CRISPR-mediert genomet redigering av Human Fungal patogen Candida albicans

* These authors contributed equally
Genetics
 

Summary

Effektiv genomet engineering av Candida albicans er avgjørende for å forstå den patogenesen og utvikling av therapeutics. Her beskrev vi en protokoll for å raskt og nøyaktig redigere C. albicans genomet bruker CRISPR. Protokollen lar etterforskerne å introdusere en rekke genetiske modifikasjoner inkludert punkt mutasjoner, innsettinger og slettinger.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Denne metoden beskriver effektiv CRISPR mediert genomet redigering av diploide menneskelige fungal patogen Candida albicans. CRISPR-mediert genomet redigering i C. albicans krever Cas9, guide RNA og reparere mal. En plasmider uttrykke en gjær codon optimalisert Cas9 (CaCas9) har blitt generert. Guide sekvenser direkte oppstrøms fra en PAM nettsted (NGG) samsvarer i Cas9 uttrykk vektor. Reparasjon mal deretter laget av primer utvidelse i vitro. Cotransformation reparasjon mal og vektor i C. albicans fører til genomet redigering. Avhengig av reparasjon malen du bruker, kan etterforskeren introdusere nukleotid endringer, innsettinger eller slettinger. C. albicans er en diploide, er mutasjoner laget i begge alleler med et forutsatt at A og B alleler ikke havn SNPs som forstyrrer guide målretting eller reparere mal innlemmelse. Multimember gene familier kan redigeres i parallell hvis egnet bevarte sekvenser finnes i alle familiemedlemmer. C. albicans CRISPR systemet beskrevet er flankert av FRT nettsteder og koder flippase. På induksjon av flippase fjernes den antibiotika markør (CaCas9) og guide RNA fra genomet. Dette gjør at etterforsker utføre etterfølgende endringer i genomet. C. albicans CRISPR er en mektig sopp genteknologi verktøyet, og mindre endringer beskrevet protokollene tillater endring av andre fungal arter inkludert C. glabrata, N. castellii, og S. cerevisiae.

Introduction

Candida albicans er den mest utbredte human fungal patogen1,2,3. Forstå forskjellene mellom C. albicans og pattedyr molekylær biologi er avgjørende for utviklingen av den neste generasjonen av soppdrepende therapeutics. Dette krever etterforskerne å raskt og nøyaktig genetisk manipulere C. albicans.

Genetisk manipulering av C. albicans har historisk vært utfordrende. C. albicans opprettholde ikke plasmider, dermed alle konstruksjoner må innarbeides i genomet. Videre er C. albicans diploide; Derfor når ut et gen eller innføre en mutasjon, er det viktig å sikre at har begge kopier vært endrede4. I tillegg er noen C. albicans loci heterozygote, ytterligere kompliserende genetisk avhør5. For å genetisk manipulere C. albicans, er det vanlig å utføre flere runder med homologe rekombinasjon6. Diploide natur genomet og arbeidskrevende konstruere utvikling har gjort dette en potensielt langtekkelig prosess, spesielt hvis flere endringer er nødvendige. Disse begrensningene og medisinsk betydningen av C. albicans krever utvikling av nye teknologier at etterforskerne å lettere manipulerer C. albicans genomet.

Gruppert regelmessig interspaced kort palindromic gjentar (CRISPR)-mediert genomet redigering er et kraftig verktøy som tillater forskere å endre rekkefølgen på et genom. CRISPR krever tre komponenter: 1) i Cas9 nuclease som innstiftet målet DNA, 2) en 20 base guide RNA som mål Cas9 sekvensen av interesse, og 3) reparasjon mal DNA som reparerer webområdet cleavage og inkorporerer beregnet endre7, 8. Når guiden bringer Cas9 målet Genova orden, Cas9 krever en protospacer tilstøtende motiv (PAM) sekvens (NGG) direkte oppstrøms av guide sekvensen deler DNA9. Kravet for både 20 base guide og PAM sekvenser gir en høy grad av målretting spesifisitet og begrenser off-målet cleavage.

CRISPR systemer er utformet for å redigere genomer av ulike organismer og takle en rekke problemer10. Beskrevet her er en fleksibel og effektiv CRISPR protokoll for redigering en C. albicans genet av interesse. Eksperimentet introduserer en stopp codon til et gen, forårsaker oversettelse oppsigelse. Andre endringer gjøres avhengig av malen reparasjon, som er innført. Et fragment merket med nourseothricin (Natr) som inneholder gjær codon-optimalisert Cas9 (CaCas9) og en guide RNA er innlemmet i C. albicans genomet på et nøytralt område. Cotransformation med malen reparasjon koding ønsket mutasjon fører til reparasjon av spalting av homologe rekombinasjon og effektiv genomet redigering. Beskrevet nedenfor er redigering av TPK2, men alle C. albicans åpne lesing rammer kan være målrettet flere ganger av CRISPR. CRISPR systemet er flankert av FRT nettsteder og kan fjernes fra C. albicans genomet av induksjon av flippase kodet på CaCas9 uttrykk plasmider. C. albicans CRISPR systemet gjør det mulig for etterforskere raskt og nøyaktig redigere C. albicans genomet11,12.

Protocol

1. identifikasjon og kloning av Guide RNA

  1. Identifikasjon av guide RNA sekvens
    1. Identifisere en 5'-NGG-3 "PAM sekvens nær der stopp codon settes. (Figur 1A) Merket finnes alle PAM sekvenser i første 100 base parene av TPK2 (figur 1A).
      Merk: Guide sekvenser målretting hver C. albicans åpent lesing ramme kan finnes på http://osf.io/ARDTX 11,12.
    2. Identifisere frem Guide Primer_3 sekvensen, som vil være 20 baser direkte oppstrøms en NGG Pam området og ikke inneholder mer enn 5 Ts på rad. Venstreklikk på basen direkte oppstrøms av NGG og dra markøren 20 baser, venstreklikk på kategorien primer til primer.
    3. Identifisere reversere Guide Primer_3 sekvensen, som vil være et supplement til frem Guide sekvensen.
      Merk: Vises guider som bruker PAM_3 (figur 1B).
    4. Høyreklikk primer og velg "Kopier primer data". Lim inn sekvenser i et tekstredigeringsprogram.
  2. Legge til overheng sekvenser fremover og reversere Guide oligos å lette kloning (tabell 1, figur 1B).
    1. Legge til nukleotid rekkefølgen ATTTG 5' slutten av den frem Guide Primer_3 før du kjøper.
    2. Legge til G 3 slutten av den frem Guide Primer_3 før du kjøper.
    3. Legge til nukleotid rekkefølgen AAAAC 5' slutten av omvendt Guide Primer_3 før du kjøper.
    4. Legge til C 3 slutten av omvendt Guide Primer_3 før du kjøper.
  3. Ufullstendig CaCas9 uttrykk vektor pV1524 med BsmBI.
    Merk: pV1524 inneholder en ampicillin (Ampr) og nourseothricin (Natr) markører. Cas9 har vært codon-optimalisert for C. albicans.
    1. Fordøye plasmider ved å legge til: 2 μg av pv1524, 5 μL 10 x Buffer, 1 μL BsmBI og H2O til 50 μL i en 1,5 mL tube. Inkuber ved 55 ° C i 20 min. (eventuelt fordøye pv1524 i 15 min med Esp3I, en isoschizomer av BsmBI, på 37 ° C.)
    2. Kul til romtemperatur (RT) og spinn for 30 s 2,348 x g å få kondens til bunnen av røret. Fortsett til trinn 1.4 eller lagre den fordøyde plasmider på 20 ° C.
  4. Fosfatase behandle fordøyd ryggraden.
    1. Tilsett 1 μL av kalv intestinal fosfatase (CIP) fordøyelsen blandingen og ruge ved 37 ° C i 1 time.
    2. Rens fordøyd plasmider ved hjelp av en kommersielt tilgjengelig polymerase kjedereaksjon (PCR) rensing kit (instruksjonene med kit) og elute det i 30 μL elueringsbufferen (EB).
  5. Phosphorylate og anneal frem Guide Primer_3 og omvendt Guide Primer_3.
    1. Legge til 0,5 μL 100 μM frem Guide Primer_3, 0,5 μL 100 μM reversere Guide Primer_3, 5 μL 10 x T4 ligase buffer, 1 μL T4 polynucleotide kinase og 43 μL H2O slik PCR.
    2. Legge til 5 μL 10 x T4 ligase buffer og 1 μL T4 polynucleotide kinase 44 μL molekylærbiologi-klasse H2O i et andre PCR-rør.
      Merk: Dette vil tjene som kontrollen negative.
    3. Inkuber reaksjon blandinger i en thermocycler ved 37 ° C i 30 minutter, deretter til 95 ° C i 5 minutter.
    4. Avkjøle blandingen på tregeste rampen rate til 16 ° C til anneal, oligos. Plass glødet oligo blandingen på 4 ° C.
  6. Ligate de glødet oligos i fordøyd pv1524 fra trinn 1.4.3.
    1. Legg til følgende slik PCR: 1 μL 10 x T4 ligase buffer, 0,5 μL T4 DNA ligase, 0,5 μL glødet oligo mix, fordøyd CIP-behandlet renset plasmider (20-40 ng) og H2O til et 10 μL totalt volum.
    2. Legg til følgende slik PCR: 1 μL 10 x T4 ligase buffer, 0,5 μL T4 DNA ligase, fordøyd CIP-behandlet renset vektor (20-40 ng), 1 μL negativ kontroll blanding og H2O til et 10 μL totalvolum.
    3. Inkuber både rør i en thermocycler på 16 ° C i 30 min, så ved 65 ° C i 10 min, deretter avkjøles til 25 ° C.
  7. Forvandle kjemisk kompetent Escherichia coli DH5α bruker en standard varme sjokk transformasjon protokoll 5 μL ligation blandinger. Velg LB Amp/Nat media (200 μg/mL Amp, 50 μg/mL Nat).
    Merk: Unnlatelse av å velge pV1524 og dets derivater på dobbel valg-media vil resultere i tap av Nat/CaCas9/guide modul av FLP/FRT excision i bakterier.
  8. Rense plasmider fra fire transformants ved miniprep, og sekvens innsettingspunktet rekken med sekvensering primer (tabell 1).
    Merk: Mesteparten av tiden, sekvensering 4 transformants er tilstrekkelig til å identifisere minst 1 riktig klone.
  9. Lagre plasmider som har guide RNA sekvensen klonet en eneste gang i BsmBI kuttet område på 20 ° C.

2. utforming og generasjon av reparasjon mal

  1. Sette inn en stopp codon venstreklikke i genet sekvensen og legge nukleotider som koder et stopp codon og begrensning fordøyelsen område (figur 1 ctabell 1).
    Merk: Innsetting vil forstyrre PAM sekvensen.
    Merk: En begrensning fordøyelsen området inkluderes i reparasjon mal sekvensen til rette for effektiv screening av kloner (figur 1 c).
  2. Venstreklikk 10 baser nedstrøms av hvor mutasjon gjøres og dra markøren 60 baser oppstrøms. Venstreklikk på kategorien primer til primer. Dette vil legge reparasjon mal Forward_3. Venstreklikk 10 baser oppstrøms av hvor mutasjon gjøres og dra markøren 60 baser nedstrøms. Venstreklikk på kategorien primer til primer. Dette vil legge reparasjon mal reversere 3. (Figur 1 c)
  3. Utføre primer forlengelsen å generere malen reparasjon.
    1. Tilsett 1,2 μL av 100 μm reparasjon mal frem primer, 1,2 μL 100 μm reparasjon mal omvendt primer, 6 μL deoxynucleotide triphosphates (dNTPs) (totalt konsentrasjon 40 mM), 6 μL buffer, 0,6 μL Taq utvalg (3 enheter) og 45 μL H2O til hver av de 4 PCR rør.
    2. Utføre primer forlengelse kjører mellom 20 og 30 runder PCR. Eksempel utvidelse forhold: 2 minutter til 95 ° C (30 s på 95 ° C, 1 min ved 50 ° C, 1 min på 68 ° C) x 34, 10 min på 68 ° C.
    3. Kombinere innholdet i alle 4 PCR rør i en 1,5 mL tube og bruker en PCR rensing kit for å rense produkter i 50 μL av H2O.
    4. Quantitate primer utvidelse produkter for å sikre tilstrekkelig DNA ved å bestemme absorbansen på 260 nm.
      Merk: Typisk siste konsentrasjonen av primer utvidelse produktet er ~ 200-300 ng/µL.

3. transformasjon av C. albicans reparasjon mal og plasmider

  1. Gjøre TE/litium acetate.
    1. Bland 10 mM Tris-Cl, 1 mM EDTA, 100 mM litium acetate og H2O (alle lagerløsning pH 7.5) å oppnå 50 mL totalt volum.
  2. Gjøre PLATE
    1. Bland 40% pinne 3350, 100 mM litium acetate, 10 mM Tris-Cl, 1 mM EDTA og H2O (alle lagerløsning pH 7.5) for å oppnå 50 mL totalt volum.
  3. Fordøye riktig klonet plasmider fra trinn 1.9.
    1. Legg 10 μg plasmider, 4 µL 10 x bufferen, 0.4 µL av 10 mg/mL bovin serum albumin (BSA), 0,5 µL av KpnI 0,5 µL av SacI og H20 til 40 µL totalt volum i en 1,5 mL tube. Ruge på 37 ° C over natten (figur 1 d).
  4. Vokse en overnatting kultur av C. albicans SC5314, vill-type prototroph, ved 25 ° C i gjær pepton druesukker supplert med 0,27 mM Uridine (YPD + Uri), ideelt OD600 mindre enn 6.
    1. Pellets 5 OD600 enheter av celler per transformasjon av snurrende etter 5 min på 2,348 x g og suspendere 5 OD600 pelleted celleområde i 100 µL TE/litium acetate.
  5. Legge til følgende en 1,5 mL tube rekkefølgen: 1) 100 µL av celler fra trinn 3.4.1, 2) 40 µL av kokt og rask-avkjølt laks sæd DNA (10 mg/mL), 3) 10 µg plasmider fordøyelsen fra trinn 3.3.1, 4) 6 µg renset reparasjon mal og 5) 1 mL av platen.
  6. Legge til følgende en 1,5 mL tube rekkefølgen: 1) 100 µL av celler, 2) 40 µL av kokt og rask-avkjølt laks sæd DNA (10 mg/mL), 3) H2O volumet for transformere DNA i trinn 3,5 og 4) 1 mL av platen.
    Merk: Dette vil tjene som en negativ kontroll.
  7. Bland transformasjonene forsiktig av pipettering og la ruge ved 25 ° C over natten.
  8. Varme sjokk cellene ved å plassere dem i en 44 ° C vannbad for 25 min.
  9. Spinn for 5 min på 2,348 x g i en Borstemmaskin sentrifuge og fjerne PLATE blandingen supernatant. Vask en gang ved å legge 1 mL av YPD + Uri og sentrifuger igjen for 5 min på 2,348 x g.
  10. Suspendere cellene i 0,1 mL YPD + Uri og ruge på Berg trommelen eller shaker ved 25 ° C over natten.
  11. Platen på YPD + Uri med 200 μg/mL nourseothricin. Kolonier vises i 2-5 dager.

4. striper for enkel kolonier

  1. Dele en 100 mm x 15 mm Petriskål i kvartaler, og merk hver kvadrant.
    1. Trykk en av koloniene fra transformasjon platen med en bakteriefri tannpirker eller applikatoren og strek over den lengste siden av kvadranten.
    2. Strek for enkelt kolonier ved hjelp av en steril teknikk og la koloniene å vokse til 30 ° C i 2 dager.

5. kolonien PCR

  1. Design frem av primer (FCP) ~ 200 base parene oppstrøms av begrensning området som ble innført og omvendt av primer (RCP) ~ 300 base parene nedstrøms.
    1. Legge til 0,3 μL FCP, 0,3 μL RCP, 0,3 μL thermostable utvalg (ExTaq 1.5 enheter), 3 μL dNTPs (totalt konsentrasjon 40 mM), 3 μL ExTaq Buffer og 23 μL H2O slik 1,5 mL.
      Merk: Tillegg av 0,5 μL/reaksjon dimethyl sulfoxide (DMSO) kan forbedre PCR effektivitet.
    2. Tilsett 0,25 μL av en enkelt gjær koloni fra trinn 4.1.2 til blanding fra trinn 5.1.1, bruker en P10 pipette tips og ta vare ikke for å forstyrre agar.
    3. Forsterke DNA av PCR og kjøre 5 μL av PCR på en gel å sikre forsterkning er vellykket, ta vare ikke for å forstyrre celle pellet nederst på røret.

6. begrensning fordøyelsen av kolonien PCR

  1. Legge til 10 μL PCR produkt (ta vare ikke å ikke forstyrr celle pellet nederst på røret), 3 μL buffer, 1 μL begrensning enzym og 16 μL H2O, deretter ruge i henhold til produsentens instruksjoner og løse på en agarose gel å identifisere valgt CT genomet redigeringer.
    Merk: Begrensning enzymet her er webområdet kodet i malen TPK2 bestemt reparasjon.

7. lagre stammer

  1. Vokse en overnatting kultur fra koloniene er bekreftet av begrensning fordøyelse i YPD + Uri på 30 ° C.
  2. Legge 1 mL av kultur og 1 mL av 50% glyserol (bringe siste konsentrasjonen av glyserol 25%) slik egnet for lagring på-80 ° C.
  3. Lagre riktig kloner på-80 ° C.
    Merk: Riktig bakteriestammer kan lagres ved-80 ° C i mange år.

8. fjerning av Natr markør

  1. Strek riktig transformant på gjær pepton maltose (YPMaltose) (2% maltose).
  2. Velg en koloni fra stripete platen og kultur gjær for 48 h på 30 ° C i flytende YPMaltose 20 finans maltose.
  3. Plate 200-400 celler i YPMaltose 20 finans maltose og ruge på 30 ° C i 24 timer.
  4. Gjenskape platen på YPMaltose og YPMaltose 200 μg/mL Nat.
  5. Ruge på 30 ° C i 24 timer.
    Merk: Koloniene som ikke lenger vokser på YPMaltose 200 μg/mL nourseothricin men vokser på YPMaltose har mistet Natr markøren (CaCAS9) og guide RNA.
  6. Lagre stammene som har mistet den Natr markør (CaCAS9) og guide RNA som gjort i fremgangsmåten 7.1-7.3.
    Merk: En lignende plasmider, pV1393, bruker SAP2 i motsetning til en MAL2 -utbyggeren. Vekst på YCB-BSA vil indusere flippase og fjerning av Natr hvis pV1393 brukes for genet redigering.

Representative Results

Sekvenser av guide RNAs og reparasjon maler som målretter C. albicans TPK2, en c-AMP kinase katalytisk delenhet, ble utformet i henhold til retningslinjene som foreslått ovenfor. Sekvenser vises i (tabell 1, figur 1). Guide RNAs ble klonet i CaCas9 uttrykk vektorer og cotransformed med reparasjon mal i vill-type C. albicans. En EcoRI begrensning fordøyelsen nettsted og stopp kodon i malen reparasjon forstyrre området PAM og Letter screening for riktig mutanter (figur 1). Transformants var stripete for enkelt kolonier og vist av kolonien PCR og begrensning fordøyelsen for inkorporering av malen reparasjon (figur 2). Begrensning fordøyelsen skiller raskt vill-type fra mutant sekvenser.

Oligonucleotide navn Oligonucleotide orden
Fremover Guide Primer_3 ATTTGgggtgaactatttgttcgccG
Omvendt Guide Primer_3 AAAACggcgaacaaatagttcacccC
Reparasjon mal Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Reparasjon mal Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Frem av Primer ttaaagaaacttcacatcaccaag
Omvendt av Primer actttgatagcataatatctaccat
Sekvensering Primer ggcatagctgaaacttcggccc

Tabell 1: liste over oligo nukleotider brukes for denne studere. Webområder lagt til for kloning formål er aktivert og uthevet i guide primer sekvenser. Sekvenser i malen reparasjon som mutere genomisk DNA er aktivert og uthevet.

Figure 1
Figur 1 : Diagram av guide RNA og reparasjon malutforming. (A) merking av alle PAM sekvenser i de første 100 nukleotider i TPK2. PAM forløp 3 (PAM_3) er merket, som det er sekvensen brukt i denne studien. (B) Guide RNA designet PAM_3. 20 base primere utformet med SnapGene er små og blå. Ekstra baser kreves for kloning er små og grønne vises forskjøvet. (C) reparasjon mal primere som sett TAA stopp codon EcoRI området settes inn i TPK2 lesing frame. DNA som er forskjellig fra vill-type sekvensen er rødt og store. (D) eksempel på hvordan en veiledningen på den positive stranden DNA ved hjelp av PAM_4. (E) skjematisk diagram over pV1524 etter kloning av guide RNA og fordøyelsen med KpnI og SacI. Neut5L-5' og Neut5L-3' mål vektoren til webområdet Neut5L i C. albicans genomet. CaENO1p er utbyggeren som driver uttrykk for gjær-optimalisert CaCas9. NATr er nourseothricin motstand kassetten. CaSNR52p er utbyggeren kjører guide RNA uttrykk (sgRNA). FRT nettsteder er kløyvde og saman av flippase (FLP) fjerne CRISPR kassetten på flippase uttrykk. En skjematisk lik (E) ble utgitt av Vyas et al. 11. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Introduksjon og bekreftelse av en stopp codon og EcoRI begrensning området TPK2. Primere brukt for forsterkning er oppført i tabell 1. Vill-type og mutant sekvenser er vist nedenfor gel. Dette tallet er endret fra Vyas et al.11. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Tegneserie beskrivelse av reparasjon maler som vil generere (A) slettinger og (B) innsettinger. Grå streker i (A) skildrer mellomliggende sekvenser finnes ikke i reparasjon mal primerne. Klikk her for å se en større versjon av dette tallet.

Discussion

C. albicans CRISPR effektivt redigerer C. albicans genomet. pV1524 koder en gjær codon-optimalisert Cas9 og er utformet slik at etterforskerne kan lett klone guide RNA sekvenser nedstrøms CaSNR52 promoter (figur 1)11. Det må sikres at bare en enkelt kopi av guide sekvensen er blitt klonet i CaCas9 uttrykk vektorer av sekvensering, ekstra kopier vil hindre genomet redigering. Hvis flere kopier av guiden er innført konsekvent, bør en lavere konsentrasjonen av glødet guiden brukes i hemorroider. Vektor og protokoll beskrevet tillater målretting av noen C. albicans genet. Selv om C. albicans diploide, er bare en enkelt transformasjon nødvendig mot både alleler med et. Videre kan processive natur CRISPR-CaCas9 genomet redigering forskere å målrette flere medlemmer av genet familier. Mange genet familier som utskilles aspartyl proteaser (TJENESTETILGANG) og agglutinin-lignende sekvens proteiner (ALS) er viktig for C. albicans virulens. CRISPR genomet redigering vil lette etterforskningen av familiene genet.

Protokollene beskrevet ovenfor introdusere en stopp codon til et åpent lesing ramme, noe som resulterer i fenotypiske tilsvarer null (figur 2). En rekke genetisk alternations kan gjøres ved å variere malen reparasjon. Tull, eks. missense og stille mutasjoner kan settes via rekombinasjon med en passende reparasjon mal. Innlemmelse av en begrensning nettsted effektiviserer transformant screening, som de uten må bli vist av sekvensering12,13. I tillegg kan C. albicans CRISPR forskere å generere innsettinger og slettinger, noe som gjør det til et ideelt system for å sette inn affinitet koder, utføre promotor bytteavtaler og generere fortrenging (Figur 3). Screening for riktig transformants for disse mutasjoner er mer arbeidskrevende, som må sekvens endringene for å bekrefte riktig innlemmelse av reparasjon maler. Videre kan sørlige klatt være nødvendig å sikre flere kopier av et gen ikke er satt inn på flere steder i genomet. Kravet til webområdet NGG PAM plasserer små begrensninger på regionene i genomet som kan målrettes. Utvikling av alternative CRISPR systemer som bruker alternative nucleases som Cpf1 eller variasjoner på Cas9 systemet har/vil lindre mange av disse begrensningene14. Den etterforskere vet på dette tidspunktet, er disse systemene ikke ennå brukt til C. albicans.

CRISPR systemet beskrevet i over protokollen er utviklet slik at det kan brukes i en rekke arter inkludert Saccharomyces cerevisiae, Naumouozyma castelliiog human patogen Candida glabrata11 . Transformasjon og effektiv redigering av disse gjær krever små endringer beskrevet protokollen, men rammeverket for redigering disse alternative genomer er bemerkelsesverdig lik som på C. albicans12. Videre gjær gir en utmerket mekanisme for å utvikle genomet redigering prosedyrer. I gjær, når ADE2 er muterte, akkumulert en forløper til adenine biosyntesen stien, snu cellene rød. Denne lett observerbare fenotypen lar etterforskerne å identifisere redigerte celler og raskt feilsøke genomet redigere protokoller. Kombinert med omfattende molekylærbiologi verktøykassen tilgjengelig for sopp, har protokoller for redigering mange gjær arter vært utviklet15,16. Så bredt program av genomet redigering teknologi i sopp har potensiale til betydelig innvirkning en rekke vitenskapelige disipliner.

CRISPR har mye bedre effektiviteten genomet tekniske C. albicans, men hittil CRISPR ikke har vært brukt til å utføre genomet bredt skjermer i C. albicans. Gjeldende protokoller krever en reparasjon mal å innføre mutasjoner, som nonhomologous slutten med veien i C. albicans er ineffektiv12. Generering av reparasjon mal oligos for hver genet er en vesentlig barriere til gjennomføring av genomet hele skjermer. Av reduserte kostnadene ved DNA-syntese og avanserer til CRISPR teknologi vil gjøre utviklingen av sletting biblioteker mer gjennomførbart. For eksempel, baner uttrykk for en reparasjon mal fra CaCas9 vektoren vei for utvikling av bærekraftig plasmider biblioteker som målretter hver genet11. Videre er forbigående Candida CRISPR protokollene som ikke krever CaCas9 uttrykk vektor inkludere i C. albicans genomet utviklet17. I tillegg økte guide uttrykk øker genomet redigering effektivitet18. Disse og andre fremskritt til CRISPR teknologier, er avgjørende for utviklingen av genomet hele skjermer i C. albicans19,20,21,22.

C. albicans genomet er diploide, men A og B alleler er ikke alltid identiske5. Slike heterozygosity gir både utfordringer og muligheter. Hvis en mål å mål begge alleler, må en PAM nettstedet guide sekvens og reparasjon mal som vil fungere på begge kopier av genet brukes. Imidlertid kan avhengig av single nukleotid polymorfismer i et gen, C.albicans CRISPR systemet etterforskerne å målrette en enkelt allelet. Så presisjon har potensial til å tillate etterforskere undersøke funksjonelle forskjeller mellom alleler. Målretting bestemte alleler må gjøres nøye, som tap av heterozygosity (LOH) på en allelet eller en hel kromosom har blitt observert. Når du redigerer én C. albicans alleler, en må undersøke tilstøtende DNA-sekvenser for å fastslå om en klone har opprettholdt en diploide SNP-profil. I tillegg off-målet effekter er ganske lav for C. albicans CRISPR, men hele genomet sekvensering kan bli vurdert for viktige stammer.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Forfatterne takker Dr. Gennifer Mager for lesing og nyttige kommentarer på manuskriptet. Dette arbeidet ble støttet av Ball State University laboratorium oppstart midler og NIH-1R15AI130950-01 til D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics