transmural है और बृहदांत्र के लिए प्रतिबंधित है । इसके अलावा, न्यूक्लियोटाइड में उत्परिवर्तनों oligomerization डोमेन-प्रोटीन युक्त 2 (NOD2), एक पैटर्न मांयता रिसेप्टर (पीआरआर) है कि muramyl dipeptide (एचडीपी), सबसे ग्राम के सेल दीवार के एक घटक को पहचानता है-सकारात्मक और नकारात्मक बैक्टीरिया, CD2के साथ संबद्ध है । इसके अलावा, ई कोलाई (ई. कोलाई), लिस्टिरिया और स्ट्रेप्टोकोक्की और उनके उत्पादों सब सीडी रोगियों कि एक बाधा उल्लंघन के बाद मेजबान में प्रवेश किया है में मैक्रोफेज के भीतर पाया गया3। जब बैक्टीरिया या उनके उत्पादों की सीडी के विकास के दौरान मेजबान में प्रवेश, प्रतिरक्षा प्रणाली एक प्रतिक्रिया विरोधी घूम के उत्पादन के लिए अग्रणी बैक्टीरियल एंटीबॉडी4विकसित करता है । हो सकता है, आईबीडी के रोगजनन में microbiota की भूमिका के लिए सबसे कायल सबूत माउस मॉडल से उपजा है । जब जानवरों एंटीबायोटिक दवाओं के साथ इलाज कर रहे हैं, या जब चूहों रोगाणु मुक्त (gf) स्थितियों में रखा जाता है, रोग की गंभीरता सबसे कोलाइटिस मॉडल में कम है, जैसे IL-10-/चूहों में कोलाइटिस का विकास नहीं करते हैं gf सुविधाओं में5,6. इसके अलावा, कोलाइटिस भी microbiota की संरचना है, जो एक असंतुलित संरचना और कम dysbiosis7बुलाया समृद्धि की विशेषता है परेशान करता है । आईबीडी का परिणाम एक वृद्धि हुई आंत्र पारगम्यता कि रोगाणुओं और माइक्रोबियल-व्युत्पंन उत्पादों की मेजबानी में प्रवेश करने के लिए नेतृत्व कर सकते हो सकता है ।

पशुओं में, Dextran सोडियम सल्फेट के आवेदन (DSS) एक आंत्र उपकला उल्लंघन उपकला बाधा8की वृद्धि हुई पारगम्यता के लिए अग्रणी लाती है. पोर्टल एलपीएस सांद्रता DSS कोलाइटिस के साथ जानवरों में ऊंचा कर रहे हैं9. दिलचस्प है, जानवरों सी प्रकार लेक्टिन रिसेप्टर विशिष्ट intracellular आसंजन अणु की कमी-3 हथियाने nonintegrin homolog-संबंधित 1 (साइन-R1) DSS कोलाइटिस और एलपीएस-प्रेरित endotoxemia से संरक्षित कर रहे हैं10. आगे की मेजबानी में प्रसार करने के लिए, बैक्टीरिया या बैक्टीरिया व्युत्पंन उत्पादों संवहनी बाधा11, पेरिटोनियल गुहा, जिसमें छोटी और बड़ी आंत स्थित है पास है, mesenteric लिम्फ नोड्स और/या जिगर12। इस प्रणाली की जटिलता को कम करने के लिए, एक परिभाषित जीवाणु-व्युत्पंन यौगिक का इस्तेमाल किया गया था । एलपीएस, जो intraperitoneal के बाद endotoxemia का कारण बनता है (आईएफसआई) या नसों में (i.v.) इंजेक्शन13 चूहों में इंजेक्ट किया गया था, interleukins के जवाब में Il6 और आईएलबीएस और cytokine Tnfa की अभिव्यक्ति का अध्ययन करने के लिए.

एलपीएस एक रोगज़नक़-जुड़े आणविक पैटर्न (PAMP) ग्राम के एक सेल दीवार घटक के रूप में व्यक्त नकारात्मक बैक्टीरिया, कि लिपिड एक (एलपीएस की संरचना में मुख्य PAMP) के होते हैं, एक कोर oligosaccharide और एक ओ साइड चेन14. टोल रिसेप्टर की तरह 4 (TLR4) वृक्ष कोशिकाओं, मैक्रोफेज द्वारा व्यक्त की, और उपकला कोशिकाओं एलपीएस15पहचानता है, कि उचित बाध्यकारी के लिए सह रिसेप्टर्स की आवश्यकता है. तीव्र चरण प्रोटीन एलपीएस-बाध्यकारी प्रोटीन (LBP) बांध एलपीएस एक जटिल है कि अंतर के क्लस्टर के लिए एलपीएस स्थानांतरण 14 (CD14), एक glycosylphosphatidylinositoled झिल्ली प्रोटीन लंगर । CD14 आगे शटल एलपीएस लिम्फोसाइट प्रतिजन ९६ करने के लिए या भी एमडी-2, जो TLR4 के extracellular डोमेन के साथ जुड़ा हुआ है के रूप में जाना जाता है । एमडी-2 के लिए एलपीएस के बंधन TLR4/एमडी-2 के dimerization की सुविधा के लिए intracellular एडेप्टर अणुओं की भर्ती करने के लिए अनुप्रवाह संकेतन मार्ग14है, जो माइलॉयड विभेद प्राथमिक शामिल है सक्रिय करने के लिए गठन के परिवर्तन प्रेरित प्रतिक्रिया जीन ८८ (MyD88)-निर्भर मार्ग और तिर डोमेन-युक्त एडेप्टर-उत्प्रेरण इंटरफेरॉन-β (TRIF)-निर्भर मार्ग16. TLR4 द्वारा एलपीएस की मान्यता तब NF-κB मार्ग को सक्रिय करता है और TNFα, il-6, और il-1β के रूप में भड़काऊ साइटोकिंस, की अभिव्यक्ति लाती है17.

विशेष रूप से, जब एलपीएस पशुओं में इंजेक्शन है, पशुओं को दी एलपीएस की एकाग्रता, पशु की आनुवंशिक पृष्ठभूमि और आहार पर विचार किया जाना है । एलपीएस के उच्च सांद्रता एक सेप्टिक सदमे की ओर जाता है, हाइपरटेंशन और कई अंग विफलताओं की विशेषता है, और अंत में18मौत के लिए । चूहों एलपीएस के लिए कम संवेदनशील है मनुष्यों की तुलना में, जहां एलपीएस सांद्रता के बीच 2-4 एनजी/किलो शरीर के वजन (BW) के लिए एक cytokine तूफान19प्रेरित कर रहे हैं । चूहों के लिए, घातक खुराक (LD50), जो चूहों के आधे में मौत लाती है 10-25 मिलीग्राम/kg BW20 से माउस के आधार पर इस्तेमाल किया तनाव । के लिए आमतौर पर इस्तेमाल किया माउस उपभेदों, C57Bl/6 और बालब/सी, घातक खुराक ५०% (LD50) है 10 मिलीग्राम/BW । इसके विपरीत, उपभेदों C3H/HeJ और C57BL/10ScCr एलपीएस प्रेरित endotoxemia है, जो Tlr421में उत्परिवर्तनों के कारण है से संरक्षित हैं । नतीजतन, Tlr4 की कमी चूहों को एलपीएस के साथ इंजेक्शन के लिए hyporesponsive हैं22. अंय आनुवंशिक रूप से संशोधित माउस लाइनों, जैसे PARP1-/चूहों को एलपीएस-प्रेरित विषाक्त सदमे के लिए प्रतिरोधी रहे हैं ।

माउस मॉडल यहां वर्णित एलपीएस प्रशासित प्रणालीबद्ध के एक घातक खुराक शरीर की सतहों के उल्लंघन के बाद एक बाधा एलपीएस प्रसार के परिणामों की नकल का उपयोग करता है । चुना एलपीएस एकाग्रता (2 mg/BW) C56Bl/6 चूहों में मृत्यु दर प्रेरित नहीं किया, लेकिन समर्थक भड़काऊ साइटोकिंस के प्रेरित रिलीज.

Protocol

चूहों नस्ल और चिकित्सा विभाग, बेसल विश्वविद्यालय (बेसल, स्विट्जरलैंड) के पशु सुविधा में विशिष्ट रोगज़नक़ मुक्त (SPF) शर्तों के तहत रखा गया था । सभी माउस प्रयोगों स्विस संघीय और गुआंगज़ौ के नियमों के अनुसार प्रदर्शन किया गया (पशु प्रोटोकॉल संख्या २८१६ [बेसल-Stadt के गुआंगज़ौ]) ।

1. एलपीएस समाधान की तैयारी

  1. एलपीएस के शेयर खोलने के लिए ई कोलाई 0111 से शुद्ध: B4 बाँझ शर्तों के तहत और यह पानी में 5 मिलीग्राम/एमएल की एकाग्रता के लिए पुनर्गठन ।
  2. ०.२ µ g/µ l के कार्य एकाग्रता के लिए बाँझ फॉस्फेट (पंजाब) के साथ एलपीएस शेयर पतला

2. चूहों को एलपीएस का Intraperitoneal इंजेक्शन

  1. महाप्राण एक लामिना हवा के प्रवाह में एक 30 जी सुई के साथ एक ०.५ मिलीलीटर सिरिंज में एलपीएस काम समाधान ।
  2. वजन महिला C57Bl/6 चूहों (उंर के छह से 10 सप्ताह) और एलपीएस की राशि है कि इंजेक्शन किया जाएगा की गणना: 10 µ l (2 µ छ)/g शरीर का वजन ।
    नोट: उदाहरण के लिए, यदि किसी माउस का वजन 20 g, तो 20 g x 10 µ l = २०० µ l एलपीएस काम समाधान के लिए इंजेक्शन की जरूरत है ।
  3. माउस धीरे लेकिन दृढ़ता से संभाल और एक हाथ में पशु रोकना । सुनिश्चित करें कि पशु सामांय रूप से सांस लेने में सक्षम है, लेकिन मोड़ और संयम के दौरान बारी नहीं है ।
  4. इंजेक्शन के लिए पेट को बेनकाब करने के लिए फर्श की ओर माउस नाक को थोड़ा झुकाएं । पेट की midline और कम पेट में इंजेक्शन जगह छोड़ दिया है या सही midline से पता लगाएँ । चूहों को नियंत्रण में एलपीएस के बजाय आईएफसआई पंजाबियों इंजेक्षन.
  5. खाली हाथ के साथ, उपयुक्त वॉल्यूम (वॉल्यूम चरण २.२ में परिकलित) एलपीएस कार्य समाधान का इंजेक्शन । सुनिश्चित करें कि सुई पेरिटोनियल गुहा में अंयथा के रूप में प्रवेश किया है, पेट की मांसपेशी परत में गलत इंजेक्शन हो सकता है । फिर भी, पेरिटोनियल गुहा में सुई के साथ गहरी जाना नहीं है कि क्षेत्र में स्थित भीतरी अंगों को घायल करने से बचने के लिए ।
  6. पिंजरे प्रति 5 चूहों के साथ पिंजरे के लिए ध्यान से जानवर लौटें ।

3. चूहों की निगरानी

  1. इंजेक्शन के समय जानवरों की निगरानी और endotoxemia की घटना और गंभीरता के लिए 8 एच के लिए इंजेक्शन के बाद हर 2 ज. इसलिए, एक स्कोर शीट (तालिका 1) है कि एक पहले से प्रकाशित पांडुलिपि 24से अनुकूलित किया गया है का उपयोग करें ।
  2. तालिका 1 में सूचीबद्ध निम्न पैरामीटर्स के लिए एलपीएस इंजेक्ट चूहों स्कोर
    1. फर जो सामांय रूप से चिकनी है की उपस्थिति के लिए जांच करें । अगर फर असंतोष प्रकट होता है, काँटेदार या झोंके फर जो बेचैनी और/या दर्द का संकेत है, उंहें 1, 2, या 3 के रूप में स्कोर ।
    2. माउस की गतिविधि के लिए जांच करें ।
      नोट: चूहों आम तौर पर पूरे पिंजरे खाने के आसपास स्वतंत्र रूप से कदम, पीने, चढ़ाई, लेकिन दबा या प्रतिबंधित गतिविधि दर्द का संकेत हो सकता है.
    3. चेतना के स्तर के लिए जांच करें ।
      नोट: चूहों बहुत उत्सुक हैं, और वे आम तौर पर आसपास की जांच पिंजरे के आसपास कदम । कमी या आंदोलन दर्द और असुविधा का सुझाव दे सकते हैं ।
    4. आंखों की जांच करें ।
      नोट: पूरी तरह से खुली आंखें स्वस्थ चूहों में उंमीद कर रहे हैं, लेकिन आंशिक रूप से या पूरी तरह से बंद आंखें, शायद स्राव के साथ, दर्द का एक संकेत हो सकता है ।
    5. श्वसन दर के लिए जाँच करें ।
      नोट: स्वस्थ चूहों आमतौर पर एक सामान्य और तेजी से श्वसन दर, एक कम श्वसन दर असुविधा का एक संकेत हो सकता है).
    6. श्वसन गुणवत्ता के लिए जांच करें ।
      नोट: के साथ या हांफते बिना परिश्रम श्वास दर्द का संकेत है ।

4. Ribonucleic एसिड (आरएनए) निष्कर्षण और Homogenization के लिए ऊतक नमूने

  1. संग्रह/homogenization ट्यूबों तैयार: जोड़ें 1 मिलीलीटर एकल-चरण आरएनए अलगाव रिएजेंट के लिए 2 मिलीलीटर ट्यूबों १.४ mm सिरेमिक क्षेत्रों के साथ भर ।
  2. उपयुक्त समय बिंदुओं पर (इससे पहले (0 एच) और 2 एच, 4 एच और 8 एच के बाद एलपीएस इंजेक्शन) euthanize माउस के साथ संवेदनाहारी ओवरडोज (isoflurane) के बाद exsanguination और विच्छेदन के साथ आगे बढ़ना ।
  3. त्वचा और मांसपेशियों की परत काट कैंची की एक जोड़ी के साथ भीतरी अंगों के साथ उदर गुहा को उजागर ।
  4. ध्यान से तिल्ली, जिगर, और बृहदांत्र काटना, वसा से अंगों को साफ और उंहें पंजाब में बर्फ पर रहते हैं ।
  5. एक छोटा सा टुकड़ा काट (के बारे में ०.५ सेमी लंबे) प्रत्येक अंग से कैंची या स्केलपेल का उपयोग कर ।
    नोट: यह हमेशा से टुकड़ा लेने के लिए महत्वपूर्ण है प्रत्येक माउस में अंग के लगभग एक ही भाग (जिगर, समीपस्थ या बृहदांत्र के बाहर के भाग के एक ही पालि) ।
  6. शीघ्र ही कागज ऊतक के एक टुकड़े पर ऊतक सूखी और यह पूरी तरह से आरएनए अलगाव एजेंट में डूबे हुए है कि यकीन है कि संग्रह/homogenization ट्यूब में जगह है ।
  7. Homogenize को एक उच् च स् पीड benchtop homogenizer में टिशू का यूज करते हैं । तिल्ली, जिगर की तरह कोमल ऊतकों के लिए, और बृहदांत्र 30 एस के लिए ६.०० गति पर homogenization के 1 चक्र का उपयोग करें
  8. कमरे के तापमान पर 5 मिनट के लिए नमूने की मशीन ।
  9. ध्यान से तरल नाइट्रोजन में ट्यूब जगह करने के लिए तस्वीर फ्रीज ऊतक lysate । आरएनए अलगाव तक-८० डिग्री सेल्सियस पर स्नैप जमे हुए lysate की दुकान ।

5. आरएनए ऊतक से निष्कर्षण

नोट: आरएनए अलगाव रिएजेंट, क्लोरोफॉर्म, और अल्कोहल खतरनाक सामग्री के रूप में माना जाता है । एक रासायनिक डाकू के तहत आरएनए निष्कर्षण प्रदर्शन । RNase-मुक्त वातावरण बनाए रखने के लिए प्रमाणित RNase-मुक्त रिएजेंट और उपकरण का उपयोग करें ।

  1. चरण पृथक्करण
    1. जमी ऊतक बर्फ पर lysate गल.
    2. 4 डिग्री सेल्सियस पर 5 मिनट के लिए १,००० एक्स जी पर नमूना केंद्रापसारक शेष ऊतक कणों कि छोड़ दिया जा सकता है गोली ।
    3. supernatant को एक नए nuclease-फ्री १.५ एमएल ट्यूब पर ट्रांसफर करें ।
    4. जोड़ें २०० µ एल बर्फ-ठंडा क्लोरोफॉर्म प्रति 1 मिलीलीटर आरएनए अलगाव रिएजेंट और 10-15 एस के लिए हाथ से जोरदार शेक ।
    5. कमरे के तापमान पर 2-3 मिनट के लिए मशीन ।
    6. 15 मिनट के लिए 4 डिग्री सेल्सियस पर 12, 000 x g पर केंद्रापसारक ।
      नोट: नमूना अब 3 चरणों में शामिल होंगे: लोअर लाल phenol-क्लोरोफॉर्म चरण, चरण और ऊपरी बेरंग जलीय चरण. आरएनए ऊपरी जलीय चरण में मौजूद है ।
    7. इकट्ठा ऊपरी जलीय चरण (कुल मात्रा का ५०%) और एक नया nuclease मुक्त १.५ एमएल ट्यूब में स्थानांतरण ।
  2. आरएनए वर्षण
    1. जोड़ें ०.५ मिलीलीटर बर्फ-ठंडा isopropanol प्रति 1 मिलीलीटर आरएनए अलगाव रिएजेंट और ट्यूब को पलटने से धीरे से मिश्रण 5-6 बार.
    2. कमरे के तापमान पर 10-15 मिनट के लिए मशीन ।
    3. 4 डिग्री सेल्सियस पर 10 मिनट के लिए १२,००० x g पर केंद्रापसारक ।
      नोट: आरएनए गोली इस स्तर पर दिखाई जानी चाहिए ।
  3. आरएनए गोली की धुलाई
    1. पूरी तरह से गोली परेशान बिना isopropanol युक्त supernatant हटा दें ।
    2. 1 एमएल आरएनए अलगाव रिएजेंट प्रारंभिक lysis के लिए इस्तेमाल प्रति 1 मिलीलीटर बर्फ ठंड ७५% इथेनॉल के साथ गोली धो लो ।
    3. भंवर नमूना संक्षेप में ।
    4. 4 डिग्री सेल्सियस पर 5 मिनट के लिए ७,५०० (या १२,०००) एक्स जी पर नमूना केंद्रापसारक ।
  4. आरएनए भंग
    1. पूरी तरह से गोली परेशान बिना supernatant में इथेनॉल हटा दें ।
    2. हवा के लिए 3-5 मिनट के लिए रासायनिक डाकू के तहत खोला ट्यूब छोड़ दो-कमरे के तापमान पर शाही आरएनए गोली (उस मामले में यह आरएनए को भंग करने के लिए मुश्किल हो जाएगा के रूप में अधिक शुष्क नहीं है) ।
    3. 20-50 µ एल nuclease में आरएनए गोली भंग-ध्यान से ऊपर और नीचे pipetting द्वारा नि: शुल्क पानी ।
    4. आगे आरएनए के समाधान में सुधार करने के लिए 10-15 मिनट के लिए ५५ ° c पर नमूना मशीन ।
      नोट: इस स्तर पर, आरएनए आगे विश्लेषण तक-८० डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।

6. शेष डीएनए का पाचन

  1. spectrophotometer में एक aliquot (2 µ एल) pipetting द्वारा एक spectrophotometer के साथ आरएनए एकाग्रता को मापने और सिफारिश की एकाग्रता को समायोजित ।
  2. अधिकतम के साथ डीएनए दूषित के पाचन शुरू करो । ५० µ l nuclease में 10 µ g आरएनए-नि: शुल्क जल ।
  3. जोड़ें ०.१ की मात्रा 10x DNase मैं बफर और 1 µ एल rDNase मैं प्रति नमूना और मिश्रण धीरे pipetting द्वारा ऊपर और नीचे ।
  4. 20-30 मिनट के लिए ३७ ° c पर मशीन ।
  5. भंवर DNase निष्क्रियता रिएजेंट और पिपेट के साथ अच्छी तरह से मिश्रण नमूना के लिए ०.१ मात्रा में जोड़ें ।
  6. कमरे के तापमान पर 5 मिनट के लिए कभी हाथ से मिश्रण के लिए मशीन ।
  7. १.५ मिनट के लिए १०,००० x g पर केंद्रापसारक ।
  8. नई nuclease-मुक्त ट्यूब में डीएनए मुक्त आरएनए युक्त supernatant हस्तांतरण ।
  9. spectrophotometer द्वारा आरएनए एकाग्रता और गुणवत्ता को मापने ।

7. रिवर्स प्रतिलेखन

  1. रिवर्स प्रतिलेखन के लिए एक व्यावसायिक रूप से उपलब्ध Deoxyribonucleic एसिड सीडीएनए रिवर्स प्रतिलेखन (आरटी) किट का उपयोग करें ।
    नोट: यहाँ, आरएनए के 2 µ जी को प्रतिलिखित बदलवा दिया जा सकता है.
  2. 2 µ जी आरएनए शामिल हैं जो मात्रा, गणना. एक नई पीसीआर ट्यूब में पिपेट 2 µ जी आरएनए ।
  3. पीसीआर ट्यूब में नमूने के लिए nuclease-मुफ्त पानी जोड़ने के लिए 10 µ की अंतिम मात्रा एल.
  4. तालिका 2 में सूचीबद्ध निम्नलिखित घटकों को मिलाकर 2x मास्टर मिक्स तैयार
  5. 10 µ एल 2x मास्टर मिश्रण जोड़ें 10 µ एल आरएनए के लिए 20 µ एल की कुल मात्रा में 1x मास्टर मिश्रण प्राप्त करने के लिए
  6. पोलीमरेज़ चेन रिएक्शन (पीसीआर) ट्यूब बंद करें और संक्षेप में नमूना नीचे स्पिन ।
  7. नमूने को पीसीआर Thermocycler में रखें और तालिका 3में सूचीबद्ध सेटिंग्स सेट करें ।
  8. अधिक विश्लेषण के लिए-20 डिग्री सेल्सियस पर उत्पन्न सीडीएनए की दुकान.

8. मात्रात्मक पीसीआर (qPCR)

  1. व्यावसायिक रूप से उपलब्ध किट के साथ qPCR प्रतिक्रिया निष्पादित करें ।
  2. स्वयं डिजाइन और परीक्षण intron-फैले प्राइमरों, उपयोग करने से पहले, सीडीएनए टेंपलेट के विभिंन सांद्रता के साथ । एक मानक वक्र बनाने और उच्च प्रभावकारिता और सही पिघलने घटता के साथ प्राइमरों का उपयोग करके प्राइमर की प्रभावकारिता का विश्लेषण ।
    नोट: इस प्रयोग में प्रयुक्त होने वाले प्राइमरों के अनुक्रम तालिका 2में सूचीबद्ध हैं ।
  3. तालिका 4में वर्णित प्रतिक्रिया सेटअप के साथ ३८४-well प्लेट में मात्रात्मक पोलीमरेज़ चेन रिएक्शन (qPCR) प्रतिक्रिया तैयार करें ।
  4. सभी समाधान और एल्यूमीनियम पंनी का उपयोग कर प्लेट गीला हो रही है जब प्रतिक्रिया मिश्रण तैयार है रोकने के लिए बर्फ पर प्लेट रखो ।
  5. triplicates में सभी प्रतिक्रियाओं का प्रदर्शन ।
  6. तालिका 5में सूचीबद्ध सेटिंग का उपयोग करके thermocycler पर पीसीआर रिएक्शन ले ।
  7. triplicates से सभी प्रतिक्रियाओं के लिए औसत सीटी मूल्य की गणना । 2 ^ (-ΔCt) की गणना करके glycerinealdehyde-3-फास्फेट-डिहाइड्रोजनेज (Gapdh) गृह व्यवस्था जीन की अभिव्यक्ति के स्तर तक सभी लक्ष्य जीन को सामान्य.
    नोट: औसत सीटी के साथ सभी लक्ष्य जीन > 35 का पता लगाने की सीमा के तहत माना जाता था ।

Representative Results

बैक्टीरिया या जीवाणु के प्रवेश के बाद मेजबान के लिए परिणामों की नकल-व्युत्पंन उत्पादों है कि आंत्र बाधा उल्लंघन के बाद होता है, एलपीएस C57Bl/6 चूहों में एक घातक खुराक में इंजेक्ट किया गया था (2 µ g/जी शरीर के वजन) । हर एक माउस पर नजर रखी और स्कोर शीट में सूचीबद्ध मापदंडों के साथ endotoxemia की घटना के लिए रन बनाए थे कि शामिल हैं, चूहों की उपस्थिति, जानवरों की गतिविधि, आंखों की हालत, और श्वसन दर और गुणवत्ता (तालिका 1) . पशुओं रोग के नैदानिक लक्षण है कि एलपीएस के इंजेक्शन के बाद 6 से 10 ज नुकीला और 24 घंटे के भीतर बरामद दिखाया (चित्रा 1) । व्यक्तिगत चूहों एलपीएस के इंजेक्शन के बाद 2 ज, 4 एच, और 8 एच बलिदान किया गया । ऊतक के टुकड़े तिल्ली, जिगर, और बृहदांत्र से एकत्र किए गए । आरएनए इन अंगों और रिवर्स सीडीएनए करने के लिए लिखित से अलग किया गया था । सीडीएनए की अभिव्यक्ति का स्तर निर्धारित करने के लिए qPCR के लिए एक टेम्पलेट के रूप में उपयोग किया गया था Il6 (चित्र 2a) Il1b (आरेख 2 बी), TNFa (चित्र 2c) और Il10 (फिगर 2d) qPCR के लिए इस्तेमाल किया प्राइमरों के साथ तालिका 6में सूचीबद्ध । तिल्ली और बृहदांत्र में इंजेक्शन के बाद Il6 नुकीला 2h की अभिव्यक्ति, और जिगर में इंजेक्शन के बाद 4 एच. Il1b, TNFa, और Il10 की अभिव्यक्ति की तिल्ली, जिगर, और बृहदांत्र में इंजेक्शन के बाद 4 एच नुकीला । इंजेक्शन के बाद 8 एच के भीतर, Il6, Il1b, TNFa, और Il10 की अभिव्यक्ति आधारभूत स्तर पर लौट आए ।

Figure 1
चित्र 1: एलपीएस इंजेक्शन (2 µ g/जी शरीर का वजन) C57Bl/6mice में endotoxemia के नैदानिक लक्षण प्रेरित । 2 µ जी के इंजेक्शन के बाद/एलपीएस के शरीर के वजन, व्यक्तिगत चूहों रोग तालिका 1 में प्रस्तुत किया है कि उपस्थिति और जानवरों की गतिविधि शामिल है, उनकी आंखों के उद्घाटन और उनकी श्वसन दर और गुणवत्ता के साथ निगरानी की गई हर 2 एच के लिए 12 एच और 24 एच पिछाड़ी ईआर एलपीएस इंजेक्शन । रोग स्कोर (y-अक्ष) संबंधित समय (x-अक्ष) को blotted था. प्रत्येक समय बिंदु प्रति 4-5 चूहों के लिए मतलब ± एसडी प्रस्तुत की है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2: एलपीएस इंजेक्शन (2 µ g/जी शरीर का वजन) C57Bl/6 चूहों में समर्थक भड़काऊ साइटोकिंस की अभिव्यक्ति लाती है । चूहों एलपीएस के 2 µ जी/जी शरीर के वजन के साथ इंजेक्शन थे और Il6 (ए)की अभिव्यक्ति के स्तर, Il1b (ख), Tnfa (ग) और Il10 (घ) तिल्ली, जिगर में qPCR द्वारा विश्लेषण किया गया, और संकेत दिया समय में बृहदांत्र इंजेक्शन के बाद अंक । Cytokine अभिव्यक्ति स्तर सभी Gapdhकी अभिव्यक्ति के लिए सामान्यीकृत थे । प्रत्येक समय बिंदु प्रति 4-5 चूहों के लिए मतलब ± एसडी दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

तालिका 1: एलपीएस इंजेक्शन के बाद C57Bl/6 चूहों पर नजर रखने के लिए रोग स्कोर शीट । पैरामीटर है कि एलपीएस इंजेक्शन के बाद निगरानी कर रहे हैं । जानवरों हर 2 एच 12 एच की अवधि के लिए इंजेक्शन के बाद निगरानी की गई, और स्कोर हर व्यक्ति तालिका में सूचीबद्ध पैरामीटर के लिए दिए गए थे । प्रत्येक जानवर के लिए अंतिम स्कोर सभी व्यक्तिगत स्कोर का योग का प्रतिनिधित्व करता है । यह संदर्भ24से अनुकूलित है । इस फ़ाइल को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

राशि अभिकर्मक
2 µ l नमूना/ 10x RT बफर
०.८ µ l नमुना/ 25x deoxynucleotide (dNTP) Mix (१०० mM)
1 µ l नमूना/ आरटी यादृच्छिक प्राइमर्स
४.२ µ l नमुना/ nuclease-मुफ्त पानी

तालिका 2: रिवर्स प्रतिलेखन के लिए मास्टर मिश्रण तैयार करने के लिए इस्तेमाल किया एजेंट ।

तापमान समय
25 डिग्री सेल्सियस 10 min
३७ ° c १२० मिनट
३७ ° c 5 min
4 ° c पकड़

तालिका 3: Thermocycler सेटिंग्स रिवर्स प्रतिलेखन के लिए इस्तेमाल किया ।

राशि अभिकर्मक
5 µ l अच्छी तरह/ 2x मास्टर मिक्स
०.०५ µ l/खैर संदर्भ डाई
५०० एनएम फाइनल/ फॉरवर्ड प्राइमर
५०० एनएम फाइनल/ रिवर्स प्राइमर
10 और १०० के बीच एनजी/खैर, हम इस्तेमाल ४० एनजी/ टेम्पलेट सीडीएनए पतला एक टेम्पलेट में कमजोर पड़ने बफर (इस बफर के 1/100 कमजोर पड़ने nuclease-मुक्त पानी में किया गया था और सीडीएनए टेम्पलेट को पतला करने के लिए इस्तेमाल किया). कमजोर इस बफर में टेम्पलेट जहां टेम्पलेट जोड़ा जाता है के रूप में प्रतिक्रिया रंग परिवर्तन नीले रंग से हरे
nuclease-मुक्त पानी के अंतिम खंड के लिए 10 µ l/ nuclease-मुफ्त पानी

तालिका 4: पीसीआर प्रतिक्रिया का विवरण ।

तापमान समय
९५ ° c 2 min
९५ ° c 5 एस ४० चक्र
६० ° c 20 एस
९५ ° c 15 एस पिघलने वक्र analaysis
६० ° c 1 min
९५ ° c 15 एस

तालिका 5: Thermocycler सेटिंग्स पीसीआर के लिए उपयोग किया जाता है ।

प्राइमर अनुक्रम पिघलने तापमान उत्पाद की लंबाई
Il6-च TCG ढकोसला GCT ताा TTA CAC ATG टीटीसी T ६०.३ ९४ बीपी
Il6-R GCATCATCGTTGTTCATACAATCA ५८.२
Il1b-च TGTGAAATGCCACCTTTTGA ५६.१ ९४ बीपी
Il1b-R GTCAAAGGTTTGGAAGCAG ५७.२
Il10-च ATCGATTTCTCCCCTGTGAA ५६.२ १०८ बीपी
Il10-R TGTCAAATTCATTCATGGCCT ५६.१
Tnfa-च CCACCACGCTCTTCTGTCTAC ६०.४ १०३ बीपी
Tnfa-R AGGGTCTGGGCCATAGAACT ६०
Gapdh-च CATCAAGAAGGTGGTGAAGC ५६.७ १९९ बीपी
Gapdh-R CCTGTTGCTGTAGCCGTATT ५८

तालिका 6: qPCR प्रतिक्रिया में प्रयुक्त प्राइमरों । qPCR के लिए माउस साइटोकिंस और गृह व्यवस्था जीन Gapdh का पता लगाने के लिए इस्तेमाल किया प्राइमरों के अनुक्रम

Discussion

इस प्रोटोकॉल प्रतिरक्षा प्रक्रियाओं है कि माइक्रोबियल व्युत्पंन उत्पादों द्वारा आक्रमण के बाद हो नकल करता है । प्रोटोकॉल के भीतर महत्वपूर्ण कदम माउस लाइन का चयन कर रहे हैं, चूहों की स्वच्छता की स्थिति, एलपीएस की खुराक, endotoxemia की घटना के लिए जानवरों की निगरानी, और प्रयोग समाप्ति के समय बिंदु. सबसे महत्वपूर्ण बात, माउस तनाव की आनुवंशिक पृष्ठभूमि पर विचार किया जाना है । अलग माउस उपभेदों एलपीएस को अलग संवेदनशीलता है । उदाहरण के लिए, C3H/HeJ और C57BL/10ScCr चूहों एलपीएस प्रेरित endotoxemia21,25के लिए प्रतिरोधी रहे हैं । इसके अलावा, पशुओं की स्वच्छता की स्थिति एलपीएस में endotoxemia के पाठ्यक्रम को प्रभावित कर सकती है । विशिष्ट-रोगज़नक़-मुक्त (SPF) जानवरों सबसे अधिक इस्तेमाल किया जाता है । इन चूहों रोगजनकों की एक निर्धारित सूची से मुक्त हैं, लेकिन इन जानवरों की पूरी microbiota रचना26,27ज्ञात नहीं है । बाँझ रोगाणु मुक्त या axenic जानवरों (जो एक microbiota बंदरगाह नहीं है) SPF चूहों से अलग हैं26. संभावना है, एक सूक्ष्मजीव के साथ या सूक्ष्मजीवों (gnotobiotic जानवरों) के एक संघ के साथ axenic पशुओं के औपनिवेशीकरण, जैसे IL-19 के रूप में जीन की अभिव्यक्ति को प्रभावित कर सकते हैं, SPF जानवरों की तुलना में एलपीएस इंजेक्शन के बाद8. इसके अलावा, एक अंक पत्र का सुझाव दिया गया है कि एक पूति पेरिटोनियल गुहा24में मल समाधान इंजेक्शन द्वारा प्रेरित मॉडल के लिए एक स्कोर शीट के रूप में इस्तेमाल किया गया था । इस sheetcan स्थानीय पशु कल्याण समिति के साथ चर्चा की है और स्थानीय जरूरतों के लिए अनुकूलित किया जा सकता है । विशेष रूप से, समाप्ति के लिए मानदंड स्थानीय पशु कल्याण समिति के साथ चर्चा की जरूरत है । इस प्रयोग को रोका जाना था जब एक स्कोर > 12 हासिल की है या जब एक व्यक्तिगत पैरामीटर के लिए अधिकतम स्कोर तक पहुंच गया है । इस प्रयोग में, आठ पशुओं से बाहर कोई जानवर एलपीएस के इंजेक्शन के बाद 12 के एक रोग स्कोर से अधिक (2 µ जी/ इस अध्ययन में, जिगर, तिल्ली और Il10 के इंजेक्शन के बाद बृहदांत्र में साइटोकिंस Il6, Il1b, TNFa और एलपीएस की अभिव्यक्ति दिखा परिणाम प्रस्तुत कर रहे हैं । तिल्ली, जिगर, और बृहदांत्र में एलपीएस इंजेक्शन के बाद Il1b, TNFa और Il10 नुकीला 4 एच की अभिव्यक्ति, जबकि, Il6 अभिव्यक्ति नुकीला 2 में एलपीएस इंजेक्शन के बाद तिल्ली और बृहदांत्र और 4 ज में एलपीएस इंजेक्शन के बाद जिगर । 8 एच के भीतर अभिव्यक्ति Il6, Il1b, TNFa और Il10 तिल्ली, जिगर और बृहदांत्र में आधारभूत स्तर को लौट आए । रोग गंभीरता एलपीएस इंजेक्शन के बाद 6 एच और 10 एच के बीच नुकीला जब Il6, Il1b, TNFa और Il10 की अभिव्यक्ति पहले से ही आधारभूत स्तर है कि Il6की बढ़ती अभिव्यक्ति का संकेत करने के लिए लौट आए हैं, Il1b, TNFa और Il10 एलपीएस इंजेक्शन के बाद तेजी से होता है, लेकिन कैनेटीक्स इंजेक्शन के बाद अन्य जीन के एलपीएस एक अलग पैटर्न दिखा सकते हैं. इन साइटोकिंस की अभिव्यक्ति एलिसा द्वारा पशुओं के रक्त में प्रोटीन के स्तर पर भी विश्लेषण किया जा सकता है, जिसे qPCR के अतिरिक्त माना जा सकता है ।

संशोधन और तकनीक के निवारण के मामलों में आवश्यक है जब एक रोग स्कोर > 12 तक पहुंच गया है । इसलिए, एलपीएस की खुराक को कम किया जाना चाहिए और बेहतर इस्तेमाल माउस लाइन और स्थानीय परिस्थितियों के लिए प्रयोग की समयपूर्व समाप्ति से बचने के लिए समायोजित । एक दिया जीनोमिक क्षेत्र को हटाने या एक जीन व्यक्त करने से जीन के हेरफेर चूहों के एलपीएस को संवेदनशीलता को प्रभावित कर सकते हैं । प्रारंभिक प्रयोगों में, एलपीएस की खुराक उचित खुराक के लिए titrated जा सकता है इस प्रयोग में पशुओं के लिए अनावश्यक नुकसान और मौत से बचने के लिए । ध्यान दें, अंय जीवाणु व्युत्पंन उत्पादों और गलत इंजेक्शन के साथ एलपीएस के संदूषण को टाल दिया है । इसके अलावा, एलपीएस इंजेक्शन के बाद ब्याज की जीन की अभिव्यक्ति के कैनेटीक्स के लिए निर्धारित किया जाना चाहिए ।

सीमाएं हैं कि इस तकनीक एक आंत्र बाधा उल्लंघन के बाद मेजबान में माइक्रोबियल उत्पादों के प्रसार के परिणामों के बारे में जानकारी प्रदान करता है, लेकिन घटनाओं है कि आंतों बाधा उल्लंघन करने के लिए नेतृत्व और कारणों के बारे में जानकारी नहीं दे देंगे जो ट्रिगर आईबीडी. बेशक, इस मॉडल DSS कोलाइटिस मॉडल के रूप में एक कोलाइटिस मॉडल नहीं है, लेकिन यह कोलाइटिस मॉडलों के अलावा में उपयोगी हो सकता है मेजबान में माइक्रोबियल उत्पादों के प्रवेश के परिणाम का अध्ययन । इसके अलावा, एलपीएस का आईएफसआई इंजेक्शन पेरिटोनियल गुहा को बाधित करेगा, जिसमें छोटी और बड़ी आंत स्थित हैं । यह पेरिटोनियल गुहा से translocation आंत्र व्युत्पंन बैक्टीरियल उत्पादों के मेजबान में सुविधा हो सकती है ।

इस मॉडल का महत्व तथ्य यह एक परिभाषित PAMP का उपयोग करता है । पूरे बैक्टीरिया का आईएफसआई इंजेक्शन सहित अन्य मॉडलों में, मल समाधान24 या सेप्टिक पेरिटोनिटिस मॉडल, जिसमें पेरिटोनिटिस cecal बंधाव और पंचर28, रोगाणुओं का एक विशाल सरणी या उनके द्वारा प्रेरित है की आईएफसआई इंजेक्शन उत्पाद रोग लाती है । इसके अलावा, चूहों में एलपीएस के इंजेक्शन एक सीधी दृष्टिकोण है और cecal बंधाव और पंचर द्वारा प्रेरित सेप्टिक पेरिटोनिटिस में के रूप में सर्जरी की आवश्यकता नहीं है ।

इस मॉडल के आगे आवेदन अध्ययन कर रहे है कि किसी भी संदर्भों में endotoxemia या एलपीएस प्रेरित गलाघोंटू की जांच करने के लिए, मेजबान में बैक्टीरिया व्युत्पंन उत्पादों की translocation द्वारा विशेषता ऐसी त्वचा बाधा के उल्लंघन या के उल्लंघन के रूप में मूत्रजननांगी पथ । अंत में, यह एक सीधा मॉडल है कि हर प्रयोगशाला सेटिंग में इस्तेमाल किया जा सकता है । स्थानीय स्थितियों के आधार पर, वहाँ स्थानीय आवश्यकताओं के लिए आवश्यक रूपांतरों हो सकता है. विशेष रूप से, स्कोर शीट के लिए प्रयोग किया जाता है पहले स्थानीय अधिकारियों के साथ चर्चा की है । इस दृष्टिकोण को मेजबान के लिए परिणामों की नकल जब बैक्टीरिया या जीवाणु व्युत्पंन उत्पादों की मेजबानी में प्रवेश के बाद एक बाधा उल्लंघन हुआ है इस्तेमाल किया गया था । यह विशेष रूप से आईबीडी जहां एक आंत्र बाधा उल्लंघन की घटना रोग की विकृति में एक आम घटना है के आधार की जांच के अध्ययन में प्रासंगिक हो सकता है ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

JHN स्विस नेशनल फाउंडेशन (SNSF 310030_146290) द्वारा समर्थित है ।

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics