Estabelecimento de infecção Viral e análise da interação vírus-hospedeiro em Drosophila Melanogaster.

* These authors contributed equally
Immunology and Infection
 

Summary

Este protocolo descreve como estabelecer infecção viral na vivo em Drosophila melanogaster , usando o método de nano-injeção e técnicas básicas para analisar a interação vírus-hospedeiro.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Propagação do vírus é das principais causas de doenças epidêmicas. Assim, compreender a interação entre o vírus e o hospedeiro é muito importante para estender o nosso conhecimento de prevenção e tratamento da infecção viral. A mosca de fruta Drosophila melanogaster provou para ser um dos organismos modelo mais eficiente e produtiva de tela para fatores antivirais e investigar a interação vírus-hospedeiro, devido a ferramentas poderosas de genéticas e altamente conservada imune inata vias de sinalização. O procedimento descrito aqui demonstra um método de nano-injeção para estabelecer a infecção viral e induzir respostas antivirais sistêmicas em moscas adultas. O controle preciso da dose injeção viral neste método permite alta reprodutibilidade experimental. Os protocolos descritos neste estudo incluem a preparação de moscas e o vírus, o método de injeção, análise de taxa de sobrevivência, a medição de carga de vírus e uma avaliação do percurso antiviral. Os efeitos da influência da infecção viral pelo fundo dos moscas foram mencionados aqui. Este método de infecção é fácil de executar e quantitativamente repetíveis; pode ser aplicado para a tela para anfitrião/viral factores envolvidos na interação vírus-hospedeiro e dissecar o crosstalk entre imune inata de sinalização e outras vias biológicas em resposta à infecção viral.

Introduction

Emergentes de infecções virais, especialmente por arbovírus, tais como o vírus de Chikungunya1, o vírus da Dengue, a febre amarela vírus2 e ovírusZika3, ter sido uma enorme ameaça para a saúde pública, causando pandemias 4. assim, uma melhor compreensão da interação vírus-hospedeiro tornou-se cada vez mais importante para o controle de epidemia e tratamento de doenças virais nos seres humanos. Para este objetivo, modelos mais apropriados e eficientes devem ser estabelecidos para investigar os mecanismos subjacentes a infecção pelo vírus.

Mosca da fruta, Drosophilamelanogaster (d. melanogaster), fornece um sistema poderoso para investigar de5,de interação vírus-hospedeiro6 e tem provado para ser um dos modelos mais eficientes para estudar doenças humanas virais7 , 8 , 9. antiviral altamente conservada, sinalização de caminhos e ferramentas de genéticas incomparáveis fazem voa um grande modelo para produzir resultados significativos com implicações reais para estudos antivirais humanos. Além disso, moscas são fáceis e baratas de manter no laboratório e são convenientes para triagem em larga escala de novos fatores regulatórios6,10 no vírus e o hospedeiro durante a infecção.

Quatro principais vias antivirais altamente conservadas (ex., o RNA de interferência (RNAi) via11, o JAK-STAT caminho12, via NF-κB e a caminho de autofagia13) são bem estudados em Drosophila nos últimos anos6. A via RNAi é um mecanismo antiviral amplo que pode suprimir a maioria dos tipos de vírus infecção6,14. Este caminho por mutações nos genes como Dicer-2 (Dcr-2) ou Argonaute 2 (AGO2) podem levar ao aumento de vírus título e host mortalidade15,16,17. O pathway JAK-STAT tem sido implicado no controle da infecção por um vírus da família Dicistroviridae e família Flaviviridae em insetos, por exemplo., vírus C drosófila (DCV) em moscas16 e vírus do Nilo Ocidental (WNV) e o vírus da Dengue em mosquitos18,19. O pedágio da drosófila (homólogo ao pathway NF-κB humana) e percursos de deficiência imunológica (IMD) (semelhantes ao humano pathway NF-κB e TNF) estão envolvidos na defesa de vírus invasão20,21, 22. autofagia é outro mecanismo conservado envolvidos na regulação da infecção viral, que é bem caracterizada em Drosophila23,24. Assim, a identificação de fatores regulatórios novela destas vias e dissecação crosstalk entre estes sinalização antiviral e outros caminhos biológicos, tais como metabolismo, envelhecimento, reação neural e assim por diante, podem ser facilmente configurados na drosófila sistema.

Embora modelos de infecciosos virais mais bem estabelecidos em drosófila são induzidos por vírus de RNA, infecção pelos invertebrados iridescente vírus 6I (IV-6) e vírus de Kallithea demonstraram o potencial para o estudo dos vírus de DNA em moscas25, 26. Além disso, o vírus também pode ser modificado para permitir a infecção de Drosophila, tais como o vírus da gripe9. Isto expandiu-se enormemente a aplicação da plataforma de triagem de Drosophila . Neste procedimento, usamos DCV como exemplo para descrever como desenvolver um sistema infeccioso viral em Drosophila. DCV é um positivo-sentido único encalhado RNA vírus de aproximadamente 9300 nucleotídeos, codificação de proteínas 927. Como um patógeno natural de d. melanogaster, DCV é considerado como um vírus adequado para estudar a resposta imune do hospedeiro fisiológicos, comportamentais e basal durante hospedeiro-vírus interação e co-evolução28. Além disso, sua taxa de mortalidade rápida após infecção em moscas do tipo selvagem torna DCV útil para triagem de genes resistentes ou suscetíveis no anfitrião29.

No entanto, há vários aspectos de preocupação quando estudar infecções virais em Drosophila. Por exemplo, bactérias simbióticas Wolbachia têm uma capacidade de inibir uma ampla espectros de proliferação de vírus de RNA em Drosophila e mosquito31,de30,32. Evidência recente mostra um possível mecanismo no qual Wolbachia blocos Sindbis vírus (SINV) infecção através o upregulation do methyltransferase Mt2 expressão no anfitrião33. Além disso, o fundo genético de insetos também é fundamental para a infecção viral. Por exemplo, o natural polimorfismo no gene, pastrel (pst), determina a suscetibilidade à infecção de DCV em Drosophila34,35, enquanto Locus E2H-Ubc e CG8492 estão envolvidos em vírus de paralisia de Cricket (CrPV) e infecção por vírus (FHV) rebanho casa, respectivamente,36.

Os modos particulares para estabelecer a interação vírus-hospedeiro em moscas, deve ser escolhido de acordo com fins de investigação, tais como uma tela de alta produtividade para componentes celulares do hospedeiro em Drosophila célula linhas37,38, oral infecção para estudar a resposta antiviral específico do intestino22,39,40, agulha picando41,42 ou nano-injeção, passando as barreiras epiteliais para estimular imune sistêmica respostas. Nano-injeção pode controlar com precisão a dose viral para induzir uma reação antiviral controlada e uma lesão fisiológica43, garantindo alta reprodutibilidade experimental44. Neste estudo, descrevemos um método de nano-injeção para estudar interações do vírus-anfitrião em Drosophila, destacando a importância dos efeitos de fundo dos moscas.

Protocol

Nota: Antes de iniciar o experimento, as linhas celulares e voar estoques usados devem não ser contaminados por outros patógenos, especialmente para vírus como DCV, FHV, Drosophila X vírus (DXV) e nefrite aviária (ANV). Idealmente, a sequenciação do ARN ou uma simples identificação de PCR-baseados são usados para detectar a contaminação10,45. Se a contaminação ocorreu, as linhas celulares e estoques voar não devem ser usados mais, até que estejam completamente descontaminados46.

1. vírus e preparação de voar

  1. Recolha e propagação de vírus
    Nota: Drosófila S2 * células são utilizadas para a titulação e a propagação de DCV. A linha de celular S2 * é derivada de uma cultura primária de embriões de d. melanogaster estágio finais. Esta linha de celular tem sido bem descrito anteriormente47.
    1. Cresce S2 * células num meio de Drosophila Schneider em 25 ° C, sem adicionais de CO2, como um monolayer semi aderente, solto uma placa de cultura de célula 10 cm, com uma densidade de 1 x 107 células viáveis/mL. Meio completo de uso para S2 * células: drosófila médio da Schneider contendo 10% calor inativada FBS, 100 unidades/mL penicilina e estreptomicina de 100 μg/mL.
      Nota: As células saudáveis devem mostrar uma forma redonda e exibem tamanho homogêneo.
    2. Descongele rapidamente o estoque DCV de-80 ° C em banho de água de 25 ° C. Infectar células S2 * com DCV em MOI = 0,01 imediatamente, diretamente, adicionando 1 mL de solução de antivírus para os pratos de cultura celular (área de crescimento: 55cm2) com 10 mL de meio completo para S2 * células.
    3. Incube as células a 25 ° C durante 3 a 5 dias. Quando o vírus está pronto para a coleção, a morfologia celular é anormal (forma da célula parece borrão) e o meio de cultura é cheio de partículas pretas indicativas de detritos celulares.
    4. Recolher a cultura de células inteiras em um tubo de 15 mL pipetando para cima e para baixo e congelar a-80 ° C (por até um ano).
      Nota: DCV pode ser armazenada por períodos prolongados de tempo a-80 ° C, com mínima perda de infecciosidade, por até um ano.
    5. Descongelar a cultura de células em um banho de água de 25 ° C com agitação constante e centrifugar a 6.000 x g, durante 15 min a 4 ° C. Recolha o sobrenadante em um tubo estéril 15 mL e vortex. Alíquota até 200 μL de solução de vírus por tubo.
      Nota: Alíquotas de vírus podem ser armazenadas por períodos curtos de até 3 dias a 4 ° C e até 1 ano a-80 ° C. Ciclos repetidos de congelamento-descongelamento devem ser evitados. É sempre melhor usar alíquota todas de uma vez.
    6. Escolha 5 tubos contendo vírus aleatórios para determinar a dose infecciosa de cultura de tecidos de vírus média (TCID50) por um ensaio de efeito citopático (ECP) (1 unidade de TCID50= 0.7 placa formando unidade [PFU]).
      Nota: CPE refere-se a alterações estruturais em células hospedeiras causadas pela invasão viral. O vírus infectante causa lise da célula hospedeira, ou quando a célula morre sem lise devido a uma incapacidade de reproduzir48.
      1. No dia 1, colete preparado S2 * células pipetando. Conte o número de celular. Centrifugar as células para 300 x g, durante 4 min e descartar o sobrenadante. Dilua as células para a densidade de 1 x 106 células/mL com meio completo para S2 * células conforme descrito na etapa 1.1.1.
      2. Sementes de 1 x 105 S2 * (100 μL) de células por bem para o fundo plano 96--placa (~ 30% confluência).
      3. Realize diluições de 10 vezes em série da unidade populacional DCV com meio completo para S2 * células. Adicione 50 diluições µ l para o poço. Adicione 50 µ l de meio de cultura sem vírus ao poço classificado bem como controlo negativo.
        Nota: Para cada taxa de diluição, 8 poços foram usados. Como o rendimento típico de DCV é cerca de 108-109 PFU/mL, a diluição deve cobrir pelo menos ~ 10-5-10-10.
      4. No dia 4, observe o CPE, com um microscópio de campo claro com o objetivo de X 40 ou 20 X. Classifica um poço no qual as células olham embaçadas e o meio está cheio de fragmentos como um "Bem positivo" e um poço no qual a morfologia celular é normal como "bem negativo".
      5. Poços de positivo ou negativos de Mark CPE com + ou –, respectivamente. Calcule o vírus TCID50 pelo método de Reed e Muench49.
    7. Elimine todos os materiais contaminados e luvas na panela descontaminação. Se o vírus não pode alcançar o desejado TCID50, concentrar-se 100 mL de solução de vírus por centrifugação a 68.000 x g, durante 1 h a 4 ° C.
      Nota: dependendo do objetivo do experimento, uma gama de doses de 102 a 10 unidades de6 TCID50 pode ser usado para infecção por vírus. Normalmente, usamos 3 x 106 TCID50 unidades.
    8. Desprezar o sobrenadante e ressuspender em 1 mL de tampão Tris-HCl (10 mM, pH 7,2). Alíquota 20 μL de solução de vírus por tubo e loja a-80 ° C. Escolha 5 tubos aleatórios para determinar o vírus médio TCID50 novamente.
  2. Preparação para a infecção de voar
    Nota: Bactérias simbióticas Wolbachia podem suprimir muitos tipos de infecção de vírus de RNA em insetos30,31,32,33,41. Assim, é essencial para limpar Wolbachia do moscas antes de estudar o hospedeiro-vírus infecção na vivo33.
    1. Prepare-se voar alimentos contendo tetraciclina adicionando 400 μL de 50 tetraciclina µ g/mL (em etanol a 70%) para 4 g de farinha de milho fresco padrão mosca alimentos (1L de comida contém 77,7 g de farinha de milho, 32,19 g de levedura, 10,6 g de ágar-ágar, 0,726 g de CaCl2 31,62 g de sacarose, 63,3 g de glicose, 2 g de sorbato de potássio e 15 mL de 5% C8H8O3). Misture bem e coloque os alimentos a 4 ° C durante a noite para evaporar o álcool etílico.
      Nota: Uma alta dose de etanol pode afetar a fertilidade voar, então não omitir este passo.
    2. Aquecer o alimento à temperatura ambiente e coloque recém eclosed moscas adultas (20 fêmeas e 10 machos) no frasco. Reproduzem as moscas a 25 ° C, umidade de 60% em um ciclo normal de claro/escuro.
      Nota: Normalmente, demora de 3 a 4 dias para as moscas desovar o suficiente. Muitos ovos inibem o desenvolvimento de larvas e diminuem a eficiência de tetraciclina.
    3. Coletar recém eclosed moscas adultas (dentro de 3 ~ 5 dias) sob um fluxo de luz de CO2e repita a etapa ~ 1.2.1-1.2.2. Normalmente, pelo menos 3 gerações são necessárias para a eliminação de Wolbachiacompletamente.
    4. Depois de 3 gerações com tratamento de tetraciclina, colete 5 moscas em um fluxo de luz de CO2 para o teste de infecção Wolbachia . Moscas para 1 min com 250 μL de água bidestilada (ddH2O) e alguns grânulos 0.5 mm cerâmica estéril em um tubo de 1,5 mL usando um homogeneizador de moer. Adicionar outro 250 μL de 2x tampão A (0.2 M Tris-HCl, pH 9.0; EDTA 0,2 M; 2% SDS) para a amostra e o vórtice.
      Nota: Desde que o SDS impedirá o movimento do grânulo, 1 x A reserva não pode ser diretamente usado para moer moscas. Se as moscas têm olhos vermelhos, remova cabeças antes da trituração, como isso pode influenciar a cor do produto de DNA.
    5. Congele as amostras a-80 ° C (manter por até um ano). Rapidamente a descongelar a amostra de-80 ° C em banho de água de 25 ° C, até dissolver. Incube as amostras a 70 ° C por 30 min.
    6. Adicionar 190 μL de 5 M KOAc, vórtex e incubar no gelo por 15 min ou mais.
    7. Centrifugar as amostras a 13.000 x g durante 5 min à temperatura ambiente, recolher o sobrenadante e transferi-los para novos tubos.
    8. Repita a etapa 1.2.7 para obter DNA com melhor qualidade.
    9. Adicionar 750 μL de isopropanol para cada amostra e inverta suavemente várias vezes à mão. Incube a temperatura ambiente por 5 min.
    10. Centrifugar as amostras a 13.000 x g durante 5 min à temperatura ambiente e descartar o sobrenadante. O pellet de DNA genômico branco vai ficar no fundo do tubo.
    11. Adicione 1 mL de etanol a 70% nas pelotas, centrifugar 13.000 x g por 5 min e descartar o sobrenadante. Secar o DNA até que se torne transparente.
    12. Dissolver o DNA em 100 μL de DDQ2O, titula-se concentração de DNA por espectrofotometria de absorção UV-Vis e o DNA de 100 ng/μL.
    13. Uso 200 ng de DNA para a reação de PCR (em um sistema de 20 μL, consulte a Tabela de materiais). Realizar PCR pelo seguinte programa: 95 ° C por 15 min; ciclo de 36 de 95 ° C por 45 s, 50 ° C durante 45 segundos e 72 ° C por 1 min; e uma etapa final de extensão (72 ° C por 1 min) em um termociclador.
      Nota: A Wolbachia 16S rRNA, usam os seguintes primers: 5' TGAGGAAGATAATGACGG 3' (em frente) e 5' CCTCTATCCTCTTTCAACC 3' (reverso). Para wsp, os primers foram 5' CATTGGTGTTGGTGTTGGTG 3' (em frente) e 5' ACCGAAATAACGAGCTCCAG 3' (reverso).
    14. Analise os produtos de PCR com eletroforese em gel de agarose a 1%. O tamanho do produto do PCR de Wolbachia 16S rRNA e wsp é em torno de 200 bp e 600 bp, respectivamente.
    15. Traseira Wolbachia livre voar estoque na comida de mosca de fubá padrão. Coletar de 3 a 5 dias recém eclosed macho voa para a infecção.
      Nota: Tratamento de tetraciclina também pode afetar a composição da microbiota intestinal, que posteriormente influencia respostas antivirais no acolhimento. Recomendamos que todas as moscas devem receber os mesmos tratamentos de tetraciclina. Manter livre de Wolbachia moscas crescer sob condições normais de pelo menos 3 gerações restaurar a microbiota do intestino.
  3. Genotipagem de Pastrel
    Nota: A presença do alelo S ou R do gene pst no fundo genético foi relatada para afetar a infecção de DCV em Drosophila34,35. É necessário verificar o genótipo de pst , especialmente para a infecção de DCV. Existem alguns SNPs em pst que podem afetar a infecção pelo vírus, o SNP major é 512 C/T. O gradiente de temperatura do PCR é um método rápido para identificar o genótipo de pst .
    1. Extrato de voar DNA genômico como descrito acima (passo 1.2.4 - 1.2.15).
    2. Uso 100 ng de DNA como o modelo, o primer de 512C, 5' CAGCATGGTGTCCATGAAGTC 3' (em frente) e 5' ACGTGATCAATGCTGAAAGT 3' (reverso) para detectar o alelo R, o primer 512T, 5' CAGCATGGTGTCCATGAAGTT 3' (em frente) e 5' ACGTGATCAATGCTGAAAGT 3' (reverso) para detectar o Alelo S.
    3. Definir os gradientes de Tm (temperatura de fusão) da seguinte forma: 54 ° C, 54,7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62,2 ° C, 63,7 ° C e 64 ° C (45 s a cada temperatura).
      Nota: 30 ciclos de PCR reação em cadeia são recomendados (sistema de 20 μL).
    4. Visualize o produto do PCR 100-bp por eletroforese em gel de agarose 2%.

2. viral infecção em Drosophila

  1. Infectar moscas por nano-injeção e realizar ensaios de sobrevivência.
    1. Puxe os capilares para preparar as agulhas de injeção, costas-encha a injeção da agulha com óleo e montar o injector como descrito anteriormente50.
    2. Anestesiar moscas na almofada sob um fluxo de luz de CO2. Inocular moscas por injeção intra torácica44 de 50,6 nL de solução de antivírus (PFU 100, diluído em tampão Tris-HCl, pH 7,2). Injete pelo menos 3 frascos de moscas (20 moscas por frasco).
      Nota: A injeção é demoradas (geralmente 100 moscas por hora) e replicação de DCV é muito rápida, por isso é muito importante anotar a hora exata no tubo uma vez terminando cada frasco (20 moscas). Injeção única de buffer é definida como um controle de simulação. Geralmente, moscas adultas masculinas são preferidas, como os resultados são mais estável e reprodutível do que quando usando fêmeas desde que as variações hormonais durante o acasalamento e reprodução podem influenciar a leitura de fêmeas51.
    3. Crescem as moscas injetadas a 25 ° C, 60% de umidade sob um ciclo normal de claro/escuro. Fornecemos moscas com alimentos frescos diariamente e registrar o número de mortos flies.
    4. Realizar pelo menos 3 réplicas biológicas e traçar a curva de sobrevivência.
    5. Para a análise estatística dos dados de sobrevivência, gere curvas de sobrevivência de Kaplan-Meier pelo software estatístico. Execute teste de log-rank para calcular os valores de P. Na tabela de sobrevivência, insira informações para cada disciplina. O software então calcula a sobrevivência por cento a cada momento e traça um plano de sobrevivência de Kaplan-Meier.
      Nota: Não adicione o fermento adicional dentro do frasco. Comparado com controles simulados, moscas infectadas por DCV ocasionalmente têm ascite e desajeitadas, que torná-lo vulnerável para o fermento pegajoso. É melhor gravar mais tempo pontos no experimento preliminar para descobrir um período de tempo no qual a morte maciça acontecerá para moscas infectadas. Geralmente, as moscas infectadas raramente morrem nos primeiros dois dias, mesmo para as linhas mutantes Dcr-2 . Para a Wolbachia voar livre w1118 (Bloomington 5905) infectado com 100 PFU de DCV, esta janela de tempo é em torno de 3 a 5 dias pós infecção. As moscas de fruta que morrer em poucas horas de injeção 0,5 h post deve não serão contadas como uma fatalidade porque eles podem ser mortos por lesão de agulha não por infecção viral.
  2. DCV carga medida pelo ensaio CPE
    Nota: Carga Viral é medida da mesma forma para a titulação da unidade populacional de vírus (etapa 1.1.6) mas requer preparação da amostra adicional (passo 2.2.1-2.2.4).
    1. No dia 1, infectar moscas masculinas, conforme descrito no passo 2.1.1-2.1.2. Grupo de moscas injetadas em grupos de 20 e mantê-los a crescer em alimentos frescos de voar para o tempo desejado (normalmente por 24 horas ou 3 dias). Fornece moscas com alimentos frescos diariamente.
    2. No dia 2, semente drosófila S2 * células numa placa de cultura de células de 10cm para a densidade de aproximadamente 5 x106 a 1 x 107 células/mL conforme descrito na etapa 1.1.1.
    3. No dia 3, coletar 5 moscas (sob um fluxo de luz de CO2) e triturá-los em um tubo de centrífuga de 1,5 mL por 30 s com 200 µ l de tampão Tris e grânulos cerâmicos usando homogenizador. Armazenar as amostras a-80 ° C ou imediatamente prosseguir para a próxima etapa.
    4. Vórtice completamente a amostra. Use uma seringa de 1 mL e 0,22 μm para filtro o sobrenadante para um novo tubo de 1,5 mL. Prossiga com a titulação, conforme descrito em etapas 1.1.6.1-1.1.6.5.
  3. Carga DCV, medida por qRT-PCR
    1. No dia 1, infectar moscas como descrito acima. Grupo injetado macho voa (20 moscas/grupo) e crescer em alimentos frescos de voar para o tempo desejado, normalmente para 24h ou 3 dias. Fornece moscas com alimentos frescos diariamente.
    2. No dia 3, coletar 5 moscas em um fluxo de luz de CO2 em um tubo de 1,5 mL com 200 μL de tampão de Lise e 20 grânulos cerâmicos (diâmetro = 0,5 mm), moer as amostras por homogenizador com alta velocidade de 30 s. Adicionar 800 μL de tampão de Lise adicionais a cada tubo e armazenar o s práticas a-80 ° C ou imediatamente realizar a extração do RNA e qRT-PCR.
    3. Preparar dicas grátis de RNase, tubos e água deionizada, diethylpyrocarbonate (DEPC) tratada e água de filtro de membrana 0,22 µm. Adicionar 200 μL de clorofórmio (99.5%) para a amostra e vigorosamente agitar durante 15 s pela mão. Incube durante 5 min ou mais à temperatura ambiente até a fase da água e a fase orgânica são claramente separados.
      Nota: Clorofórmio é extremamente perigoso e deve ser manuseado com cuidado. Fazer não vórtice a amostra, o que aumentará o risco de contaminação de DNA.
    4. Centrifugar as amostras a 13.000 x g, durante 15 min a 4 ° C.
    5. Coletar 400 μL do sobrenadante e transferir o sobrenadante para tubos novos. Misture com o mesmo volume de isopropanol (≥ 99.5%), inverta suavemente as amostras para 20 vezes à mão e depois precipitar por 10 min ou mais à temperatura ambiente.
      Nota: Precipitação a-20 ° C irá aumentar o rendimento do RNA.
    6. Centrifugar as amostras a 13.000 x g durante 10 minutos a 4 ° C. RNA de branco pelotas são visíveis na parte inferior do tubo.
    7. Desprezar o sobrenadante e adicionar 1 mL de etanol a 70% (etanol em água DEPC) e inverter algumas vezes para lavar o RNA.
    8. Centrifugar as amostras a 13.000 x g por 5 min a 4 ° C. Descartar o sobrenadante e seco do RNA por 5-10 min; RNA deve tornar-se transparente.
    9. Adicione 50 μL de água DEPC para a amostra, pipeta para poucas vezes e vortex.
    10. Tome 3 μL de RNA para titulada a concentração de RNA. Quantificar o RNA em 260 nm. Normalmente, a concentração de RNA extraída por este protocolo é aproximadamente 100-500 μg/μL, que é apropriada para a síntese do cDNA.
    11. Uso 2 μg de RNA para a síntese do cDNA. Diluir a amostra com 100 μL com DDQ2O e loja a-20 ° C.
    12. Faça qRT-PCR de acordo com as instruções do fabricante e execute qRT-PCR.
      Nota: Para a síntese do cDNA de DCV, primers aleatórios funcionavam muito melhor do que o primer poli A em nossas mãos. Expressão de RNAm DCV é normalizado para proteína endógena ribosomal 49 (rp49) mRNA. As primeiras demão do oligonucleotide usadas nesta parte: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (em frente) e 5' CACCAGGAACTTCTTGAATCCGG 3' (reverso); DCV, 5' TCATCGGTATGCACATTGCT 3' (em frente) e 5' CGCATAACCATGCTCTTCTG 3' (reverso); Vani, 5' TGCAACTCTGGGAGGATAGC 3' (em frente) e 5' AATTGCCCTGCGTCAGTTT 3' (reverso); vírus-induzida RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (em frente) e 5' GATTACAGCTGGGTGCACAA 3' (reverso).

Representative Results

Após a infecção de DCV de d. melanogaster, obtêm-se resultados desta seção. A Figura 1 mostra o fluxograma de infecção viral em Drosophila. Moscas são injetadas intra-thoracically, e em seguida as amostras são coletadas para a medição do viral TCID50 e o nível do genoma de RNA (Figura 1). Infecção por vírus pode induzir lise celular e CPE é observada em 3 dias pós infecção (Figura 2A). Em consonância com a carga de vírus, medida pelo ensaio de CPE é medida por qPCR (Figura 2B). Como mostrado na Figura 3, a Wolbachia inibe infecção de DCV em Drosophila. WOL-16s rRNA e wsp primers são usados para detectar a presença de Wolbachia (Figura 3A) e Wolbachia-voa livre mostra a taxa de sobrevivência significativamente diminuída após infecção DCV (Figura 3B). A Figura 4 mostra como verificar o polimorfismo de pst por gradiente PCR utilizando primers específicos. A Figura 5 mostra a dose efeitos dependentes da DCV infecção em sua mosca. A taxa de sobrevivência na Figura 5A e o vírus carregar em 3 dias pós infecção é mostrada na Figura 5B. A Figura 6 demonstra que a infecção de DCV pode ativar o antiviral Dcr2/RNAi e JAK/STAT, sinalização de caminhos entre o anfitrião52. O nível de expressão do repórter Vani da expressão do gene do percurso Dcr2/RNAi é elevado 3 dias pós infecção (figura 6A). O pathway JAK-STAT é também ativado após infecção de DCV, que é indicada pelo nível de expressão de gene repórter vir-1 (Figura 6B). A Figura 7 mostra que o caminho de Dcr2/RNAi é crítico para infecção antiviral em Drosophila52. DCR-2 moscas mutantes têm uma taxa de sobrevivência diminuída (Figura 7A) e uma carga maior de vírus (Figura 7B) após a infecção de DCV.

Figure 1
Figura 1: fluxograma de Drosophila infecção e análise de carga de vírus.
Estabelecimento de Drosophila infecção por nano-injeção. O gráfico do esquema mostra que moscas são infectadas intra-thoracically e a carga de vírus são medidos pelo ensaio CPE e qRT-PCR. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Análise de carga DCV.
Em consonância com a carga de vírus, medida pelo ensaio de CPE é medida por qPCR. (A) S2 * células são cultivadas em 25 ° C durante 3 dias com uma diluição de vírus diferentes (50 μL). 1 unidade TCID50 de vírus usada é 4,29 x 109 (equivalente a 3 x 109 PFU/mL). Primeiro painel, 10-3 diluição; segundo painel, 10-7 diluição; terceiro painel, 10-10 diluição; diante do painel, sem infecção. As células no painel 1 e 2 apresentam o fenótipo típico de positivo CPE (setas brancas indicam os restos da célula), e células no painel 3 e 4 mostram o fenótipo típico de negativo. Barra de escala é indicada nas figuras. (B) medição de DCV carregar por qPCR. Realizar diluições de 10 vezes em série de DCV e infectar S2 * linhagem celular. O RNA total de células infectadas é extraído e qPCR é realizada para medir o nível de RNA de DCV. Gradiente infecciosa carga viral (determinada pelo ensaio CPE) nas células é correspondida e positivamente relacionada com a medição por qPCR (r2= 0.999). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Infecção Viral de moscas com ou sem Wolbachia.
Wolbachia infecção contribui para a resistência de DCV em Drosophila. (A) a Wolbachia é detectada presença por cartilhas wol-16s rRNA e wsp . G1, G2 e G3 representado minériormoscas (Oregon-R) (Bloomington 5) trataram por tetraciclina para um, dois e três gerações respectivamente. O tamanho do produto do PCR é em torno de 200 bp (wol-16s rRNA) e 600 bp (wsp). (B) Wolbachia livre moscas são mais sensíveis à infecção de DCV. 3 a 5 dias velhas machos adultas moscas são injetadas com 100 PFU de DCV. Wolbachia livre voa (linhas sólidas) Mostrar significativamente reduzida de sobrevivência que Wolbachia protegido mosca (linhas de traço) após infecção de DCV. Duas linhas diferentes da sua, minérior e w1118, são utilizadas para o ensaio de sobrevivência e mostram resultado semelhante. Todas as barras de erro representam o erro padrão (s.e.) pelo menos três testes independentes; * P < 0.05, * * P < 0,01, * * * P < 0,001, * * * P < 0,0001, ns, não significativos. (B) de Kaplan-Meier. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: Pastrel genotipagem por PCR gradiente.
polimorfismo de PST é verificado pelo PCR gradiente. Gradiente PCR é realizada para distinguir pst R (512 C) e S (512T) alelo no adulto drosófila . Gradientes de TM são r: 54 ° C, b: 54,7 ° C, c: 55,5 ° C, d: 58 ° C, e: 59,7 ° C, f: 62,2 ° C, g: 63,7 ° C, h: 64 ° C.  Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: Taxa de sobrevivência e DCV título de minérior moscas infectados com uma dose diferente de DCV.
Moscas de minériorsão injetadas com três doses diferentes de DCV, 10 PFU/voar, PFU/voar 50 e 100 PFU/voar. (A) a taxa de sobrevivência dos moscas é significativamente menor quando infectados com doses mais elevadas infecciosas. (B) o nível de RNA de DCV em todo o corpo de moscas indicados é medido por qRT-PCR no momento indicado e normalizado do grupo de inoculação de PFU/voar 10. Todas as barras de erro representam o erro padrão (s.e.) pelo menos três testes independentes; * P < 0.05, * * P < 0,01, * * * P < 0,001, * * * P < 0,0001, ns, não significativos. Kaplan-Meier (A) ou (B) de One-Way anova. Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6: Dcr2/RNAi e antiviral JAK/STAT sinalização via ativada após infecção de DCV.
Moscas de minériorforam infectadas com 100 PFU de DCV. Vani (A) e vir-1 (B) mRNA expressado em todo o corpo são medidos por qRT-PCR na hora indicada pontos pós infecção. A mudança de expressão é normalizada para o de nível basal antes da infecção. Todas as barras de erro representam o erro padrão (s.e.) pelo menos três testes independentes; * P < 0.05, * * P < 0,01, * * * P < 0,001, * * * P < 0,0001, ns, não significativos. ANOVA One-Way (A, B). Clique aqui para ver uma versão maior desta figura.

Figure 7
Figura 7: Dcr-2 mutante mosca sensível à infecção de DCV.
DCR-2 mutante voa e seus controle genético w1118 moscas foram infectadas com 100 PFU de DCV. (A) as taxas de sobrevivência de moscas deficientes Dcr-2 e moscas do selvagem-tipo (w1118) pós infecção de DCV. (B), DCV RNA nível em todo o corpo de moscas indicados é medido por qRT-PCR 2 dias pós infecção e normalizada ao de w1118. Todas as barras de erro representam o erro padrão (s.e.) pelo menos três testes independentes; * P < 0.05, * * P < 0,01, * * * P < 0,001, * * * P < 0,0001, ns, não significativos. Kaplan-Meier (A) ou no teste T de student (B). Clique aqui para ver uma versão maior desta figura.

Discussion

Neste artigo, apresentamos um procedimento detalhado sobre como estabelecer um sistema viral infeccioso em adultos Drosophila melanogaster , usando nano-injeção. Os protocolos incluem a preparação de linhas apropriadas de voar e estoque de vírus, técnicas de infecção, a avaliação dos indicadores de infecciosas e a medição da resposta antiviral. Apesar de DCV é usado como um exemplo de um patógeno viral, dezenas de tipos diferentes de vírus foi bem sucedidas para estudo no sistema da drosófila. Além disso, foram identificadas centenas de fatores regulatórios, do vírus ou do hospedeiro, através de triagem em larga escala em moscas. Assim, este método é altamente adaptável e não limita a DCV / interação dadrosófila .

Para propagar e colheita foram DCV com êxito, algumas precauções devem ser tomadas. As células devem ser saudáveis, cultivadas em uma densidade adequada e colhidas na hora. Reduzir o volume de cultura de células não afeta significativamente título do vírus. Normalmente, 107 células infectadas por DCV em MOI = 0,01 será finalmente rendimento aproximado 108-109 TCID50 de DCV, que pode atender às demandas da maioria dos experimentos in vivo e in vitro . O ensaio CPE e ensaio de qRT-PCR são descritos no presente protocolo para a medição da carga de vírus. O ensaio CPE de alguma forma é complicado. A densidade adequada de inoculação de células e um experiente padrão de discriminação de CPE positivo/negativo permitem um rápida e bem sucedido do ensaio CPE. Assim, nós fornecemos um ensaio de qRT-PCR fácil aqui para ajudar a decidir a diluição cutt-off no ensaio CPE antes de dominar o ensaio da CPE.

No entanto, DCV é um vírus muito potente para a mosca adulta e linhagem de células de Drosophila . Inoculação de PFU/voar apenas 100 pode matar 50% das moscas selvagens dentro de 5 dias. Uma dose de infecção em excesso pode sombrear a significância entre as linhas de suscetíveis de tipo selvagem voar e potencial. É importante aplicar pelo menos duas doses de infecção quando se inicia uma nova tela. Desde a morte de maciça de Drosophila pode acontecer em uma janela de tempo muito curto por causa da alta letalidade de DCV, registando o número de morte com mais frequência em experimentos preliminares é altamente recomendável. Após a infecção de DCV, algumas moscas ocasionalmente tem síndrome de ascite. Notavelmente, moscas que morrem dentro de infecção de 0,5 h post devem ser excluídas, que pode ser causada por lesão de injeção inadequada da agulha.

A força infecciosa da DCV também é influenciada por muitos fatores do hospedeiro, que devem ser considerados antes de iniciar um experimento. Wolbachia é um vertical transmitir endossimbiose que tem grande impacto sobre a infecção do vírus em moscas32. Tratamento de tetraciclina em comida de mosca é um método comum usado para eliminar a infecção de Wolbachia . No entanto, esse método também altera a composição da microbiota intestinal, que por sua vez pode afetar a resposta antiviral53. Alguns estudos têm enfatizado a importância da variação genética na infecção vírus36, como ubc-e2h, cg8492 e pst. Por exemplo, a maioria selvagem tipo mosca linhas têm o alelo pst S e são sensíveis ao tipo picorna vírus, enquanto a maioria das linhas mutantes testamos de centro de estoque de Bloomington têm alelo pst R, assim tendo fenótipos resistentes. É muito importante descartar o impacto do pst, especialmente quando censurando um gene de resistência comparando com tipo selvagem controle29.

Nano-injeção para induzir infecção sistêmica de vírus, além de outros métodos estão disponíveis para estudar a infecção de vírus em moscas. Linhas de células de Drosophila tem provado ser um método de alta produtividade para testar a infecção pelo vírus relacionados ao hospedeiro componente celular37,38. No entanto, um sistema in vitro é sempre acompanhado com uma alta taxa de falsos positivos, quando confirmando em vivo. DCV também pode ser aplicado para infectar Drosophila oralmente, Considerando que apenas pode desencadear uma infecção restrita e mais leve. Apenas 20% de larvas foram infectados dentro de 12 h e 14% de mortalidade foi observada, com apenas 25% mortalidade em 20 dias no adulto voa22. Picada de moscas com pinos de 0,15 mm de diâmetro é outra maneira de definir a infecção viral, mas isso não pode garantir a dose exata de infecção e repetibilidade quantitativa. Superexpressão de proteínas virais pela manipulação genética de moscas é uma boa maneira de estudar interactomes molecular no vivo7. No entanto, isso pode não retratar a realidade de Fisiologia e patologia no acolhimento ao ser infectado. Enquanto isso, o método de nano-injeção também tem desvantagens, pois não é o caminho natural da infecção e diretamente pode estimular uma resposta imune do sistema forte logo após a infecção, que ignoraram a cutícula, a primeira linha de defesa antiviral. Em suma, o propósito específico de investigação e condição experimental disponível são fatores decisivos na escolha entre diferentes métodos.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Gostaríamos de agradecer o laboratório Pan todo em IPS. CAS. Agradecemos o Dr. Lanfeng Wang (IPS, CAS) para assistência experimental e Dr. Gonalo Cordova Steger (natureza de Springer), Dr. Jessica VARGAS (IPS, Paris) e Dr. Seng Zhu (IPS, Paris) para comentários. Este trabalho foi apoiado por concessões do programa estratégico de pesquisa prioritárias da Academia Chinesa de Ciências L.P (XDA13010500) e h. t (XDB29030300), a Fundação ciência Natural nacional da China para L.P (31870887 e 31570897) e J.Y (31670909). L.P é um membro da Associação de promoção de inovação do CAS da juventude (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics