Mediada por CRISPR genoma edição do patógeno humano fungo Candida albicans

* These authors contributed equally
Genetics
 

Summary

Engenharia de genoma eficiente de Candida albicans é fundamental para compreender a patogênese e o desenvolvimento de terapêuticas. Aqui, descrevemos um protocolo para rápida e precisa editar o genoma de c. albicans usando CRISPR. O protocolo permite que os investigadores introduzir uma ampla variedade de modificações genéticas, incluindo mutações pontuais, inserções e exclusões.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Este método descreve o genoma CRISPR mediada eficiente edição do patógeno fúngico humano diploide Candida albicans. Mediada por CRISPR genoma edição em c. albicans requer Cas9, guia de RNA e reparar o modelo. Um plasmídeo expressando um codão de levedura otimizado Cas9 (CaCas9) foi gerado. Guia de sequências montante diretamente de uma PAM local (NGG) são clonados no vetor de expressão Cas9. Um modelo de reparação, em seguida, é feito pela cartilha extensão em vitro. Cotransformation do modelo de reparação e vector em c. albicans leva à edição de genoma. Dependendo do modelo de reparação usado, o investigador pode introduzir mudanças de nucleotídeos, inserções ou exclusões. Como c. albicans é um diploides, mutações são feitas em ambos os alelos de um gene, desde que os alelos A e B não abriga SNPs que interferem na guia direcionamento ou reparar a incorporação do modelo. Famílias multimember gene podem ser editadas em paralelo se apropriado sequências conservadas existem em todos os membros da família. O sistema de c. albicans CRISPR descrito é ladeado por sites FRT e codifica a flipase. Após a indução de flipase, o marcador de antibiótico (CaCas9) e guia do RNA são removidos do genoma. Isso permite que o investigador realizar edições subsequentes para o genoma. C. albicans CRISPR é uma ferramenta poderosa genética de fungos, e pequenas alterações para os protocolos descritos permitem a modificação de outras espécies de fungos, incluindo c. glabrata, s. castellii e S. cerevisiae.

Introduction

Candida albicans é a mais prevalente patógeno humano fúngica1,2,3. Diferenças de compreensão entre c. albicans e mamíferos biologia molecular é fundamental para o desenvolvimento da próxima geração da terapêutica antifúngica. Isto requer investigadores para ser capaz de rapidamente e com precisão geneticamente manipular c. albicans.

Manipulação genética de c. albicans tem sido, historicamente, desafiador. C. albicans não mantém plasmídeos, assim todas as construções devem ser incorporadas ao genoma. Além disso, a c. albicans é diploide; Portanto, quando bater para fora de um gene ou introduzindo uma mutação, é importante assegurar que ambas as cópias foram alterados4. Além disso, alguns loci de c. albicans são heterozigotos, complicando ainda mais a genética interrogatório5. Para manipular geneticamente c. albicans, é típico para realizar várias rodadas de recombinação homóloga6. No entanto, a natureza diploide do genoma e laboriosa construção desenvolvimento fizeram isto um processo potencialmente tedioso, especialmente se várias alterações são necessárias. Estas limitações e a importância médica de c. albicans exigem o desenvolvimento de novas tecnologias que permitem que os investigadores mais facilmente manipular o genoma de c. albicans .

Agrupados regularmente intercaladas curtas palíndromos repetições (CRISPR)-edição de genoma mediado é uma ferramenta poderosa que permite que os pesquisadores alterar a sequência de um genoma. CRISPR requer três componentes: 1) o Cas9 nuclease que cliva o DNA alvo, 2) 20 base RNA guia que tem como alvo Cas9 a sequência de interesse e 3) reparar o ADN do molde que repara o local de clivagem e incorpora a alteração pretendida7, 8. Uma vez que o guia traz Cas9 para a sequência do genoma de destino, Cas9 requer uma sequência de motivo adjacentes (PAM) de protospacer (NGG) diretamente a montante da sequência guia para clivar o DNA9. A exigência para o 20 base guia e sequências de PAM fornece um alto grau de especificidade de direcionamento e limita a clivagem fora do alvo.

Sistemas CRISPR foram projetados para editar os genomas de um conjunto diverso de organismos e resolver uma grande variedade de problemas10. Descrito aqui é um protocolo CRISPR flexível, eficiente para a edição de um c. albicans gene de interesse. O experimento introduz um códon de parada para um gene, causando a rescisão de tradução. Outras edições podem ser feitas dependendo do modelo de reparação que é introduzido. Um fragmento marcado com nourseothricin (Natr) contendo levedura códon otimizado Cas9 (CaCas9) e um guia do RNA é incorporado no genoma da c. albicans em um local neutro. Cotransformation com o modelo de reparação codificação a mutação desejada leva à reparação da clivagem por recombinação homóloga e eficiente do genoma de edição. Descrito abaixo é a edição de TPK2, mas todas as c. albicans aberta ler frames podem ser direcionados a várias vezes por CRISPR. O sistema CRISPR é ladeado por sites FRT e pode ser removido do genoma de c. albicans por indução de flipase codificado no plasmídeo de expressão CaCas9. O sistema de c. albicans CRISPR permite que os investigadores com precisão e rapidamente editar o genoma de c. albicans 11,12.

Protocol

1. identificação e clonagem de sequência guia RNA

  1. Identificação da guia sequência de RNA
    1. Identificar uma 5'-NGG-3' sequência de PAM perto onde será inserido o códon de parada. (Figura 1A) Rotulado todos PAM sequências encontram os primeiros 100 pares de base de TPK2 (figura 1A).
      Nota: Guia sequências alvo cada frame de leitura aberto de c. albicans podem ser encontradas em http://osf.io/ARDTX 11,12.
    2. Identificar a sequência de Primer_3 de guia para a frente, que será a 20 bases diretamente de um NGG PAM site EPorta não conterá mais de 5 Ts em uma fileira. Botão esquerdo do mouse sobre a base diretamente contra a corrente da NGG e arraste o cursor de 20 bases, em seguida, clique na guia para adicionar a primeira demão de primer.
    3. Identifica a sequência inversa guia Primer_3, que será o complemento para a sequência do guia para a frente.
      Nota: Mostrados são guias que usam PAM_3 (figura 1B).
    4. A primeira demão com o botão direito e selecione "copiar os dados da primeira demão". Cole as sequências em um programa de edição de texto.
  2. Adicione sequências de saliência oligos para diante e reversa guia para facilitar a clonagem (tabela 1, figura 1B).
    1. Adicione a sequência de nucleotídeos ATTTG à extremidade 5' do Primer_3 de guia para a frente antes de comprar.
    2. Adicione G à extremidade 3' do Primer_3 de guia para a frente antes de comprar.
    3. Adicione a sequência de nucleotídeos AAAAC à extremidade 5' da reverter guia Primer_3 antes de comprar.
    4. Adicione C à extremidade 3' da reverter guia Primer_3 antes de comprar.
  3. CaCas9 Digest expressão vetorial pV1524 com BsmBI.
    Nota: pV1524 contém uma ampicilina (Ampr) e nourseothricin (Natr) marcadores. Cas9 tem sido códon otimizado para c. albicans.
    1. Digerir o plasmídeo, acrescentando: 2 μg de pv1524, 5 μL de tampão de 10x, 1 μL de BsmBI e de H2O para 50 μL em um tubo de 1,5 mL. Incubar a 55 ° C por 20 min. (Alternativamente, digerir pv1524 por 15 min com Esp3I, um isoschizomer de BsmBI, a 37 ° C.)
    2. Fixe a temperatura ambiente (RT) e rotação para 30 s a 2.348 x g para trazer a condensação no fundo do tubo. Prossiga para a etapa 1.4 ou armazenar o plasmídeo digerido a-20 ° C.
  4. A espinha dorsal digerida fosfatase-deleite.
    1. Adicionar 1 μL de fosfatase intestinal do bezerro (CIP) para a mistura de digestão e incubar a 37 ° C, durante 1 h.
    2. Purificar o plasmídeo digerido usando um kit de purificação de reação em cadeia (PCR) comercialmente disponível do polymerase (as instruções fornecidas com o kit) e Elui-lo em 30 μL de tampão de eluição (EB).
  5. Fosforilar e recoze frente guia Primer_3 e reverter guia Primer_3.
    1. Adicionar 0,5 μL de 100 μM em frente guia Primer_3, 0,5 μL de 100 μM reverter guia Primer_3, 5 μL de tampão, ligase x T4 10, 1 μL da quinase de polinucleotido T4 e 43 μL de H2O para um tubo PCR.
    2. Adicione 5 μL de tampão, ligase x T4 10, 1 μL da quinase de polinucleotido T4 e 44 μL de biologia molecular-classe H2O, em um segundo tubo PCR.
      Nota: Isto servirá como controlo negativo.
    3. Incube as misturas de reação em um thermocycler a 37 ° C por 30 min, em seguida a 95 ° C por 5 min.
    4. Arrefecer a mistura à taxa de rampa mais lento a 16 ° C para recozer os, oligos. Em seguida, coloque a mistura de oligo recozido a 4 ° C.
  6. Ligam os oligos recozido em digerido pv1524 da etapa 1.4.3.
    1. Adicione o seguinte para um tubo PCR: 1 μL de tampão de ligase x T4 10, 0,5 μL de T4 DNA ligase, 0,5 μL de mistura de oligo recozido, digerido CIP-tratados purificado do plasmídeo (20 – 40 ng) e H2O para um volume total de 10 μL.
    2. Adicione o seguinte para um tubo PCR: 1 μL de tampão, ligase 10 x T4, 0,5 μL de T4 DNA ligase, digerido vector purificada CIP-tratados (20 – 40 ng), 1 μL de mistura de controlo negativo e H2O até um volume total de 10 μL.
    3. Incubar ambos os tubos em um thermocycler a 16 ° C por 30 min, em seguida, a 65 ° C por 10 min, em seguida, fixe a 25 ° C.
  7. Transforme quimicamente competentes Escherichia coli DH5α usando um protocolo de transformação de choque de calor padrão 5 μL da mistura da ligadura. Selecione na mídia LB Amp/Nat (200 μg/mL Amp, Nat de 50 μg/mL).
    Nota: Para selecionar o pV1524 e seus derivados na mídia de seleção dupla resultará em perda de módulo Nat/CaCas9/guia por excisão FRT/FLP em bactérias.
  8. Purificar os plasmídeos de quatro transformants por miniprep e sequência da sequência de inserção com primer de sequenciamento (tabela 1).
    Nota: Na maioria das vezes, sequenciamento 4 transformants é suficiente para identificar pelo menos 1 clone correto.
  9. Salvar o plasmídeo que têm a sequência de RNA guia clonada uma única vez para o BsmBI corte local a-20 ° C.

2. concepção e geração de modelo de reparação

  1. Inserir um codão stop clicar na sequência do gene e adicionando nucleotídeos que codificam um stop códon e restrição digestão site (Figura 1tabela 1).
    Nota: A inserção irá interromper a sequência de PAM.
    Nota: Um site de digestão de restrição será incluído na sequência de modelo de reparação para facilitar a triagem eficiente dos clones (Figura 1).
  2. Clique esquerdo 10 bases a jusante de onde será feita a mutação e arrastar que o cursor 60 bases contra a corrente. Clique na guia para adicionar a primeira demão de primer. Isto irá adicionar reparação modelo Forward_3. Clique esquerdo 10 bases montante de onde será feita a mutação e arrastar que o cursor 60 bases a jusante. Clique na guia para adicionar a primeira demão de primer. Isto irá adicionar reparação modelo inverter 3. (Figura 1)
  3. Realize a extensão da primeira demão para gerar o modelo de reparação.
    1. Adicionar 1,2 μL de 100 μm reparação modelo para a frente da primeira demão, 1,2 μL de 100 μm reparação modelo reverso da primeira demão, 6 μL de deoxynucleotide trifosfatos (dNTPs) (total concentração 40 mM), 6 μL de tampão, 0,6 μL da Taq polimerase (3 unidades) e 45 μL de H2O para cada um dos 4 PCR tubos.
    2. Realizar a extensão da primeira demão executando entre 20 e 30 rodadas do PCR. Condições de extensão exemplo: 2 min a 95 ° C, (30 s a 1 min a 50 ° C, a 1 min a 68 ° C, 95 ° C) x 34, 10 min a 68 ° C.
    3. Combinar o conteúdo de todos os 4 tubos PCR em um tubo de 1,5 mL e usar um kit de purificação de PCR para purificar produtos em 50 μL de H2O.
    4. Dosar os produtos de extensão da primeira demão para garantir suficiente DNA determinando a absorvância a 260 nm.
      Nota: Concentração final típica do produto extensão da primeira demão é ~ 200 – 300 ng / µ l.

3. transformação de c. albicans com modelo de reparação e plasmídeo

  1. Acetato de lítio e TE de fazer.
    1. Mix 10 mM Tris-Cl, 1 mM EDTA, acetato de lítio de 100 mM e H2O (pH de solução-mãe todos os 7,5) para atingir o volume total de 50 mL.
  2. Faça a placa
    1. Misture 40% PEG 3350, acetato de lítio 100 mM, 10 mM Tris-Cl, 1 mM EDTA e H2O (pH de solução-mãe todos os 7,5) para atingir o volume total de 50 mL.
  3. Digeri corretamente clonado plasmídeos da etapa 1.9.
    1. Adicionar 10 μg de plasmídeo, 4 µ l de tampão 10x, 0,4 µ l de 10 mg/mL albumina de soro bovino (BSA), 0,5 µ l de KpnI, 0,5 µ l de SacI e H20 a 40 µ l total de volume em um tubo de 1,5 mL. Incube a 37 ° C durante a noite (Figura 1).
  4. Cresce uma cultura durante a noite de SC5314 de c. albicans , selvagem-tipo prototroph, a 25 ° C em dextrose de peptona levedura suplementado com 0,27 mM uridina (YPD + Uri), idealmente a OD600 inferior a 6.
    1. 5 unidades de600 OD de células por transformação de pelotas por fiação durante 5 min à 2.348 x g e suspender o OD 5600 de células peletizadas em acetato de lítio e TE 100 µ l.
  5. Adicione o seguinte para um tubo de 1,5 mL na ordem listada: 1) 100 µ l de células da etapa 3.4.1, 2) 40 µ l de esperma salmão cozida e refrigeração rápida DNA (10 mg/mL), 3) 10 µ g de digestão de plasmídeo da etapa 3.3.1, 4) 6 µ g de reparação purificada modelo e 5) 1 mL de placa.
  6. Adicione o seguinte para um tubo de 1,5 mL na ordem listada: 1) 100 µ l de células, 2) 40 µ l de esperma de salmão cozida e refrigeração rápida DNA (10 mg/mL), volume de2O 3) H igual ao de transformar o DNA em passo 3.5 e 4) 1 mL de placa.
    Nota: Isto irá servir como um controle negativo.
  7. Misture as transformações suavemente pipetando e deixe incubar a 25 ° C durante a noite.
  8. As células de choque de calor, colocando-os em um banho de água de 44 ° C durante 25 min.
  9. Gire por 5 min a 2.348 x g em uma centrífuga de bancada e retire a placa de mistura sobrenadante. Lave uma vez com a adição de 1 mL de YPD + Uri e centrifugar novamente por 5 min a 2.348 x g.
  10. Suspender as células em 0,1 mL de YPD + Uri e incubar um tambor rolo ou agitador a 25 ° C durante a noite.
  11. Placa em YPD + Uri com 200 μg/mL de nourseothricin. Colónias aparecerá em 2-5 dias.

4. estrias para colônias única

  1. Dividir uma 100 x 15 mm placa de Petri em trimestres e etiquete cada quadrante.
    1. Toca uma das colónias da placa com um palito de dente estéril ou aplicador e raia de transformação em todo o lado mais comprido do quadrante.
    2. Despir-se para colônias simples usando uma técnica asséptica e permitir que as colônias a crescer a 30 ° C durante 2 dias.

5. colônia do PCR

  1. Desenha os cheque para a frente da primeira demão (FCP) ~ 200 pares de bases montante do site da restrição que foi introduzido e as seleção inversa da primeira demão (RCP) ~ 300 pares de bases a jusante.
    1. Adicione 0.3 μL do FCP, 0.3 μL de RCP, 0.3 μL de polymerase thermostable (ExTaq 1.5 unidades), 3 µ l de dNTPs (total concentração 40 mM), 3 μL de tampão de ExTaq e 23 μL de H2O para um tubo de 1,5 mL.
      Nota: Adição de 0,5 μL/reação dimetil sulfóxido (DMSO) pode melhorar a eficiência do PCR.
    2. Adicione 0,25 μL de uma colônia de levedura única da etapa 4.1.2 à mistura da etapa 5.1.1, usando a ponta da pipeta P10 e tomando cuidado para não perturbar o ágar-ágar.
    3. Amplificar DNA por PCR e executar 5 μL de PCR em um gel para garantir a amplificação é bem sucedida, tendo cuidado para não perturbar o centrifugado na parte inferior do tubo.

6. restrição digestão de PCR de colônia

  1. Adicionar 10 μL de produto (tomando cuidado para não não perturbe o centrifugado na parte inferior do tubo) PCR, 3 μL de tampão, 1 μL de enzima de restrição e 16 μL de H2O, em seguida, incube-se de acordo com as instruções do fabricante e resolver em um gel de agarose para identificar corre edições do genoma de CT.
    Nota: A enzima de restrição usada aqui é o site codificado no modelo de reparação específica de TPK2 .

7. salvar cepas

  1. Crescer uma cultura da noite das colônias que foram confirmadas pela digestão da limitação em YPD + Uri a 30 ° C.
  2. Adicione 1 mL da cultura e 1 mL de glicerol a 50% (trazendo a concentração final de glicerol a 25%) para um tubo adequado para armazenamento a-80 ° C.
  3. Armazenar os clones corretos a-80 ° C.
    Nota: Estirpes corretas podem ser armazenadas a-80 ° C por muitos anos.

8. remoção de Natr marcador

  1. Raia transformantes correto em maltose de peptona levedura (YPMaltose) (2% maltose).
  2. Escolher uma colônia da placa de listras e cultura o fermento por 48 h a 30º C no líquido YPMaltose maltose de 20 g/L.
  3. 200 – 400 células em maltose de 20 g/L de YPMaltose da placa e incubar a 30 ° C por 24 h.
  4. Replicar a placa sobre YPMaltose e YPMaltose 200 μg/mL NAT.
  5. Incube a 30 ° C por 24 h.
    Nota: Colônias que já não crescem em YPMaltose 200 μg/mL nourseothricin mas crescem na YPMaltose perderam o Natr marcador (CaCAS9) e guia de RNA.
  6. Salve as estirpes que perderam o Natr marcador (CaCAS9) e guia do RNA como feito em etapas 7.1 – 7.3.
    Nota: Um plasmídeo semelhante, pV1393, usa o SAP2 em oposição a um promotor MAL2 . Crescimento no YCB – BSA irá induzir flipase e remoção de Natr se pV1393 é usado para edição de gene.

Representative Results

Sequências de guia RNAs e reparação de modelos que se destinam a c. albicans TPK2, uma subunidade catalítica da quinase c-AMP, foram projetados de acordo com as orientações acima sugeridas. As sequências são mostradas na (tabela 1, Figura 1). Guia RNAs foram clonados em vetores de expressão CaCas9 e cotransformed com o modelo de reparação no selvagem-tipo c. albicans. Um site de digestão de restrição EcoRI e códons de parada no modelo de reparação perturbam o site PAM e facilitam a triagem para mutantes corretos (Figura 1). Transformants eram listradas para colônias única e selecionados por digestão de PCR e restrição de colônia para a incorporação do modelo de reparação (Figura 2). Digestão da limitação rapidamente distingue o selvagem-tipo de sequências mutantes.

Nome do oligonucleotide Sequência do oligonucleotide
Guia para a frente Primer_3 ATTTGgggtgaactatttgttcgccG
Inverter Primer_3 guia AAAACggcgaacaaatagttcacccC
Reparar o modelo Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Reparar o modelo Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Primer de seleção direta ttaaagaaacttcacatcaccaag
Inverter seleção Primer actttgatagcataatatctaccat
Primer de sequenciamento ggcatagctgaaacttcggccc

Tabela 1: lista de oligo nucleotídeos utilizados para este estudo. Sites adicionados para fins de clonagem são capitalizados e em negrito nas sequências de cartilha de guia. Sequências no modelo de reparação que modifica o DNA genômico são capitalizadas e em negrito.

Figure 1
Figura 1 : Diagrama do guia de design de modelo de RNA e reparação. (A) rotulagem de todas as sequências de PAM nos primeiros 100 nucleotídeos do TPK2. Sequência de PAM 3 (PAM_3) é destacada, como é que a sequência utilizada neste estudo. (B) guia de RNA desenha usando PAM_3. 20 primeiras demão base projetadas usando SnapGene são minúsculas e azul. Bases adicionais necessárias para clonagem são maiusculas e verde mostrado deslocamento. (C) reparação modelo as primeiras demão que inserir um códon de parada TAA e EcoRI site são inseridas o TPK2 quadro de leitura. DNA que difere a sequência de tipo selvagem é vermelho e em maiusculas. (D) exemplo de como um guia destina-se na vertente positiva de DNA usando PAM_4. (E) diagrama esquemático de pV1524 após a clonagem do guia do RNA e digestão com KpnI e SacI. Neut5L-5' e 3-Neut5L' o vetor para o site Neut5L no genoma de c. albicans -alvo. CaENO1p é o promotor que impulsiona a expressão do fermento otimizado CaCas9. Nat,r é a gaveta de resistência nourseothricin. CaSNR52p é o promotor dirigindo a expressão de RNA guia (sgRNA). FRT sites são clivados e recombinados por flipase (FLP), removendo a fita CRISPR sobre flipase expressão. Um esquema similar a (E) foi publicado pela Vyas et al. 11. clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Introdução e confirmação de um códon de parada e sítio de restrição EcoRI para TPK2. Primers utilizados para amplificação estão listados na tabela 1. Sequências de tipo selvagem e mutantes são mostradas abaixo do gel. Esta figura foi modificada de Vyas et al.11. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Descrição de modelos de reparação que irá gerar exclusões (A) e (B) inserções de cartoon. Cinza traços em (A) retratam intermediárias sequências não está presentes nos primers de modelo de reparação. Clique aqui para ver uma versão maior desta figura.

Discussion

C. albicans CRISPR eficientemente edita o genoma de c. albicans . pV1524 codifica uma levedura Cas9 códon otimizado e é projetado tais que os investigadores facilmente podem clonar as sequências de guia RNA a jusante do CaSNR52 promotor (Figura 1)11. Deve assegurar-se que apenas uma única cópia da sequência de guia foi clonada em vetores de expressão CaCas9 por sequenciamento, como cópias extras impedirá a edição de genoma. Se várias cópias do guia são introduzidas consistentemente, um deve diminuir a concentração do guia recozido utilizado na ligadura. O vetor e o protocolo descrito permitem o direcionamento de qualquer gene de c. albicans . Apesar de c. albicans é diploide, somente uma única transformação é necessária para atingir ambos os alelos de um gene. Além disso, a natureza processive de CRISPR-CaCas9 edição do genoma permite que pesquisadores de vários membros da família do gene-alvo. Muitas famílias de gene como o secretado aspartil proteases (SAPS) e proteínas de aglutininas sequência (ALS) são importantes para a virulência de c. albicans . Edição de genoma CRISPR facilitará a investigação dessas famílias de gene.

Os protocolos descritos acima apresentar um códon de parada para um frame de leitura aberto, resultando em fenotípico equivalente a um valor nulo (Figura 2). Uma grande variedade de alterações genéticas pode ser feita variando o modelo de reparação. Bobagem, missense e mutações silenciosas podem ser inseridas através de recombinação com um modelo de reparação adequada. Incorporação de um sítio de restrição simplifica a seleção de transformantes, como aqueles sem devem ser rastreados por sequenciamento de12,13. Além disso, c. albicans CRISPR permite que pesquisadores gerar inserções e exclusões, tornando-se um sistema ideal para inserir tags de afinidade, realizar trocas de promotor e gerar nocautes (Figura 3). Triagem para transformants correta para essas mutações é mais trabalhosa, como é necessário sequenciar as edições para confirmar a correta incorporação dos modelos de reparação. Além disso, o borrão do Sul pode ser necessário garantir cópias adicionais de um gene não foram inseridas em locais adicionais no genoma. A exigência do site NGG PAM coloca limitações ligeiras sobre as regiões do genoma que podem ser direcionados. O desenvolvimento de sistemas alternativos de CRISPR que usam nucleases alternativas tais como Cpf1 ou variações sobre o Cas9 sistema tem/irá aliviar muitos destas limitações14. Para conhecimento dos investigadores neste momento, estes sistemas ainda não foram aplicados para c. albicans.

Foi desenvolvido o sistema CRISPR descrito no protocolo acima tal que pode ser aplicado em uma ampla variedade de espécies, incluindo Saccharomyces cerevisiae, Naumouozyma castelliie o patógeno humano Candida glabrata11 . Transformação e eficiente edição destes levedura exige ligeiras alterações ao protocolo descrito, mas o quadro para edição estes genomas alternativas é notavelmente semelhante à descrita para c. albicans12. Além disso, levedura fornecem um excelente mecanismo para desenvolver procedimentos de edição de genoma. No fermento, quando ADE2 é uma mutação, um precursor para a via de biossíntese de adenina se acumula, transformando as células vermelhas. Este fenótipo facilmente observável permite que os investigadores identificar células editadas e solucionar rapidamente o genoma protocolos de edição. Combinado com caixa de ferramentas extensivo de biologia molecular disponível para fungos, protocolos para a edição de numerosas espécies de levedura têm sido desenvolvidos15,16. Tal uma aplicação ampla da tecnologia de edição do genoma em fungos tem o potencial de afetar significativamente uma grande variedade de disciplinas científicas.

CRISPR melhorou extremamente a eficiência da engenharia do genoma em c. albicans, mas até à data CRISPR não tem sido usado para executar telas ampla do genoma em c. albicans. Protocolos atuais exigem um modelo de reparação para introduzir mutações, como o fim não-homólogos ingressar na via em c. albicans é ineficiente12. A geração de reparação modelo oligos para cada gene é uma barreira significativa para a execução de todo o genoma de telas. Confluência dos custos diminuição da síntese de DNA e os avanços de tecnologias CRISPR fará desenvolvimento de bibliotecas de exclusão mais viável. Por exemplo, a expressão de um modelo de reparação do vetor CaCas9 abre o caminho para o desenvolvimento de bibliotecas de plasmídeo sustentável que cada gene11de destino. Além disso, protocolos CRISPR Candida transitórios que não requerem CaCas9 vetor de expressão incorporar no genoma da c. albicans foram desenvolvidos17. Além disso, aumentou o genoma de aumentos de expressão guia edição eficiência18. Estes e outros avanços de tecnologias CRISPR, são cruciais para o desenvolvimento de telas de todo o genoma em c. albicans19,20,21,22.

O genoma de c. albicans é diploides, mas A e alelos B não são sempre idênticos5. Tal heterozigosidade fornece ambos os desafios e oportunidades. Se um destina-se a ambos os alelos de destino, devem ser usados um site PAM, sequência de guia e modelo de reparação que atuarão em ambas as cópias do gene. No entanto, dependendo de polimorfismos de nucleotídeo único presentes em um gene, sistema CRISPR C.albicans permite que os investigadores atingir um único alelo. Tal precisão tem o potencial para permitir que os investigadores examinar as diferenças funcionais entre alelos. Direcionamento de alelos específicos deve ser feito com cuidado, como observou-se perda de heterozigosidade (LOH) em um alelo ou de um cromossomo inteiro. Quando a edição única de c. albicans alelos, um deve examinar adjacentes sequências de DNA para determinar se um clone tem mantido um perfil SNP diploide. Além disso, o alvo efeitos são bastante baixos para c. albicans CRISPR, mas sequenciamento do genoma inteiro pode ser considerado para estirpes principais.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Os autores agradecer Dr. Gennifer Mager para leitura e comentários úteis sobre o manuscrito. Este trabalho foi financiado por fundos de inicialização de laboratório de Ball State University e NIH-1R15AI130950-01 a D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics