En effektiv strategi til at generere væv-specifikke binære transskription systemer i Drosophila af genom-redigering

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi præsenterer her, en metode til at generere væv-specifikke binære transskription systemer i Drosophila ved at erstatte den første kodning exon af gener med transskription drivere. CRISPR/Cas9-baseret metode placerer en transaktivatoren sekvens under den endogene regulering af et afløste gen, og derfor letter transctivator udtryk udelukkende i gen-specifikke spatiotemporelle mønstre.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Binære transskription systemer er stærke genetiske værktøjer bruges til visualisering og manipulere celle skæbne og gen udtryk i bestemte grupper af celler eller væv i modelorganismer. Disse systemer indeholder to komponenter som separate transgene linjer. En driver linje udtrykker en transcriptional aktivator under kontrol af væv-specifikke initiativtagerne/smagsforstærkere, og en reporter-effektor linje havne et target gen placeret nedstrøms til bindingssted af transkription aktivere. Dyr husly begge komponenter fremkalde væv-specifikke transactivation for en target genekspression. Præcise spatiotemporelle udtryk af genet i målrettet væv er kritisk for objektiv fortolkning af celle-genet aktivitet. Derfor er udvikle en metode til at generere eksklusive celler/væv-specifik driver linjer afgørende. Her præsenterer vi en metode til at generere meget væv-specifikke målrettede udtryk systemet ved at ansætte en "grupperet regelmæssigt Interspaced korte palindromiske Repeat/CRISPR-forbundet" (CRISPR/Cas)-baseret genom-redigering teknik. I denne metode guide liv1975 Cas9 er målrettet to kimære RNA'er (gRNA) til bestemte websteder i den første kodning exon af et gen i Drosophila genom oprette dobbelt-strenget pauser (DSB). Efterfølgende, kan ved hjælp af en udefrakommende donor plasmid som indeholder transaktivatoren sekvens, celle-selvstændig reparation maskiner homologi-instrueret reparation (HDR) af DSB, hvilket resulterer i præcise fjernelse og udskiftning af exon med transaktivatoren sekvens. Bankede i transaktivatoren er udtrykt udelukkende i celler hvor cis-regulerende elementer af udskiftede genet er funktionelle. Detaljerede trinvise protokollen præsenteres her til at generere en binær transcriptional driver udtrykt i Drosophila fgf/forgreningsløse-producerer epitelial/neuronale celler kan vedtages for enhver gen - eller væv-specifikke udtryk.

Introduction

Den genetiske værktøjskasse til målrettede genekspression har været veludviklet i Drosophila, hvilket gør det en af de bedste model til at undersøge funktionen af gener involveret i en bred vifte af cellulære processer. Binært udtryk systemer, såsom gær Gal4/UAS (opstrøms aktivering sekvens), blev først vedtaget for væv-specifikke enhancer diffusering og gene misexpression i Drosophila genetiske model1 (figur 1). Dette system fremmet udviklingen af en lang række teknikker som spatiotemporelle regulering af genet overekspression, misexpression, knockout i udvalgte grupper af celler samt som celle ablation, celle mærkning, live sporing af cellulære og molekylære processer i embryo og væv, afstamning sporingen og mosaik analyser under udvikling. En række binære transskription system, såsom den bakterielle LexA/LexAop system (figur 1) og Neurospora Q-system, er stærke genetiske værktøjer, der er nu udbredt i Drosophila, ud over den oprindelige Gal4/UAS system for målrettede gen expression1,2,3.

Vi præsenterer her, en metode til at generere meget pålidelige væv-specifikke binære udtryk systemet ved at ansætte en genom-redigering teknik. De seneste fremskridt i CRISPR/Cas9 genom redigering teknologi har tilladt hidtil usete muligheder for at gøre styret genom ændringer i en bred vifte af organismer. I forhold til de andre tilgængelige genom redigering teknikker, er CRISPR/Cas9-systemet billig, effektiv og pålidelig. Denne teknologi anvender komponenter af den bakterielle adaptive immunsystem: en Cas9 liv1975 af Streptococcus pyogenes , der skaber en dobbelt-strenget pause (DSB) og en kimære guide-RNA (gRNA), som guider Cas9 for et websted til et bestemt genom målrettet DSB4. Cellerne indeholder maskineri for at reparere DSB ved hjælp af forskellige veje. Ikke-homologe ende sammenføjning (NHEJ) fører til små indrykninger eller sletninger at forstyrre genfunktion, mens homologi-instrueret reparation (HDR) indfører en defineret instrueret/ønskeligt genomisk knock-i/knock-out ved hjælp af en udefrakommende HDR donor som en skabelon. Den HDR-baserede udskiftning strategi udnyttes effektivt for at generere en yderst pålidelig væv-specifikke binære udtryk system, som kan overvinde begrænsningerne af traditionel forstærker fælde metoder. Vi beskriver en trinvis fremgangsmåde for udnyttelse af CRISPR/Cas9-baserede HDR reparation til at generere en binær transskription driver linje, der kommer til udtryk under kontrol af endogene transcriptional og post-transcriptional regulering af en Drosophila gen. I denne protokol, vi vise generation af en specifik for driveren forgreningsløse (bnl) gen kodning en FGF familie protein, der regulerer forgrening morfogenese af luftrør luftvejene epitel5. I dette eksempel, den første kodning exon af bnl genet blev erstattet af rækkefølgen af en bakteriel LexA transaktivatoren sekvens uden at ændre nogen endogene cis-regulerende sekvenser af bnl genet. Vi viser, at strategien genereret en bnl-LexA driver linje, der spatiotemporally styrer udtryk af en reporter gen placeret neden for LexAoperator (LexAop eller LexO) udelukkende i bnl- at udtrykke epitelial/mesenchymale/neuronale celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. designe og konstruere gRNA udtryk vektor

  1. For at netop erstatter en lang definerede region af en exon, bruge en dobbelt gRNA tilgang6, hvor hver gRNA kan målrettet mod to ender af det valgte område af interesse. For at opnå nøjagtige gen-specifikke spatiotemporelle udtryk for driveren, skal du vælge to gRNA målwebsteder inden for den første kodning exon af genet.
  2. Drosophila melanogaster, Vælg gRNA målrette websteder ved hjælp af værktøjet flyCRISPR optimale mål Finder (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Andre tilgængelige CRISPR designværktøjer kan bruges såvel, herunder optimeret CRISPR Design værktøj (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), og E-knækbrød (www.e-crisp.org/E-CRISP).
    Bemærk: De følgende protokoller gRNA design og kloning blev vedtaget fra metoder ovenfor beskrevne6,7.
    1. Afskrift den faktiske rækkefølge i boksen i online-værktøjet. Vælg senest frigivne Drosophila melanogaster genom anmærkning version, "r_6," i rullemenuen til "Vælg genom." I feltet "Vælg guide længden (nt)," input "20." Vælg at finde "Alle CRISPR mål" og klik på "Find CRISPR mål".
    2. Evaluere alle kandidat gRNA mål ved at sætte "Maksimal" for "Strenghed" og "NGG kun" for "PAM". Prøv at vælge gRNA websteder uden nogen potentielle off-mål eller et minimumsantal af off-mål mulige. Brug web-værktøj, der er beskrevet i Doench et al. 2014 8 for at vælge gRNAs med en potentiel "god" aktivitet score.
    3. Sikre samtidig, at der er ingen enkelt nukleotid polymorfisme i gRNA mål i genomet af overordnede fluelinen valgt til injektion (Fx nos-Cas9 på X-kromosom, BL # 54591). Følge protokollen beskrevet i Gratz et al. 20157 hen til uddrag den genomisk DNA fra den overordnede fluelinen. PCR forstærke, ca, de 500-1.000 nt områder ved hjælp af primere, der flankerer sekvensen af interesse og en high-fidelity DNA polymerase; sekvens-kontrollere PCR forstærket produkter.
  3. For at generere en tandem gRNA udtryk vektor, følge en ligatur-uafhængig kloning protokol6 til at indføre to protospacer sekvenser i en pCFD4 RNA udtryk vektor. Bemærk at en forbedret multi-gRNA udtryk vektor (pCFD5) er nu tilgængelig, hvor både sgRNAs kommer til udtryk fra den stærke U6:3 initiativtagere9 (https://www.crisprflydesign.org). Bruge en DNA forsamling metode for at klone gRNAs til pCFD4 vektor.
    1. Designe og bestille de frem og bak primere for at indføre to protospacer sekvenser i RNA udtryk vektor pCFD4 (tabel 1A). Som tidligere beskrevet6indeholder den forreste primer den første protospacer sekvens flankeret af områder svarende til U6-1 promotor og gRNA kerne i pCFD4; den omvendte primer indeholder omvendte supplement af den anden protospacer flankeret af områder svarende til gRNA kerne og U6-3 initiativtager i pCDF4.
    2. Resuspend primere til 100 μM med DNase- og RNase-fri dobbelt destilleret vand (ddH2O). Gøre en 10 μM arbejder koncentration primer. Bruge pCFD4 plasmid som en skabelon og oprette PCR reaktion ved hjælp af en high-fidelity polymerase og anbefalede indstillinger til PCR reaktion6.
    3. For at klone den forstærkede produkt i pCFD4, fordøje pCFD4 plasmid med BbsI enzym ved at oprette følgende reaktion: 2 – 5 μg af pCFD4 plasmid, 5 μl af 10 x fordøjelsen buffer, 1 μL BbsI enzym, og Hedeselskabet2O at bringe det endelige rumfang på 50 μL. Bland reaktion indholdet af forsigtigt trykke røret og indsamle alle de spredte dråber fra mur af røret til bunden af en kort prøvetur. Inkuber mastermix ved 37 ° C i 2 timer.
    4. Køre PCR produkt fra trin 2 og fordøjet produktet fra trin 3 på en 1%-agarosegel. Udføre elektroforese for tid nok til at helt adskilte DNA bands. Cut den korrekte størrelse DNA bands under en UV trans-illuminator før rensning de forventede produkter ved hjælp af gel eluering kolonne efter fabrikantens anvisninger (Se Tabel af materialer). PCR-produktet skal være 600 bp og lineariseret pCFD4 plasmid bør være ~6.4 kb 6.
    5. Oprette DNA forsamling reaktion i en PCR rør, pr fabrikantens anvisninger (Se Tabel af materialer).
    6. Omdanne kompetente bakterier (DH5α eller lignende stammer med ΔrecA1, ΔendA1) 2 μl af varens forsamling, plade på Ampicillin (100 μg/mL) indeholdende LB (LB/Amp) agar plader og inkuberes ved 37 ° C natten over. Bemærk, at DNA forsamling mix kan være giftige for visse bakterier stammer, men fortynding forsamling mix kan reducere toksicitet.
    7. Pick 3 – 4 ampicillin-resistente kolonier fra natten-rugede pladen, podes koloni i 3 mL LB indeholdende 100 μg/mL ampicillin og vokse podede bakterier i et 37 ° C shaker natten over. Uddrag plasmid fra natten-kulturperler bakterier ved hjælp af plasmid mini prep kit efter fabrikantens anvisninger (Se Tabel af materialer).
    8. Sekvens plasmider med T3 universal primer til at screene for de korrekte kloner indeholdende tandem gRNA indsættelse. Etablere en glycerol bestand af bakterier omdannet med et sekvens-verificerede pCFD4-gRNA i 20% glycerol og opbevares i et-80 ° C fryser til fremtidig brug.

2. designe og konstruere HDR Donor

  1. For genomisk knock-in af en Gal4 eller LexA sekvens, designe en dobbelt-strenget HDR donor indeholdende transaktivatoren sekvens flankeret af to homologi arme.
    1. Brug > 1,5 kb til venstre og højre homologi arme flankerende gRNA målretning kvadratnetsreference. Udvidet homologi arme øge effektiviteten af HDR under reparation processen 10.
    2. PCR forstærke homologi våben fra genomisk DNA (gDNA) udvundet fra den overordnede fluelinen valgt til injektion (Fx nos-Cas9 (om X kromosom), BL # 54591). Bruge en korrekturlæsning hot start Taq DNA polymerase enzym egnet til lange PCR forlængelse (Se Tabel af materialer). Sekvens-kontroller.
  2. For at undgå retargeting af gRNA til de manipuleret locus, design udskiftning donor på en sådan måde, at gRNA genkendelsessekvenser er forstyrret af eksogene sekvensen blev indført.
    Bemærk: for at undgå at ændre de formodede cis-regulerende elementer, Vælg altid gRNA genkendelsessekvenser inden for regionen kodning exon.
  3. For at generere en udskiftning kassette, planlægge DNA forsamling strategi for at sammen fire segmenter: 5' og 3' homologi armene, midterste eksogene transaktivatoren DNA-sekvens og lineariseret kloning vektor rygraden (fx pUC19 eller andre almindeligt anvendt kloning vektorer). Efter fabrikantens retningslinje for DNA Forsamling (se tabel af materialer), designe de passende primere til PCR-amplifikation og montage af hvert segment. Resuspend primere til 100 μM med ddH2O. gør en 10 μM arbejder koncentration primer. Bruge high-fidelity polymerase for alle PCR reaktioner. Følg følgende protokol:
    1. PCR forstærke en Gal4 eller LexA udtryk kassette fra en tilgængelig vektor (fx nls-LexA:p65; de ideelle LexA-Gal4-QF2 udtryk plasmider kan findes og fremstillet af fælles ressourcer som Addgene) ved hjælp af den primere, der er anført i tabel 1B.
      1. Hvis du vil bevare alle de originale transcriptional og post-transcriptional forordninger af den afløste exon på udtryk af transaktivatoren DNA-sekvens, design kassette på en sådan måde, at den redigerede genomiske allel vil udtrykke en kimære mRNA i den transaktivatoren og genet. Bevare 5' og 3' slutningen af den målrettede exon at bevare nogen splejsning signal.
      2. Indarbejde en T2A selvstændige cleaving peptid sekvens mellem resterende 5' kodning exon og transaktivatoren sekvens til at forhindre oversættelse til en kimære protein. Tilføje en oversættelse stop codon efter eksogene transaktivatoren sekvens (figur 5).
    2. PCR forstærke homologi våben fra genomisk DNA (gDNA) udvundet fra den overordnede fluelinen valgt til injektion (Fx nos-Cas9 (om X kromosom), BL # 54591) ved hjælp af primere listet i tabel 1B. Bruge high-fidelity polymerase til alle PCR reaktioner ved hjælp af systemer som følger: 5 μl af 5 x reaktion Buffer, 0,5 μl af 10 mM dNTP'er, 1,25 μl af 10 μM frem Primer, 1,25 μl af 10 μM Reverse Primer, 0,5 μl af skabelon DNA, 0,25 μL af High-Fidelity DNA Polymerase , 16,25 μL af Hedeselskabet2O.
    3. Brug lineariseret kloning vektor som pUC19. Der findes nu en række af donor vektorer. Se en samlet liste på følgende website-http://flycrispr.molbio.wisc.edu.
    4. Køre PCR-produkter på en 1%-agarosegel. Udføre elektroforese for tid nok til at sikre en klar adskillelse af bølgeområde fra de uønskede uspecifikke bands (hvis nogen). Gel-rense de forventede DNA fragmenter. Mål koncentrationen af hver renset DNA-fragment, der bruger et spektrofotometer.
    5. Oprette DNA forsamling reaktion efter fabrikantens anvisninger. Bland de lineariseret kloning vektor og target fragmenter fra trin 3 og trin 4 i den følgende reaktion: 1 μL af lineære kloning vektor (50 ng/μl), 2 – 3 fold overskydende af hver target fragment, 10 μL 2 x DNA forsamling master mix, bringe den endelige reaktion volumen til 20 μL med ddH < C21 > 2O. Incubate mastermix i 1 time ved 50 ° C.
    6. Omdanne 2 μl af varens forsamling til kompetente bakterier, plade på LB/Amp agar plader der indeholder 100 μg/mL ampicillin. Også, tilføje X-Gal + IPTG på pladen for blå/hvid screening.
    7. Pick 3 – 4 hvide kolonier fra natten-rugede pladen, podes koloni i 3 mL LB indeholdende 100 μg/mL ampicillin og vokse ved 37 ° C natten over i en shaker. Ekstrakt plasmid fra natten-kulturperler bakterier ved hjælp af plasmid mini prep kit efter fabrikanten 's manual (Se Tabel af materialer).
    8. Skærmen den positive koloni af PCR eller begrænsning fordøjelsen.
    9. Sekvens verificere den endelige plasmid HDR donor-regionen. Gemme en bakteriel bestand omdannet med de korrekte kloner i 20% glycerol ved-80 ° C til fremtidige podning.

3. embryo injektion, flyve genetik og Screening for genom-redigering

  1. Forberede høje renhed endotoxin-fri gRNA udtryk vektor samt HDR donor plasmid ved hjælp af en plasmid maxiprep kit (Se Tabel af materialer).
  2. Co indsprøjtes gRNA udtryk plasmid (100 ng/μl) og udskiftning donor (500 ng/μl) i kønscelleoverførsel nos-Cas9 embryoner6. Bemærk: vi bruger en kommerciel service til injektion, men denne procedure kan udføres på laboratorium.
  3. Flyve genetik og screening (figur 2 og figur 3):
    1. Når de injiceres embryoner udvikler sig til voksne, på tværs af hver enkelt G flyver0 til balancer fluer. Vælg egnet balancer for kromosom indeholder den målrettede allel.
    2. Bedøver F1-afkom fra hvert G0 cross på en CO2 pad og tilfældigt vælge 10-20 mænd under et stereomikroskop. Krydse dem individuelt til balancer hunner, som vist i figur 3.
    3. Når F2 larver klækkes, vælge enkelt F1 far fra hver cross og udtrække gDNA ved hjælp af enkelt flyve genomisk DNA forberedelse protokollen:
      1. Forberede gDNA udvinding buffer: 10 mM Tris-Cl pH 8,2, 1 mM EDTA, 25 mM NaCl, opbevares ved stuetemperatur. Forberede 20 mg/mL Proteinase K stamopløsning og opbevares i fryseren.
      2. Sætte hver flue i en 1.5 mL micro-centrifugerør og etiket røret. Holde i-80 ° C fryser natten over.
      3. Forberede en frisk arbejder bind af gDNA ekstraktionsbuffer indeholdende 200 µg/mL endelige koncentration af Proteinase K.
        Bemærk: Brug ikke en gammel buffer til dette trin.
      4. Klemme hver flyve til 10 – 15 s med en pipette tip indeholdende 50 μL squishing buffer uden udlevering af væsken. Undvære den resterende buffer ind i røret og bland godt. Der inkuberes ved 37 ° C i 20-30 min.
      5. Lægge rør i 95 ° C varme blok for 1-2 min til at inaktivere Proteinase K.
      6. Spin ned i 5 min på 10.000 x g. Gemme forberedelse ved 4 ° C for yderligere PCR analyse.
  4. Brug den samme metode til at forberede gDNA fra en nos-Cas9 flue, der tjener som en negativ kontrol. Udføre tre-trins PCR baseret skærme for at identificere den korrekte "ender ud" HDR (figur 2, figur 5) ved hjælp af gDNA af hver F1 mand som en skabelon5. Bruge 1 μL af DNA prep i følgende PCR reaktion system: 10 μL 2 x PCR Master Mix med farvestof, 1 μL af hver primer (10 μM), 1 μL af DNA skabelon, og 7 μL af Hedeselskabet2O.
  5. Som vist i figur 5A, udføre PCR ved hjælp af primere fwd1 og rev1 til skærmen for eksistensen af isætning eller udskiftning; udføre PCR ved hjælp af fwd2 og rev2 primere til at kontrollere isætning eller udskiftning fra 3' region; udføre PCR ved hjælp af primere M13F og rev3 at kontrollere "ender-i" HDR (tabel 1 c).
  6. Holde de flyve linjer med bekræftet ender ud HDR og etablere afbalanceret bestande fra F2-generationen. Krydses til balancer fluer igen for at fjerne eventuelle utilsigtede mutationer på andre kromosomer.
  7. Forbered dig høj kvalitet gDNA fra de etablerede bestande til forstærke lang PCR (> 800-1.000 nt) amplikon med high-fidelity Taq-polymerase og fuldt sekvens kontrollere amplikoner fremstillet de manipulerede genomisk regioner. Alternativt, bruger rå gDNA ekstrakt som beskrevet tidligere til at forstærke kortere (< 800 nt), overlappende PCR produkter for at validere det redigerede genomet sekvens. Brug følgende protokol til at forberede en god kvalitet Drosophila genomisk DNA:
    1. Sætte om 25 voksne fluer i 1,5 mL microcentrifuge rør, og fryse i-20 ° C eller-80 ° C fryser i mindst 1 time.
    2. Tilsæt 250 μL af opløsning A (pH 9,0 Tris HCl 0,1 M, EDTA 0,1 M, SDS 1%).
    3. Homogeniseres fluer ved hjælp af de homogenisering pestles i microcentrifuge rør, og lægge røret på is.
    4. Der inkuberes ved 70 ° C i 30 min.
    5. Tilføje 35 μL af KOAc (5 M), ryste og bland godt, men gør ikke vortex.
    6. Der inkuberes i isbad i 30 min.
    7. Spin på 12.000 x g i 15 min.
    8. Med en 1 mL mikropipette, omhyggeligt overføre kun klare supernatanten til en ny tube, forlader tilbage enhver bundfaldet eller interfasen.
    9. Tilføj 150 μL af isopropanol til supernatanten. Forsigtigt blandes ved inversion.
    10. Spin på 10.000 x g i 5 min.
    11. Forsigtigt fjerne supernatanten og forlade pellet i røret.
    12. Vaske pellet med 1 mL 70% EtOH.
    13. Spin på 12.000 x g i 5 min.
    14. Fjern supernatanten. Luft tørre pellet for 15 til 20 min. Over tør ikke pellet.
    15. Opløse pellet i 100 μL af Hedeselskabet2O.
    16. Brug high fidelity DNA polymerase egnet til lang amplikon (> 800 bp) til at forstærke den komplette redigerede region. Ideelt, tage to primere uden for den indsatte kassette til at forstærke den genomisk region. Gel rense PCR produkt, og som beskrevet tidligere, sekvens kontrollere produkt med flere overlappende primere.
  8. Validere de korrekte spatiotemporelle udtryk mønstre fra dissekeret væv/embryoner manipuleret flyve linjer:
    1. Udføre RT-PCR fra den samlede RNA til at kontrollere et udtryk for produktets hybrid mRNA (tabel 1 d).
    2. Udføre en i situ hybridisering af mRNA produkt af interesse i larve væv/embryo til at validere udtryk.
    3. At screene for nøjagtig væv-specifikke spatiotemporelle udtryk mønstre blandt de sekvens-verificerede ender-out linjer, krydse hver af de redigerede linjer opnået for den binære udtryk driver med LexO- NGL eller LexO- RFP (for LexA driver) linje (tilgængelig fra Bloomington stock Centre) og observere LexA eller Gal4 drevet reporter-genekspression i embryo, larve og voksen væv under et fluorescens mikroskop.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Denne protokol blev med held bruges til at generere en målrettet binære udtryk reporter system specifik for bnl udtrykker celler5. Cis-regulerende elementer (CREs) at styre komplekse spatiotemporelle bnl udtryk er ikke karakteriseret. Derfor, for at opnå spatiotemporelle udtryk under kontrol af den endogene bnl regulerende sekvens, kun den første kodning exon af bnl var designet til at blive erstattet med sekvensen af den bakterielle LexA transaktivatoren. En forbedret nls-LexA::p65 kassette kendt for at give optimal udtryk i Drosophila blev valgt.

Udskiftning strategi har til formål at generere en kimære nls-LexA:p65-bnl mRNA under endogene transcriptional og post-transcriptional kontrol. Denne kimære mRNA indeholdt en intakt bnl 5' UTR, en del af årets 5' og 3' enden af den redigerede bnl kodning exon (første exon), og komplet downstream bnl introner og exons. For at bevare bnl RNA-specifikke splejsning af den afløste exon, blev små 5' og 3' ender af den afløste kodning exon bevaret. Men at forhindre syntese af en kimære Bnl protein smeltet til nls -LexA: p65, en T2A selv holde peptid sekvens blev indarbejdet mellem de resterende 5' bnl kodende region og ATG af nls-LexA:p65. Også, en oversættelse stop codon blev tilføjet efter den nls-LexA:p65 rækkefølge for at undgå Co oversættelse af en afkortet Bnl protein5 (figur 4 og figur 5A).

En udskiftning donor indeholdende alle disse funktioner blev brugt, som havde T2A-nls-LexA:p65 sekvens og 2 kb 5'- og 1,8 kb 3' - homologi arme. Lang homologi våben blev anvendt for effektiv HDR og indsættelse af en store DNA fragmenter i stedet for reparation (T2A-nls-LexA:p65 er 1,8 kb) (figur 5A).

To gRNAs blev brugt til at oprette DSBs på de definerede positioner for at slette de fleste af de første kodning exon af bnl. To gRNAs, der matcher alle kriterierne beskrevet i afsnit 1.3 (PAM sekvens understreget) var:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Begge gRNA genkendelsessekvenser blev afbrudt i udskiftning donor af af eksogene T2A-nls-LexA:p65 sekvens, som er den nemmeste måde at undgå retargeting af gRNAs til de manipuleret locus. Forstyrret gRNA anerkendelse sekvenser i udskiftning donor (en eksogen sekvenser, der forstyrret gRNA genkendelsessekvenser i kursiv) var:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

PCFD4 gRNA udtryk vektor indeholdende disse gRNAs, sammen med donor-udskiftning, var Co injiceres i kønscelleoverførsel nos-Cas9 embryoner. Efterfølgende, den protokol, der er beskrevet her blev fulgt at screene for den påtænkte udskiftning (figur 5B, C). Omkring 67% af injicerede G0 dyr var frugtbar. Og 56% af de frugtbare G0s var stifterne, som gav anledning til HDR-positive afkom. Blandt F1 afkom kontrolleret, ca. 23% var positive for vellykket HDR, og 73% af positive HDR var "ender-out" (tabel 2). Siden den første kodning exon af bnl blev "slået ud", alle HDR linjerne blev fundet for at være homozygot dødbringende, og lagrene blev vedligeholdt over balancers.

Generation af en kimære LexA-bnl mRNA i cellerne blev valideret af RT-PCR analyser (fig. 5 d). At kontrollere, hvis de opnåede bnl-LexA linjer blev udtrykt i endogene bnl udtryk mønster, hver "ender-out" HDR linje blev krydset til LexO-mCherryCAAX transgene fluer5og reporter udtryk mønster blev undersøgt i den afkom embryoner og larver. 42 ud af 46 linjer viste nøjagtig spatiotemporelle udtryk i overensstemmelse med den tidligere rapporteret bnl mønstre5 (figur 6). Fire linjer viste enten svag eller ikke-specifikke udtryk mønstre. Vi forudser, at disse linjer måtte har akkumuleret mutationer, som vi skal bekræfte med grundig sekventering analyser. Sammen bekræftede disse resultater, at HDR-medieret exon udskiftning strategi med held kunne anvendes til at generere en målrettet binære ekspressionssystem for en gen. Værktøjet kan med succes bruges til at udtrykke reporter eller ektopisk gener i de spatiotemporelle mønstre af bnl genet.

Figure 1
Figur 1: ordning af en binær transskription system for målrettede genekspression. En transaktivatoren (GAL4 eller LexA), udtrykt under kontrol af cis-regulerende elementer (CREs) af et gen, drev en effektor transgen placeret nedstrøms for specifikke transskription bindingssteder (UAS for Gal4 eller LexAop for LexA). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: en oversigt over arbejdsproces for CRISPR/Cas9-medieret genom-redigering til at generere en binær transskription system. Den omtrentlige varighed kræves for hvert trin er anført. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: en illustration af CRISPR screening og genetiske cross ordning for fastsættelse af genom-redigeret flyve linjer. I genetiske Kors står R for den redigerede allel, der er på 3rd -kromosom. MKRS (Tp (3; 3) MRS, M (3) 76A [1] kar [1] ry [2] Sb [1]), er en 3rd kromosom markør; TM6B (I (3LR) TM6B, Antp [Hu] e [1] Tb[1]) er en 3rd kromosom balancer. Genom redigeret flyve bestande er verificeret af PCR forstærke målområder af interesse fra genomisk DNA ekstraheret fra enten F2 eller F3 generation fluer og sekvens bestemmelse af PCR-produkter. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: Generation af udskiftning kassette af DNA forsamling. En skematisk tegning skildrer PCR-amplifikation og samling af forskellige PCR produkter (a, b og c) til donor vektor (d) ved hjælp af en DNA forsamling metode. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: Generation af bnl-LexA af CRISPR/Cas9-medieret exon udskiftning. (A) skematisk tegning skildrer strategien for CRISPR/Cas9 medieret HDR for exon udskiftning i bnl locus. Box - exon; Line-intron; udskiftning donor (pDonor -bnl:LexA) og to mulige udfald af HDR blev vist. PDonor -bnl:LexA havde følgende funktioner: (1)T2A-nls-LexA:p65 (~1.8kb) sekvens flankeret af 2 kb og 1,8 kb homologi arme (stiplede linjer), (2) en T2A selvstændige cleaving peptid mellem de resterende N terminal bnl exon og NLS-LexA:p65, og (3) en oversættelse stop codon (rød *) efter den nls-LexA:p65 sekvens. HDR produkt beholdt alle bnl,og LexAtranscriptional og post-transcriptional kontrol: p65 protein forventes at blive produceret i samme mønster som endogene Bnl. små sorte pile viser relative bindingsstederne (ikke i skala) af PCR-primere (tabel 1) bruges til 3-trins screening eller RT-PCR validering. (B) agarosegel billeder viser resultaterne af 3-trins PCR screening. PCR produkter amplificeret fra genomisk DNA af fire succesfulde ender ud HDR linjer er vist; negativ kontrol, genomisk DNA af nos-Cas9 forældrenes linje; positiv kontrol, pDonor -bnl:LexA plasmid; Møller, markør (SL2K DNA ladder). (C) et eksempel på screening gelen viser den forventede PCR produkt ved hjælp af primere M13F og rev3 for enderne-i linjer; M8-7 og M9-6 er to ender i linjer; negative og positive kontroller, den samme som i B; Møller, markør (NEB 1 kb DNA ladder). (D) RT-PCR analyse på total RNA fra bnl-LexA og nos-Cas9 kontrol flyver. Fremad primer binder sig til en bestemt region, LexA , reverse primer binder sig til en downstream bnl exon region; ~ 440 bp (basepar) forstærkning band (*) blev opdaget af RT-PCR på bnl-LexA mRNA, men ikke fra kontrolelementet RNA. M, 100 bp markør (NEB). Tilpasset fra figur 2 og S1 i Du mfl. 20175. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: Validering af væv-specifikke og betinget bnl-LexA udtryk i forskellige væv. (A-D) bnl udtryk (rød) i forskellige larve væv, med btl udtrykker celler vist i grøn. (A, A') Wing bnl diskkilden foran den voksende Luftsækken primordium (ASP). (B, C) BNL udtryk i TR5 tværgående bindevæv (TC) (B) og TR2 dorsale gren (DB) (C). (D) bnl udtryk i genital diske. (E-J) Dynamisk bnl udtryk (rød) under embryonale trakeal gren (grøn) mønstre; Små pile, fem bnl kilder omkring luftrør placode på trin 10. Genotyper: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ") Hypoxi-induceret bnl-LexA udtryk profil i wing diske og tilhørende TR2 trakeale metamere (TC, DB, dorsale trunk-DT). Genotype: bnl-LexA, LexO -CherryCAAX / +. (K) kontrol diske fra ex vivo kulturperler organer uden CoCl2. (L-L") fløj diske (L, L') og luftrør (DT, (L'')) fra kulturperler ex vivo organer med CoCl2 induceret hypoxi. Stjerne, Ektopisk udtryk induceret af hypoxi. Skalere barer = 30 µm; 50 µm (K-L"). Tilpasset fra figur 3 i Du mfl. 20175. Venligst klik her for at se en større version af dette tal.

A. gRNA kloning og sekventering
BNL-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
cGACGTTAAATTGAAAATAGGTC
T3 primer anvendes til sekvensering CAATTA ACCCTCACTAAAGG-3'
Bemærk: nukleotider understregede anneal U6 promotor eller gRNA core på pCFD4 vektor, de små bogstaver g/c blev føjet til støtte U6 promotor-afhængig transkription
B. HDR donor konstruktion
BNL Nielsen-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL lexA-Nielsen tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Bemærk: nukleotider i hovedstaden overlapning med pUC19 vektor for Gibson forsamling, nukleotider understregede var sekvens overhæng for T2A peptid tilsætning.
C. HDR screening og sekventering
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
ender i check rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Bemærk: Disse primere blev brugt til PCR screening og sekventering, de omtrentlige placeringer af primer bindingssteder er vist i figur 5A som fwd1-2 og rev1-3.
D. RT-PCR analyse
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabel 1: primere anvendes i denne undersøgelse. (A) primere for kloning gRNA udtryk vektor og sekventering. (B) primere for kloning HDR donor skabelon. (C) primere for screening og sekventering af HDR produkter. (D) primere bruges til RT-PCR verifikation af varens kimære LexA-bnl mRNA.

genotype HDR transmission sats % (# HDR-fremstilling G0 / # frugtbare G0) # HDR-positive F1 / # samlede F1 kontrolleres (%) # "ender-out" HDR / # samlede HDR (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabel 2: effektiviteten af CRISPR/Cas9-medieret HDR. HDR transmission sats beregnes som # af HDR-fremstilling G0 / # af samlede frugtbare G0. Vellykket HDR % beregnes som # af HDR-positive F1 / # af samlede F1 screenet. "Ender-out" % beregnes som # "ender-out" HDR / # af samlede positive HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Traditionelt, blev Drosophila enhancer fælder genereret af to forskellige metoder. En af måder omfatter tilfældige indsættelse af en driver (fx., Gal4) sekvens i genomet af gennemførelse (fx., P-element gennemførelse)1 . Alternativt, driver sekvenser kan placeres under transcriptional kontrol af en formodede forstærker/promotor-regionen i en plasmid konstruktion, som ville derefter integreres i en ektopisk site af genom3,11. Selv om disse metoder har genereret en stor pulje af Gal4 eller LexA enhancer fælder for Drosophila, har de flere begrænsninger. P-element-medieret tilfældige indsættelse i genomet kan forstyrre den lovgivningsmæssige aktivitet af kritiske cis-regulerende sekvenser. På grund af den tilfældige gennemførelse i genomet, kan transaktivatoren udtryk rapportere mønstre af flere nærliggende gener. På den anden side er en forudgående kendskab til cis-regulerende sekvenser af et gen nødvendige for en forstærker-fælde plasmid konstruktion. Der er også en grænse for længden af en sekvens, der kan klones og testet i en plasmid konstruktion. Isolere og kloning kun en delvis fragment af DNA ud af den endogene genomiske sammenhæng kan ikke reproducere et komplet gen-specifikke udtryk mønstre. For eksempel, gengiver linjen bnl-Gal4 (NP2211), som blev genereret af P-element indsættelse af en forstærker trap Gal4 element lige foran bnl gen, helt ikke gen-specifikke udtryk mønstre i embryo5 . Derfor, under sådanne sammenhænge, de nyorientering teknikker, såsom HACK (homologi bistået CRISPR knock-i), at kan konvertere det eksisterende Gal4 linjer i en anden LexA eller Q-system baseret driver linje12 kan ikke være meget nyttig. For at overvinde disse begrænsninger, her, beskrev vi en effektiv og alternative metode til at generere binære udtryk systemer af genom-redigering. I denne metode, den første kodning exon af et gen er udskiftet med transaktivatoren (fx., LexA eller Gal4) sekvens så at udtryk for transskription driver udelukkende efterligner spatiotemporelle mønstre af Gen-ekspression. Selv om strategi og protokoller er beskrevet her var optimeret til bnl -udtryk, kan metoden let vedtages for andre gener.

Bestemmelse af en indsættelsesstedet inden for regionen målrettede gen er den mest afgørende skridt i denne eksperimentelle strategi. Metoden vi præsenteret var designet til at bevare alle den oprindelige transcriptional samt de post-transcriptional forordninger bnl gen5. Derfor, vi har planlagt at slette de fleste af de første kodning exon af bnl genet og erstatte det med LexA kassette. Udskiftning var planlagt på en sådan måde, at den redigerede allel udtrykker en hybrid LexA-bnl mRNA fra endogene transskription og translation starter site af bnl samtidig bevare alle de intronic regioner. Dog hybrid mRNA blev manipuleret til at producere kun LexA protein, men ikke Bnl. Vi viste, at strategien med succes havde genereret en bnl-LexA /LexO-baseret transskription system, og at systemet kan præcist dynamisk, spatiotemporelle bnl udtryk mønstre (figur 5)5 . En begrænsning af denne proces er den homozygot dødelighed i Drosophila linjer hvis målrettede genet er afgørende for overlevelse. Yderligere, brug af en dobbelt gRNA strategi kan øge chancen for off-target redigering. En alternativ strategi kan anvendes til at undgå disse problemer. I denne strategi, kan en LexA eller Gal4 kassette placeret lige på ATG startstedet det erstattede gen og en T2A selv holde peptid sekvens kan placeres mellem LexA/Gal4 kassette og starten af den intakte kodning exon af target-genet. Denne strategi forventes at producere en kimære mRNA, der kan oversættes til både transctivator og funktionelle gen produktet. Sådan et design kunne muligvis reducere chancen for homozygote dødelighed. I denne strategi er en enkelt gRNA tilstrækkelig for genom-redigering. Men, i nærværelse af to kopier af funktionelle gener, udtryk af transgene protein varianterne drevet af Gal4/LexA driver (fx., bnl-LexA drevet udtryk for LexO- Bnl: normal god landbrugspraksis fusioner eller Bnl proteiner med sletninger) vil ikke give oplysninger af funktionaliteten af de variant proteiner.

En begrænsning af genom-redigering-strategien er den besværlige proces af målretning og redigering af et enkelt gen ad gangen. Men den enkelhed og effektivitet af CRISPR/Cas9-medieret genom redigering metode har revolutioneret målrettede genomisk knock-knock-udtjekning og udskiftning teknologi, der kan nemt vedtages i enhver standard laboratorium oprettet. I de sidste mange år, har Drosophila forskere udviklet praktiske værktøjskasser for genom-redigering, der kan anvendes til at udvide den genetiske toolsets afgørende for forståelse grundlæggende biologiske processer7,13 . Genom redigering og screening processer beskrevet her er forholdsvis hurtigere og tager omkring to måneder i forhold til alle andre homologe rekombination-baseret erstatning. For vellykkede og effektive genom-redigering resultater, er det vigtigt at følge flere teknisk kritiske trin: 1) hver gRNA er valgt af den maksimale strenghed og aktivitet uden potentielt off mål; 2) HDR donor indeholder ~1.5 kb homologi arme flankerende gRNA målretning websteder. Længere homologi arme (1,8-2 kb) bruges til at øge effektiviteten af HDR, når et stort udefrakommende DNA-fragment skal indsættes; 3) HDR donor er designet til at være fri for gRNA genkendelsessekvenser at undgå retargeting af gRNA til de manipuleret locus; og 4) en idiotsikker omfattende plan og koordinering af timingen af genetiske krydser med 3-trins PCR-baseret screening at vælge en "ender-out" HDR linje.

I modsætning til tilfældige gennemførelse eller klonede enhancer konstruktioner, strategi og protokoller vi beskrevet her sikrer generation af en udelukkende målsystemet gen-specifikke binære transskription. Da udtryk for føreren erstatter en native gen exon, gen-specifikke udtryk af driveren er også alsidige og forventes at efterligne gen expression mønstre under alle udviklingsmæssige, metaboliske og fysiologiske forhold5. Gen/celle-specifikke udtryk er de mest ønskværdige kriterier for alle binære driver linjer, når de anvendes i forskellige celle og udviklingsmæssige biologi metoder. For eksempel, letter gen-specifikke udtryk for reporter gener af en transskription driver pålidelige lineage analyser af de celler, der udtrykker target-genet. Det sætter også live imaging og sporing af spatiotemporelle udtryk, migration og reorganisering af celler under udvikling. For at undersøge de cellulære og molekylære begivenheder under væv morfogenese, Gal4 eller LexA drevet overekspression/misexpression af er forskellige transgener og RNAi-medieret gen knock-down i bestemte sæt af celler essentielle. Meget specifikke målrettede udtryk system giver en uvildig analyse og fortolkning af resultaterne. Derfor, CRISPR/Cas9-baseret målretning af et gen exon og erstatte den med en transaktivatoren sekvens giver et bedre alternativ til at generere meget specifikke målrettede gen expression systemer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen interessekonflikter at videregive.

Acknowledgments

Vi takke Dr. F. Port, Dr. K. O'Connor-Giles og Dr. S. Feng for drøftelser om CRISPR strategi; Dr. T.B. Kornberg og Bloomington Stock Center for reagenser; UMD imaging core facilitet; og midler fra NIH: R00HL114867 og R35GM124878 til SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics