Kristallstruktur des N-terminale Domäne des Ryanodin-Rezeptoren von Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

In diesem Artikel beschreiben wir die Protokolle der Proteinbestimmung Ausdruck, Reinigung, Kristallisation und Struktur der N-terminalen Domäne des Ryanodin-Rezeptoren von Diamondback Moth (Plutella Xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Entwicklung von potenten und effiziente Insektiziden gezielt Insekt Ryanodin-Rezeptoren (RyRs) wurde von großem Interesse im Bereich der landwirtschaftlichen Schädlingsbekämpfung. Bis heute mehrere Diamide Insektizide targeting Pest, die RyRs in den Handel gebracht worden sind, generieren, die jährlichen Umsatz von 2 Milliarden US-Dollar. Aber Verständnis für die Wirkungsweise von RyR Zielversionen Insektiziden ist begrenzt durch den Mangel an strukturellen Informationen über Insekt RyR. Dies schränkt im Gegenzug Verständnis für die Entwicklung von Insektizid Widerstand in Schädlinge. Die Diamondback Moth (DBM) ist eine verheerende Pest zerstören Kreuzblütler Kulturen weltweit, die auch berichtet wurde, Widerstand gegen Diamide Insektizide zu zeigen. Daher ist es von großer praktischer Bedeutung, neuartige Insektizide, die Ausrichtung der DBM RyR, vor allem auf eine Region, die anders als die traditionelle Diamide-Bindungsstelle zu entwickeln. Hier präsentieren wir ein Protokoll, um die N-terminale Domäne von RyR von DBM strukturell zu charakterisieren. Die Röntgen-Kristallstruktur wurde gelöst durch molekulare Ersatz mit einer Auflösung von 2,84 Å, die zeigt, ein Beta-Kleeblatt Falten Motiv und eine flankierende Alpha-Helix. Dieses Protokoll kann in der Regel für den Ausdruck, Reinigung und strukturelle Charakterisierung von anderen Domänen oder Proteine angepasst werden.

Introduction

Ryanodin-Rezeptoren (RyRs) sind spezifische Ionenkanäle, die die Permeation von Ca2 + -Ionen über den sarkoplasmatischen Retikulum (SR)-Membranen in den Muskelzellen zu vermitteln. Daher spielen sie eine wichtige Rolle in der Erregung Kontraktion Kupplung Prozess. In seiner funktionalen Form RyR montiert wie ein Homo-Tetramer mit einer Molekülmasse von > 2 MDa mit jeder Untereinheit, bestehend aus ~ 5000 Aminosäurereste. Bei Säugetieren, gibt es drei Isoformen: RyR1 - Skelettmuskulatur Typ, Herzmuskel Typ RyR2- und RyR3-ubiquitär in verschiedenen Geweben1ausgedrückt.

Bei Insekten gibt es nur eine Art von RyR, das Muskel- und Nervensystem Gewebe2ausgedrückt wird. Insekt RyR ist ähnlicher Säugetier RyR2 mit einer Sequenz-Identität von etwa 47 %3. Diamide Insektizide targeting RyR Lepidoptera und Coleoptera entwickelt und vermarktet von Großunternehmen wie Bayer (Flubendiamid), DuPont (Chlorantraniliprole) und Syngenta (Cyantraniliprole). Seit relativ kurzer Zeit sind Diamide Insektizide eines der am schnellsten wachsende Klasse von Insektiziden geworden. Derzeit haben die Verkäufe von diesen drei Insektizide jährlich 2 Milliarden US-Dollar mit einer Wachstumsrate von mehr als 50 % seit 2009 (Agranova) überschritten.

Jüngste Studien haben die Entwicklung von Resistenzen bei Insekten nach wenigen Generationen der Nutzung dieser Insektizide4,5,6,7,8berichtet. Die Resistenzmutationen in der transmembrane Domäne des RyRs aus der Diamondback Moth (DBM), Plutella Xylostella (G4946E, I4790M) und die entsprechenden Positionen in Tomaten-Leafminer, Tuta Absoluta (G4903E, I4746M) zeigen, dass die region könnte Diamide Insektizid Bindung beteiligt sein, da diese Region bekannt ist kritisch für die Anspritzung von Channel4,8,9. Trotz umfangreicher Forschung in diesem Bereich bleiben die genauen molekularen Mechanismen der Diamide Insektizide schwer. Darüber hinaus ist unklar, ob die Resistenzmutationen Interaktionen mit Diamides direkt oder allosterically betreffen.

Frühere Studien haben berichtet, die mehrere Domänen RyR Säugetierarten und Struktur in voller Länge Säugetier-RyR1 und RyR2 durch Röntgen-Kristallographie und Kryo-Elektronenmikroskopie, bzw.10,11, 12,13,14,15,16,17,18,19,20,21 . Aber bisher keine Struktur des Insekts RyR wurde berichtet, das verbietet uns vom Verständnis der molekularen Feinheiten der Rezeptor-Funktion sowie die molekularen Wirkmechanismen Insektizid und Insektizid Resistenzentwicklung.

In diesem Manuskript präsentieren wir eine generalisierte Protokoll für die strukturelle Charakterisierung der N-terminale β-Kleeblatt-Domäne des Ryanodin-Rezeptoren von Diamondback Moth, zerstörerischen Schädling infiziert Kreuzblütler Kulturen weltweit22. Das Konstrukt wurde nach den veröffentlichten Kaninchen RyR1 NTD Kristall Strukturen23,24, Cryo-EM Strukturmodellen16,17,18,19, entwickelt. 20 , 21. Dies ist die erste hochauflösende Struktur für Insekt RyR, die zeigt des Mechanismus für die Anspritzung Kanal und stellt eine wichtige Vorlage für die Entwicklung der artspezifischen Insektizide mit Struktur-basierte Wirkstoffdesign gemeldet. Für die Strukturaufklärung beschäftigten wir Röntgen-Kristallographie, die als "Goldstandard" für Protein Strukturaufklärung an in der Nähe von atomarer Auflösung gilt. Obwohl die Kristallisation unberechenbar und arbeitsintensiv ist, wird dieser Schritt für Schritt-Protokoll den Forschern helfen, zum Ausdruck bringen, zu reinigen und zu anderen Domänen von Insekten RyR oder andere Proteine im Allgemeinen zu charakterisieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Gen-Klonieren, Proteinexpression und Reinigung

  1. PCR DNA entspricht Protein des Interesses zu verstärken (1-205 Rückstände von DBM RyR, Genbank gem. keine. AFW97408) und Klon in Haustier-28a-HMT Vektor durch Ligation-unabhängige Klonen (LIC)25. Dieser Vektor enthält ein Histidin-Tag, MBP-Tag und ein TEV Protease-Spaltstelle am N-Terminus15.
    1. Entwerfen Sie LIC Primer für die Amplifikation des Zielgens mit LIC-kompatiblen 5' Erweiterungen:
      Nach vorne LIC-Primer:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Rückwärts LIC-Primer:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Kombinieren Sie die Reaktionskomponenten (50 μL): 1 μl DNA-Templates (100 ng/μl), 1 μL forward Primer (10 μM), 1 μL der rückwärts-Primer (10 μM), 0,5 μL der DNA-Polymerase (NEB), 5 μl 10-fach Reaktion-Puffer, 1 μl dNTP (25 mM) , 40,5 μl RNase frei DdH2O.
      1. Legen Sie das Reaktionsgemisch in einer PCR-Maschine und führen Sie das folgende Programm.
      2. Bei 95 ° C für 3 min inkubieren, und führen Sie dann 30 Zyklen (95 ° C für 30 s, 58 ° C für 15 s, 72 ° C für 1 min). Bei 72 ° C für 5 min inkubieren Sie und halten Sie dann bei 4 ° C.
      3. Die gesamte Reaktion Mischung (50 μl) auf ein 2 % Agarosegel laufen und mit einem Gel Extraction Kit extrahieren. Protokoll des Herstellers zu folgen.
    3. Ligatur-unabhängige Klonen (LIC)
      1. Führen Sie SspI Verdauung (60 μL): 20 μL der Vektor-DNA (50 ng/μl), 6 μl 10 x Reaktion Puffer, 4 μL der SspI und 30 μl DdH2O. Inkubation bei 37 ° C für 3 h laufen die gesamte Reaktion auf 1 % Agarose-Gel mischen und mit einem Gel Extraction Kit extrahieren. Protokoll des Herstellers zu folgen.
      2. T4-DNA-Polymerase Behandlung des Vektors führen und DNA einfügen. Kombinieren Sie die folgenden: 5 μl Vektor oder Insert DNA (50 ng/μl), 2 μL der 10 x T4 DNA-Polymerase-Puffer, 1 μL der dGTP (25 mM) für Vektor oder 1 μL der dCTP (25 mM) für Einsatz DNA, 1 μL von DVB-t (100 mM), 0.4 μl des T4 DNA-Polymerase (LIC-qualifiziert) , und 9,6 μL DdH2O. Incubate Reaktionen bei Raumtemperatur für 40 min. Hitze inaktivieren Enzym bei 75 ° C für 20 Minuten.
        Hinweis: Die LIC Vektor und Einfügen DNA müssen in separaten Reaktionen behandelt werden.
      3. Führen Sie der LIC Glühen Reaktion. Kombinieren Sie die folgenden: 2 μL der T4-behandelten Einsatz DNA, 2 μL der T4-behandelten LIC Vektor-DNA. Inkubieren Sie Reaktion bei Raumtemperatur für 10 min.
  2. Verwandeln Sie BL21 (DE3) E. Coli Zellen mit dieses rekombinante Plasmid.
    1. Kompetente Zellen (50 μL in Mikro-Zentrifugenröhrchen) auf Eis auftauen.
    2. Fügen Sie ca. 1 μl (50 ng) des Plasmids in die Röhre. Mischen Sie die Zellen und die DNA durch sanft streichen die Röhre 2 – 3 Mal. Legen Sie den Schlauch für 20 min auf Eis.
    3. Erhitzen Sie Schock bei 42 ° C für 40 S. Ort das Rohr auf dem Eis wieder für 2 min. Add 1 mL der Raumtemperatur LB Medien am Rohr.
    4. Ort der Mischung Rohr im Shaker 250 u/min bei 37 ° C für 45 min. verteilt 150 – 200 µL der Mischung auf die Auswahl-Platten. Drehen Sie die Platte und über Nacht bei 37 ° c inkubieren
  3. Wählen Sie eine einzelne Kolonie und die Kultur der Zellen in 100 mL 2YT Medium mit 50 µg/mL Kanamycin bei 37 ° C über Nacht. Am nächsten Morgen, 1 L 2YT Medium mit 50 µg/mL Kanamycin mit 10 mL der Nacht Kultur zu impfen und Inkubation bei 37 ° C Shaker Inkubator an 250 u/min, bis die OD600 ~ 0,6 erreicht. Danach induzieren die Kultur mit IPTG in einer Endkonzentration von 0,4 mM und wachsen für eine weitere 5 h bei 30 ° C.
  4. Ernte der Zellen durch Zentrifugation bei 8.000 X g für 10 min bei 4 ° C, die Zellen zu sammeln und jeden 10 g-Zellen in 40 mL Lyse-Puffer (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-Mercaptoethanol, 25 μg/mL Lysozym, 25 μg/mL DNase Aufschwemmen 1 mM PMSF).
    1. Stören sie durch Ultraschallbehandlung bei 65 % Amplitude für 8 min mit 1 s ein und 1 s aus. Entfernen Sie die Zellenrückstand durch Zentrifugation bei 40.000 X g für 30 min bei 4 ° C. Den Überstand von 0,22-μm-Filter auf der Durchreise zu filtern und in die Probenschleife laden.
  5. Reinigen Sie des Fusionsproteins, Spalten Sie das Tag und wieder reinigen Sie das Zielprotein.
    1. Reinigen des Fusionsproteins über Ni-NTA-Spalte (Bindung Puffer: 10 mM HEPES pH 7.4, 250 mM KCl; Elution Buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM Imidazol) und durch ein Reinigungssystem mit einem linearen Farbverlauf von 20-250 mM Imidazol zu reinigen.
    2. Spalten der eluierten Zielprotein mit TEV Protease (01:50 Verhältnis) über Nacht bei 4 ° C.
    3. Reinigen die Spaltung Reaktionsmischung mittels Amylose Harz Spalte (Bindung Puffer: 10 mM HEPES pH 7.4, 250 mM KCl; Elution Buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM Maltose) und Ni-NTA-Spalte, die Tag und TEV Protease zu entfernen. Das Zielprotein werden im Durchflussverfahren Bruch der beiden Spalten.
    4. Dialyse der Probe gegen Dialyse-Puffer (10 mM Tris-HCl pH 8,8, 50 mM KCl, 10 mM β-Mercaptoethanol, die Salzkonzentration zu reduzieren. Reinigen Sie die Probe auf einem Anion-Austausch-Spalte (Bindung Puffer: 10 mM Tris-HCl pH 8,8, 10 mM β-Mercaptoethanol; Elution Buffer: 10 mM Tris-HCl pH 8,8, 1 M KCl, 10 mM β-Mercaptoethanol) durch einen linearen Verlauf von 20-500 mM KCl im Elution Puffer.
    5. Als letzten Schritt in den Reinigungsprozess das Protein mit zentrifugalen Konzentrator (10 kDa MWCO) zu konzentrieren und Spritzen in eine Superdex 200 26/600-Gel-Filtration-Spalte, die Homogenität zu überprüfen.
  6. Untersuchen Sie die Reinheit des Proteins, indem Sie auf eine 15 % SDS Seite ausgeführt.
    Hinweis: Alle Spalten werden auf ein Protein-Reinigungsanlage mit einer verbindlichen Flussrate von 2 mL/min und eine Elution Durchflussmenge von 4 mL/min mit Ausnahme von Gel-Filtration bei 1 mL/min. ausgeführt werden.

2. Protein Vorbereitung und Kristallisation

  1. Konzentrieren der gereinigten Protein Probe 10 mg/mL mit Zentrifugal-Konzentrator (10 kDa MWCO) und Buffer Tausch auf Kristallisation Puffer vor der Lagerung bei-80 ° C.
  2. Kristallisation Screening durchführen (Verhältnis 1:1, 200 nL von Protein und 200 nL Reservoir Puffer) durch die Sitzung fallen Dampf-Diffusion-Methode bei 295 K mit mehreren Kristallisation Kits mit einer automatisierten Flüssigkeit Umgang mit Robot-System in einem 96-Well-Format.
    Hinweis: Wir nutzten Kits von molekularen Dimensionen und Hampton Forschung und der Greif automatisiert liquid Handling-System.
  3. Versiegeln Sie die Kristallisation 96-Well-Platte um Verdunstung zu vermeiden und ermöglichen die Gleichgewichtherstellung der Protein-Tropfen mit dem Reservoir-Puffer. Halten Sie dann die Platten in den Kristall-Inkubator bei 18 ° C.
  4. Überprüfen Sie die 96-Well-Platten, die in regelmäßigen Abständen mit einem Lichtmikroskop Kristallbildung und Wachstum zu überwachen.
  5. Zur Unterscheidung von Proteinkristallen von Salzkristallen, verwenden Sie einen Protein-Farbstoff. Fügen Sie 1 µL Farbstoff zum Drop-Ziel. Warten Sie ca. 1 h und unter dem Mikroskop beobachten. Die Proteinkristallen werden blau.
  6. Nutzungsbedingungen der positiven Kristallisation (1,5 M Ammoniumsulfat, 0,1 M Tris pH 8.0) zur weiteren Optimierung der Kristalle mit hängenden drop-Dampf-Diffusion-Methode in 24-Well-Platten.
    1. PH-Wert von 7,0 bis 8,5 mit 0,5 pH-Einheit-Intervall jeden Schritt zu optimieren. Optimieren Sie Konzentration von Ammoniumsulfat von 1,2 M bis 1,7 M mit 0,1 M Intervall jeden Schritt. (In unserem Fall war die beste Voraussetzung, die Herstellung von großen plattenförmigen Kristallen 0,1 M HEPES pH 7.0 und 1,6 M Ammoniumsulfat)

3. Crystal Montage, Röntgen-Datenerfassung und Strukturaufklärung

  1. Montieren Sie Kristalle in einer Cryoloop und Blitz-Cool in flüssigem Stickstoff mit Reservoir-Lösung mit 20 % Glycerin als Cryo-Schutzmittel. Legen Sie die Kristalle in Unipuck für Lagerung und Transport.
  2. Vor dem Bildschirm Proteinkristallen mit einer Rigaku Inhouse Röntgen-Diffractor. Wählen Sie die besten mit den höchsten Auflösungen für die Datenerfassung am Synchrotron Einrichtungen (unseres Datensatzes wurde von BL17U1 in Shanghai Synchrotron Radiation Facility erhoben).
    1. Verwenden Sie die Strahlrohr Steuerungssoftware BluIce26 zu montieren und in der Mitte der Kristalle durch automatische oder manuelle Zentrierung Funktion. Führen Sie Test-Aufnahmen um Daten-Collection-Strategie, einschließlich dem Starten Winkel, Belichtungszeit, Detektor-Abstand, Rahmenbreite und Zahlen zu bestimmen.
    2. Dataset entsprechend zu sammeln (erhobenen 180 Frames mit 1 s Belichtungszeit, 1° Rahmenbreite und der Detektor-Abstand von 350 mm).
  3. Index, zu integrieren und skaliert das Dataset mithilfe HKL2000 Suite27. Führen Sie die Spitze-Suchfunktion, die Beugung Spots zu finden und dann index die Spots und wählen Sie die richtigen Raum-Gruppe. Skalieren Sie nach Peak-Integration das Dataset mit der richtigen Fehlermodell und speichern Sie die Ausgabedatei .sca.
  4. Lösen Sie die Phase-Problem, indem molekulare Ersatz mit Phaser28 in PHENIX29.
    1. Berechnen Sie die mögliche Kopienzahl des Protein-Moleküle in der asymmetrischen Einheit von Xtriage30.
    2. Suchen Sie die richtige Struktur-Vorlagen mit hoher Identität und strukturelle Sequenzähnlichkeit als das Zielprotein mit bekannten Strukturen von Literatur oder die Modelle von Struktur Vorhersage Server wie Phyre231 erzeugt (Wir verwendeten Kaninchen RyR1 NTD als Ein Suchmodell, PDB-ID 2XOA).
    3. Führen Sie Phaser mit Beugung-Datendatei, die Template-Struktur-Datei und die Protein-Sequenz, um die Lösung zu finden.
  5. Führen Sie AutoBuild32 in PHENIX29 , das erste Modell mit der Ausgabedatei von Phaser und die Sequenz-Datei aus dem Zielprotein zu generieren.
  6. Manuell die Struktur in der modifizierten experimentelle Elektronendichte mit Coot33 erstellen und verfeinern mit phenix.refine34 in iterativen Zyklen.
  7. Das letzte Modell mit der Validierungs-Tools in PHENIX18zu validieren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Reinigung

Die N-terminale Domäne des DBM RyR wurde als ein Fusionsprotein mit einem Hexahistidine Tag, ein MBP-Tag und ein TEV Protease-Spaltstelle ausgedrückt. Wir folgten eine fünf-Stufen-Reinigung-Strategie um ein sehr reines Protein, geeignet für Kristallisation Zweck zu erhalten. Anfangs war Fusionsproteins aus der löslichen Fraktion von Zelle lysate durch Ni-NTA-Spalte (HisTrap HP) gereinigt. Als nächstes Fusionsproteins TEV Protease Spaltung unterzogen wurde und die Hexahistidine-MBP glyko-wurde von Amylose Harz Spalte gefolgt von Ni-NTA-Spalte entfernt. Weiter, das Protein Austausch spaltenweise Anion (Q Sepharose HP) gereinigt wurde und schließlich spaltenweise Gel-Filtration (Superdex 200 26/600). Die letzte Ausbeute an gereinigtes Protein aus 1 L Bakterienkultur mit 2YT Media war ~ 4 mg. Das gereinigte Protein zeigte ein einzelnes Band auf SDS-PAGE bei ~ 21 kDa (Abbildung 1). Volumen der Elution von Gel-Filtration Spalte bestätigt die gereinigten RyR NTD zu einem Monomer (Abbildung 1).

Kristallisation

Ersten Kristallisation in 96-Well Platten screening ergab Kristalle in mehreren Bedingungen. Diese Bedingungen wurden zur Optimierung der Kristall in 24-well-Platten ausgewählt. Der optimale Zustand wo hochwertige Platte Form Kristalle gebildet wurden war 0,1 M HEPES pH 7.0 und 1,6 M Ammoniumsulfat (Abbildung 2).

Strukturaufklärung

Kristalle gewonnen wurde auf 2,84 Å am Strahlrohr BL17U1 in Shanghai Synchrotron Radiation Facility gebeugt. Der Kristall wurde in der Raumgruppe P6 indiziert1 mit Elementarzelle Parameter ein = 170.13, b = 170.13, C = 51.763 Å, α = β = 90,00 °, γ = 120 °. Zur Strukturaufklärung arbeitete mit Kaninchen RyR1 NTD als Suche Modell in PHENIX molekulare Ersatz. Weitere Verfeinerung der Struktur wurde in PHENIX, eine endgültige Rarbeiten und Rfrei von 21,63 und 24.52 % getan. Die Daten sammeln und Verfeinerung Statistiken sind in Tabelle 1aufgeführt. Die gelöste Struktur der DBM RyR NTD für die Rückstände 1-205 (PDB-ID 5Y9V) ist in Abbildung 3dargestellt.

Figure 1
Abbildung 1: SDS-PAGE und Gel Filtration Chromatogramm Vertretung Reinigung von DBM RyR NTD35. SDS-PAGE (15 %) im Einschub zeigt gereinigten DBM RyR NTD als ein single-Band, nachdem die fünfstufige Reinigung Strategie. Die linke Spur zeigt standard Protein-Marker (PM). Das Gel Filtration Chromatogramm unter Verwendung einer Superdex 200 26/600-Spalte zeigt die Elution Peak bei 240 mL, das entspricht der Monomeren Form des Proteins. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Kristallisation von DBM RyR NTD35Kristalle von DBM RyR NTD durch Dampf-Diffusion-Methode erzeugt, wie unter dem Lichtmikroskop sichtbar. Der Kristallisation Zustand war 0,1 M HEPES pH 7.0 und 1,6 M Ammoniumsulfat. Maßstabsleiste = 200 µm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Struktur der DBM RyR NTD (PDB ID 5Y9V)35Struktur des Proteins aus zwei Ansichten gezeigt gelöst. Elemente der Sekundärstruktur sind beschriftet. Β-Stränge sind in lila angezeigt. Α-Helix und eine 310 Helix werden blau dargestellt. Schleifen werden in weiß angezeigt. NT und Ct sind die N-terminale und das C-terminale des Proteins, beziehungsweise. Bitte klicken Sie hier für eine größere Version dieser Figur.

Tabelle 1: Daten sammeln und Verfeinerung Statistiken für DBM RyR NTD Kristall35. Klicken Sie hier, um diese Tabelle herunterzuladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In diesem Artikel beschreiben wir das Verfahren um rekombinant express, reinigen, kristallisieren und bestimmen die Struktur der DBM RyR NTD. Für die Kristallisation ist eine entscheidende Voraussetzung um Proteine mit hohen Löslichkeit, Reinheit und Homogenität zu erhalten. In unserem Protokoll haben wir pET-28a-HMT Vektor verwenden, denn es enthält ein Hexahistidine Tag und MBP-Tag, die genutzt werden könnte, für Reinigung, eine höhere Falte Reinheit zu erhalten. Darüber hinaus die MBP-Tag hilft in der Löslichkeit des Zielproteins. Wir das Protein durch fünf aufeinanderfolgenden Schritten das Protein geführt, die sehr reine und für Kristallisation wurde gereinigt. Kristallisation Screening erfolgte mittels automatisierter Liquid handling-System. Im Vergleich zu herkömmlichen Screening von Drop-manuelle Einstellung, automatisiertes System nutzt sehr kleine Volumen der Probe, spart Zeit und Energie. Es verbessert auch die Reproduzierbarkeit aufgrund der Genauigkeit der Handhabung von Flüssigkeiten. Kristalle wurden im eigenen Haus für Screening und Synchrotronstrahlung für die Datenerfassung gebeugt wie Röntgen mit höherer Intensität und weniger Divergenz, freuen Sie sich dabei hohe Datenqualität nachgeben. Molekulare Ersatz war unsere erste Wahl, da ähnliche strukturelle Vorlagen in der Datenbank vorhanden waren. Der alternative Weg ist mit experimentellen phasing, einschließlich MAD, SAD, MIR, etc.

Während die Struktur der DBM RyR NTD, gewonnenen Xtriage30 Matthews-Koeffizienten zu lösen vorgeschlagen, dass die asymmetrische Einheit (ASU) wahrscheinlich vier Monomeren mit 46 % Lösungsmittel Inhalte enthalten, hat eine Wahrscheinlichkeit von 49 %. Jedoch nicht die richtige Lösung mit vier Moleküle in ASU gefunden. Nachfolgende Ausführungen zu zwei, drei, fünf, sechs Moleküle suchen auch nicht. Schließlich fanden wir die richtige Lösung mit nur einem Molekül in ASU, hat nur 4 % Wahrscheinlichkeit und über 86 % Lösemittelanteil. Des hohen Wasseranteils wurde bestätigt, nachdem wir die Struktur gelöst. Somit ist der extrem hohen Lösemittelanteil abhängig von dem inneren Weg in welche Protein-Packs vorhanden.

Obwohl Röntgen-Kristallographie ein Goldstandard in der Strukturaufklärung von Proteinen ist, sind Proteine mit großen Störung oder flexible Regionen und einige große Proteinkomplexe mit schwachen Affinität schwierig um zu kristallisieren. Protein-engineering-Methoden, einschließlich der Schleife-abschneiden, Oberfläche Entropie Verringerung und Vernetzung, die Chance auf bessere Proteinkristallen verbessern könnte. Neben der Aufspürung der hochauflösenden Proteinstrukturen können Röntgen-Kristallographie auch die Protein-Pestizid-Interaktionen zu untersuchen, die uns, auf Struktur-basierte Pestizid-Design helfen würde verwendet werden. Qi Et Al. fanden, dass verschiedene Familien von Diamides an verschiedene Standorte binden könnte, die über Arten36unterscheiden. Mit unserer Strategie, kann die RyR Strukturen aus mehreren Arten zu bestimmen und die einzigartige Elemente verantwortlich für die beobachteten Artspezifität identifizieren. Insgesamt kann dieses Protokoll für Ausdruck, Reinigung, Kristallisation und Struktur Bestimmung von Proteinen oder Protein Domänen alleine oder im Komplex mit kleinen Molekül-Drogen angepasst.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgements

Die Finanzierung dieser Forschung von zur Verfügung gestellt wurde: National Key Research und Development-Programm aus China (2017YFD0201400, 2017YFD0201403), National Nature Science Foundation of China (31320103922, 31230061) und Projekt des nationalen Grundlagenforschung (973) Programm der China (2015CB856500, 2015CB856504). Wir sind dankbar für das Personal auf das Strahlrohr BL17U1 bei Shanghai Synchrotron Radiation Facility (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics