Bruke i Vitro fluorescens resonans energioverføring å studere dynamikken i Protein komplekser på et millisekund tidsskala

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Protein-protein interaksjoner er avgjørende for biologiske systemer, og studier av bindende kinetics gir innsikt i dynamikk og funksjonen av protein komplekser. Vi beskriver en metode som quantifies kinetic parameterne for et protein kompleks fluorescens resonans energioverføring og stoppet-flow teknikken.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Proteiner er primære operatører av biologiske systemer, og de kommuniserer vanligvis med andre makro- eller små molekyler utføre sine biologiske funksjoner. Slike samhandlinger kan være svært dynamisk, betyr de samspill underenheter er stadig forbundet og avstand på enkelte priser. Mens måle forpliktende tilhørighet med teknikker som kvantitative rullegardinmenyen avslører styrke samhandling, studere bindende kinetics gir innsikt i hvordan rask samspillet skjer og hvor lenge hver komplekset finnes. Videre måle the kinetics av en interaksjon i nærvær av en tilleggsfaktor, for eksempel en protein utveksling faktor eller et legemiddel, hjelper avsløre mekanismen som samhandlingen er regulert av den andre faktoren, gir viktig kunnskap for den fremme av biologisk og medisinsk forskning. Her beskriver vi en protokoll for å måle bindende kinetics av et protein kompleks som har en høy iboende tilknytning hastighet og kan bli atskilt raskt av en annen protein. Metoden bruker fluorescens resonans energi-overføring til å rapportere dannelsen av protein kompleks i vitro, og du kan overvåke rask foreningen og av komplekset i sanntid på en stoppet-flow fluorimeter. Bruker denne analysen, er association og dissosiasjon rate konstanter av proteinet kvantifisert.

Introduction

Biologiske aktiviteter utføres til slutt av proteiner, mest som samhandler med andre for riktig biologiske funksjoner. Bruke en beregningsorientert tilnærming, den totale mengden protein-protein interaksjoner i human er anslått til ~ 650 0001og avbrudd i disse samhandlingene ofte fører til sykdommer2. På grunn av deres viktige roller i å kontrollere mobilnettet og organismebiologi prosesser, er mange metoder utviklet for å studere protein-protein interaksjoner, for eksempel gjær-to-hybrid, resultatet av dette fluorescens complementation, split-luciferase complementation og co-immunoprecipitation analysen3. Mens disse metodene er flink til å oppdage og bekrefter protein-protein interaksjoner, de er vanligvis ikke-kvantitative og dermed gir begrenset informasjon om affinitet mellom samspill protein partnerne. Kvantitativ rullegardinlistene kan brukes til å måle forpliktende tilhørighet (f.eks dissosiasjon konstanten Kd), men det måle ikke the kinetics av bindingen eller kan det brukes når Kd er svært lav på grunn av en utilstrekkelig signal-til-støy forholdet4. Overflaten plasmon resonans (SPR) spektroskopi kvantifiserer bindende kinetikk, men det krever en bestemt overflaten og immobilisering av en reactant på overflaten som potensielt kan endre binding-egenskapen reactant5. Videre er det vanskelig for SPR å måle rask association og dissosiasjon priser5, og det er ikke hensiktsmessig å bruke SPR for å karakterisere hendelsen utveksle protein underenheter i et protein kompleks. Her beskriver vi en metode som tillater måling av protein kompleks montering og demontering på et millisekund tidsskalaen. Denne metoden var avgjørende for fastsette rollen til Cullin - ssociated -Nedd8 -dissociated protein 1 (Cand1)i F-boks protein utveksling faktor6,7.

Cand1 regulerer dynamikken i Skp1•Cul1•F-boksen protein (SCF) E3 ligases, som tilhører familien Cullin-RING ubiquitin ligases. SCFs består av cullin Cul1, som binder RING domene protein Rbx1, og en utskiftbare F-boks protein, som rekrutterer underlag og binder Cul1 gjennom adapter protein Skp18. Som en E3 ligase, SCF gir Bøyning av ubiquitin til sin substrat, og aktiveres når underlaget er rekruttert av F-boks protein, og når Cul1 endres av ubiquitin-lignende protein Nedd89. Cand1 binder uforandret Cul1, og ved bindende, det forstyrrer både foreningen Skp1•F-box protein med Cul1 og Bøyning av Nedd8 Cul110,11,12,13. Resultatet Cand1 syntes å være en inhibitor av SCF aktivitet i vitro, men Cand1 mangel på organismer forårsaket som antyder en positiv rolle i Cand1 i å regulere SCF aktiviteter i vivo14,15,16 , 17. dette paradokset ble endelig forklart av en kvantitativ studie som avslørte de dynamiske interaksjonene mellom Cul1, Cand1 og Skp1•F-box protein. Bruker fluorescens resonans energi overføring (bånd) analyser som oppdager dannelsen av SCF og Cul1•Cand1 komplekser, foreningen og dissosiasjon rate konstanter (k og kav, henholdsvis) var målt individuelt. Målingene avslørte at både Cand1 og Skp1•F-box protein skjemaet stramt kompleks med Cul1, men den kav av SCF er dramatisk økte med Cand1 og den kav av Cul1•Cand1 økes dramatisk av Skp1•F-box protein6,7. Disse resultatene gir den første og kritiske støtten for definering av rollen for Cand1 som en protein utveksling faktor, som gir dannelsen av nye SCF komplekser gjennom gjenvinning Cul1 fra gamle SCF komplekser.

Her presenterer vi prosedyren for utvikling og bruk av bånd analysen for å studere dynamikken i Cul1•Cand1 komplekse7, og det samme prinsippet kan brukes til å studere dynamikken i ulike biomolecules. BÅND oppstår når en donor er glade med den riktige bølgelengden og en godkjenner med eksitasjon spectrum overlappende donor utslipp spektrum finnes innenfor en avstand på 10-100 Å. Opphisset tilstand overføres til acceptor, og dermed redusere donor intensiteten og øke acceptor intensitet18. Effektiviteten av bånd (E) avhenger både han selvmord radius (R0) og avstanden mellom giver og acceptor fluorophores (r), og er definert av: E = R06/ (R0 6 + r6). Han selvmord radius (R0) avhenger av flere faktorer, inkludert dipol kantete retningen, spectral overlappingen av donor-acceptor paret, og løsningen brukes19. Hvis du vil bruke bånd analysen på en stoppet-flow fluorimeter, som overvåker endring av donor utslipp i sanntid og muliggjør målinger av rask k og kav, er det nødvendig å etablere effektive bånd som resulterer i en betydelig reduksjon av donor utslipp. Derfor utforme effektive bånd ved å velge riktig par fluorescerende fargestoffer og områder på målet proteiner knytte fargestoffer er viktig og vil bli diskutert i denne protokollen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. prosjektert bånd analysen.

  1. Last ned filen Cul1•Cand1 kompleks i struktur fra Protein Data Bank (filen 1U6G).
  2. Vise strukturen for Cul1•Cand1 i PyMOL.
  3. Bruk funksjonen måling på PyMOL veiviseren meny til å beregne avstanden mellom den første aminosyren av Cand1 og den siste aminosyren av Cul1 (figur 1).
  4. Last online spectra betrakteren (se Tabell for materiale) og Vis eksitasjon og utslipp spektra av 7-amino-4-methylcoumarin (AMC) og FlAsH samtidig (figur 2). AMC er bånd giver og FlAsH er bånd acceptor.

Figure 1
Figur 1: crystal strukturen av Cul1•Cand1 og måling av avstanden mellom potensial merking nettsteder. Crystal struktur filen ble lastet ned fra Protein Data Bank (filen 1U6G), og vises i PyMOL. Målinger mellom valgte atomer ble gjort av PyMOL. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: eksitasjon og utslipp spektra av fluorescerende fargestoffer for bånd. Spektra av AMC (7-amino-4-methylcoumarin) og FlAsH vises. Stiplede linjer angir eksitasjon spectra, og heltrukne linjer angir utslipp spectra. Bildet opprinnelig ble generert av fluorescens SpectraViewer og ble endret for bedre klarhet. Klikk her for å se en større versjon av dette tallet.

2. forberedelse av Cul1AMC•Rbx1, bånd donor protein

  1. Konstruere plasmider for å uttrykke menneskelige Cul1sortase•Rbx1 i E. coli celler. Merk at to plasmider co uttrykke menneskelige Cul1•Rbx1 i E. coli celler er beskrevet i detalj i en tidligere rapport20.
    1. Legge til en DNA sekvens koding "LPETGGHHHHHH" (sortase-hans6 -koden) 3 slutten av Cul1 koding gjennom standard PCR og kloning metoder21,22.
    2. Sekvens av nye plasmider for å bekrefte genet innsatsen er nøyaktig.
  2. Co express Cul1sortase•Rbx1 i E. coli celler. Metoden er avledet fra en tidligere rapport20.
    1. Mix 100 ng hver av to plasmider med BL21 (DE3) kjemisk kompetent celler for co transformasjon bruke varmen sjokk metoden23. Vokse celler i LB agar plate inneholder 100 µg/mL ampicillin og 34 µg/mL chloramphenicol på 37 ° C over natten.
    2. Vaksinere 50 mL av LB kultur med fersk transformert kolonier og vokse over natten på 37 ° C med 250 rpm risting. Dette gir en startkulturer.
    3. Vaksinere 6 flasker, hver med 1 L LB medium, for med 5 mL startkulturer hver og vokse på 37 ° C med 250 rpm risting til OD600 er ~ 1.0. Cool kulturen til 16 ° C og legge isopropyl-β-D-thiogalactoside (IPTG) til 0.4 mM. Hold kulturen på 16 ° C over natten med 250 rpm risting.
    4. Høste E. coli cellene til sentrifugering 5000 x g i 15 min og samle celle pellets i 50 mL konisk rør.
      Merk: Cellen pellets kan behandles for protein rensing eller være frosset om-80 ° C før du fortsetter til protein rensing trinn.
  3. Rensing av Cul1sortase•Rbx1 kompleks. Denne metoden er avledet fra en tidligere rapport20.
    1. Legge til 50 mL av lyseringsbuffer (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, 10% glyserol, 1 tavle av protease hemmer cocktail pH 7.6) pellet E. coli celler uttrykke Cul1sortase•Rbx1.
    2. Lyse cellene i isen med sonication på 50% amplitude. Veksle mellom 1 sekund og 1 sekund på og kjøre på 3 minutter.
    3. Gjenta trinn 2.3.2 2-3 x.
    4. Overføre cellen lysate til en 50-mL sentrifugering rør og fjerne celle rusk ved sentrifugering 25.000 x g i 45 minutter.
    5. Inkuber klart cellen lysate med 5 mL av glutation perler ved 4 ° C i 2 timer.
    6. Sentrifuge perler-lysate blandingen på 1500 x g i 2 minutter på 4 ° C. Fjerne nedbryting.
    7. Vask perler med 5 mL lyseringsbuffer (med ingen proteasehemmere) og fjern nedbryting etter sentrifugering 1500 x g i 2 minutter på 4 ° C.
    8. Gjenta trinn 2.3.7 2 x.
    9. Legge til 3 mL lyseringsbuffer vasket perler og overføre perle gjødsel i en tom kolonne.
    10. Legge til 5 mL av elueringsbufferen (50 mM Tris-HCl, 200 mM NaCl, 10 mM redusert glutation, pH 8.0) i kolonnen. Ruge på 10 min og samle eluate.
    11. Gjenta trinn 2.3.10 3-4 x.
    12. Legge til 200 µL av 5 mg/mL trombin (se Tabell of Materials) til eluate fra glutation perler og ruge over natten på 4 ° C.
      Merk: Protokollen kan pauses her.
    13. Fortynne protein prøven med Buffer A (25 mM HEPES, 1 mM DTT, 5% glyserol, pH 6,5) tredoblet.
    14. Equilibrate en cation exchange kromatografi kolonne (se Tabell for materiale) på et FPLC system med Buffer A.
    15. Last protein prøven kolonnen equilibrated cation exchange Ture på en 0,5 mL/min flow rate.
    16. Elute protein med en gradient NaCl i 40 mL ved å blande Buffer A og 0-50% Buffer B (25 mM HEPES, 1 M NaCl, 1 mM DTT, 5% glyserol, pH 6,5) på en 1 mL/min flow rate.
    17. Sjekk eluted proteinet i forskjellige fraksjoner bruker SDS-side24.
      Merk: Protokollen kan pauses her.
    18. Basseng eluate fraksjoner som inneholder Cul1sortase•Rbx1.
    19. Konsentrere grupperte Cul1sortase•Rbx1 prøven til 2,5 mL av passerer bufferen gjennom en ultrafiltrasjon membran (30 kDa cutoff).
  4. Legge til AMC C-terminus av Cul1 gjennom sortase-mediert transpeptidation21,22.
    1. Endre bufferen i Cul1sortase•Rbx1 prøven til sortase buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7.5) bruker en avsalting kolonne (se Tabell for materiale).
      1. Equilibrate en avsalting kolonne med 25 mL sortase buffer.
      2. Legg 2,5 mL av Cul1sortase•Rbx1 prøve i kolonnen. Kast gjennomflytsenhet.
      3. Elute prøven med 3,5 mL sortase buffer. Samle gjennomflytsenhet.
    2. Legg 100 µL av 600 µM renset sortase A løsning og 10 µL av 25 mM GGGGAMC peptid i 900 µL av Cul1sortase•Rbx1 løsningen i sortase buffer. Inkuber reaksjonsblandingen på 30 ° C i den mørke natten. Merk at dette skrittet vil generere Cul1AMC•Rbx1.
      FORSIKTIG: Fluorescerende fargestoffer er følsomme for lys, så unngå å utsette dem til omgivelseslyset under protein og eksempel utarbeidelsen som mulig.
      Merk: Protokollen kan pauses her.
    3. Legge til 50 µL av Ni-NTA agarose perler reaksjonsblandingen og ruge ved romtemperatur for 30 min.
    4. Pellets Ni-NTA agarose perler med sentrifugering 5000 x g i 2 minutter og samle nedbryting.
    5. Equilibrate en størrelse utelukkelse kromatografi kolonne (se Tabell for materiale) med buffer (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glyserol) på FPLC systemet.
    6. Laste alle Cul1AMC•Rbx1 eksempel på kolonnen størrelse utelukkelse kromatografi. Elute med 1,5 x kolonnen volum bufferen.
    7. Sjekk eluate fraksjoner av SDS side24.
    8. Pool eluate fraksjoner som inneholder Cul1AMC•Rbx1.
    9. Måle protein konsentrasjonen med sin absorbansen på 280 nm med et spektrofotometer.
    10. Aliquot protein løsningen og butikk på-80 ° C.
      Merk: Protokollen kan pauses her.

3. forberedelse av FlAsHCand1, bånd acceptor protein

Merk: De fleste av trinnene i denne delen er det samme som trinn 2. Vilkår som avviker er beskrevet i detalj nedenfor.

  1. Konstruere plasmider for å uttrykke menneskelige TetraCysCand1 i E. coli celler.
    1. Legge til DNA sekvensen koding "CCPGCCGSG" (tetracysteine/TetraCys-koden) før 15th aminosyren av Cand1 gjennom vanlige PCR25 (primer sekvenser: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. Inn en pGEX-4T-2 vektor PCR produktet. Sekvens plasmider for å bekrefte genet innsatsen er nøyaktig og i rammen.
  2. Ekspress TetraCysCand1in E. coli celler på samme måte som skritt 2.2, bortsett fra at plasmider er forvandlet til Rosetta kompetent celler.
  3. Rensing av TetraCysCand1 fra E. coli celler.
    1. Lyse E. coli celle pellets og ekstra TetraCysCand1using glutation perler. Fremgangsmåten er den samme som trinn 2.3.1–2.3.12.
    2. Fortynne protein eluate fra glutation perler med Buffer C (50 mM Tris-HCl, 1 mM DTT, 5% glyserol, pH 7.5) av tre kaster. Equilibrate en anion exchange kromatografi kolonne (se Tabell for materiale) på FPLC system med Buffer C og Last utvannet protein prøven på en 0,5 mL/min flow rate.
    3. Elute protein med en gradient NaCl i 40 mL ved å blande Buffer C og 0-50% Buffer D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, 5% glyserol, pH 7.5) på en 1 mL/min flow rate. Kontroller eluted proteinet i forskjellige fraksjoner bruker SDS-side24og basseng fraksjoner som inneholder TetraCysCand1. Merk at TetraCysCand1 har et større oppbevaring volum enn gratis GST.
    4. Konsentrere grupperte TetraCysCand1 prøven ved å sende bufferen gjennom en ultrafiltrasjon membran (30 kDa cutoff).
    5. Equilibrate størrelse utelukkelse kromatografi kolonnen med merking buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, 5% glyserol) på FPLC systemet. Last TetraCysCand1 eksempel (500 µL hver gang) og sjekk eluate fraksjoner av SDS side24.
    6. Samle alle fraksjoner som inneholder TetraCysCand1 og konsentrere protein til ~ 40 µM ved bestått bufferen gjennom en ultrafiltrasjon membran (30 kDa cutoff). Beregne protein konsentrasjonen med sin absorbansen på 280 nm. Lagre protein som 50 µL dele på-80 ° C.
      Merk: Protokollen kan pauses her.
  4. Utarbeidelse av FlAsHCand1.
    1. Legge 1 µL av FlAsH løsning (se Tabell of Materials) til 50 µL TetraCysCand1 løsning.
    2. Bland godt og ruge blandingen ved romtemperatur i mørket 1-2 h å få FlAsHCand1.
      Merk: Protokollen kan pauses her.

4. forberedelse av Cand1, bånd chase protein

Merk: Protein forberedelse protokollen er lik trinn 3 med følgende modifikasjoner.

  1. Koding sekvensen av full lengde Cand1 inn pGEX-4T-2 vektoren.
  2. Endre bufferen i trinn 3.3.5 en buffer som inneholder 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glyserol.
  3. Eliminere trinn 3.3.7 og 3.3.8.

5. test og Bekreft bånd analysen

  1. Forberede bånd bufferen som inneholder 30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL ovalbumin, pH 7.6, og bruke ved romtemperatur.
  2. Teste båndet mellom Cul1AMC•Rbx1 og FlAsHCand1 på en fluorimeter.
    1. Legg til Cul1 i 300 µL bånd bufferen,AMC•Rbx1 (bånd donor) til en siste konsentrasjon av 70 nM. Overføre løsningen til søppel.
    2. Sted cuvette i prøven innehaveren av en fluorimeter. Opphisse prøven med 350 nm eksitasjon lys og skanning utslipp signalene fra 400 nm 600 nm 1 nm trinn på.
    3. Gjenta trinn 5.2.1 Oppgi men endre Cul1AMC•Rbx1 til FlAsHCand1 (bånd acceptor). Skanne FlAsHCand1 eksempel på samme måte som i trinn 5.2.2.
    4. (Valgfritt) Opphisse FlAsHCand1 med 510 nm eksitasjon lys, og Skann utslipp signalet fra 500 nm til 650 nm.
    5. Legg til begge Cul1 i 300 µL bånd buffer,AMC•Rbx1 og FlAsHCand1 til en siste konsentrasjon av 70 nM. Analysere eksempel på samme måte som i trinn 5.2.2.
  3. Bekrefte båndet mellom Cul1AMC•Rbx1 og FlAsHCand1 ved å legge til chase (umerket Cand1) protein (Figur 3 c).
    1. Legg til 70 i 300 µL bånd bufferen, nM Cul1AMC•Rbx1 og 700 nM Cand1. Skanne eksempel utslipp som i trinn 5.2.2.
    2. Legg til 70 i 300 µL bånd bufferen, nM FlAsHCand1 og 700 nM Cand1. Skanne eksempel utslipp som i trinn 5.2.2.
    3. Legg til 70 i 300 µL bånd bufferen, nM Cul1AMC•Rbx1 og 70 nM FlAsHCand1, og Inkuber prøven ved romtemperatur for 5 min. Deretter legger 700 nM Cand1, og umiddelbart etter tillegg, skanne eksempel utslipp som i trinn 5.2.2). Merk at dette trinnet er lik trinn 5.2.5.
    4. I 300 µL bånd buffer, fortløpende legge 70 nM Cul1AMC•Rbx1, 700 nM Cand1 og 70 nM FlAsHCand1. Inkuber prøven ved romtemperatur for 5 min, og Skann eksempel utslipp som i trinn 5.2.2. Merk at dette er jakten prøven (grønn linje i Figur 3 c).

6. måle association rate konstant (k) av Cul1•Cand1

Merk: Detaljer om opererer en stoppet-flow fluorimeter har blitt beskrevet i en tidligere rapport26.

  1. Forberede stoppet-flow fluorimeter måling.
    1. Slå på stoppet-flow fluorimeter i henhold til produsentens instruksjoner.
    2. Angi magnetisering lys på 350 nm og bruke et bånd-pass filter som kan 450 nm utslipp lys skjedde og blokkerer 500-650 nm utslipp lys.
    3. Holde eksempel ventilene fylle der, og koble en 3 mL sprøyte fylt med vann. Vask to sample sprøyter (A og B) med vann ved å flytte utvalget sprøyte stasjonen opp og ned flere ganger. Forkaste alle vannet som brukes i dette trinnet.
    4. Holde eksempel ventilene fylle der, og koble en 3 mL sprøyte fylt med bånd buffer. Vask to sample sprøyter med bånd bufferen ved å flytte utvalget sprøyte stasjonen opp og ned flere tid. Forkaste alle bånd bufferen som brukes i dette trinnet.
  2. Ta kontroll mål (figur 4C).
    1. Koble en 3 mL sprøyte og Legg i sprøyte A med 100 nM Cul1AMC•Rbx1 i bånd bufferen. Slå eksempel ventilen til kjøre posisjon.
    2. Koble en 3 mL sprøyte og Legg i sprøyten B med bånd bufferen. Slå eksempel ventilen til kjøre posisjon.
    3. Bruke Kontrollpanelet under Hent i programvaren for å ta fem skudd (mix like volum av prøver fra sprøyten A og sprøyte B) på den stoppet-flow fluorimeter uten å registrere resultatene.
    4. Åpne Kontrollpanelet under Hent i programvaren, og program til posten utslipp av Cul1AMC over 60 s. Så ta et eneste skudd.
    5. Gjenta trinn 6.2.4 2 x.
    6. Vise eksempel ventilen å fylle stillingen. Tom sprøyte B og vask med bånd bufferen.
  3. Mål observert association rate konstanter (kobs) av Cul1•Cand1 (figur 4B).
    1. Holde prøven i sprøyten A lik trinn 6.2.1.
    2. Koble en 3 mL sprøyte og Legg i sprøyten B med 100 nM FlAsHCand1 i bånd bufferen. Slå eksempel ventilen til kjøre posisjon.
    3. Bruk Kontrollpanelet under Hent i programvaren for å ta fem skudd uten å registrere resultatene.
    4. Åpne Kontrollpanelet under Hent i programvaren, og program til posten utslipp av Cul1AMC over 60 s. Så ta et eneste skudd.
    5. Gjenta trinn 6.3.4 2 x.
    6. Tom sprøyte B og vask med bånd bufferen.
    7. Gjenta trinn 6.3.1–6.3.6 flere ganger med økende konsentrasjoner av FlAsHCand1 i bånd bufferen.
    8. Passe endringen (reduksjon) i fluorescerende signaler målt over tid fra hvert skudd til en enkelt eksponentiell kurve. Dette vil gi kobshver måling, og enheten er s-1. Merk at grunnlaget for denne beregningen er også omtalt i en tidligere rapport27.
  4. Beregn gjennomsnittet og standardavviket for kobsfor hver FlAsHCand1 konsentrasjon brukes. Tegne den gjennomsnittlige kobsmot Cand1 konsentrasjon (Figur 4 d), og stigningstallet for linjen representerer den k av Cul1•Cand1, med en enhet av M-1 s-1.

7. måle dissosiasjon rate konstant (kav) av Cul1•Cand1 i nærvær av Skp1•F-box protein.

Merk: Dette trinnet er lik trinn 6, med følgende endringer.

  1. I sprøyten A, under fylle stillingen, laste en løsning av 100 nM Cul1AMC•Rbx1 og 100 nM FlAsHCand1 i bånd bufferen. Slå eksempel ventilen til "Kjøre" posisjon.
  2. I sprøyten B, under fylle stillingen, laste en løsning av Skp1•Skp2 (forberedt etter en tidligere rapport20). Slå eksempel ventilen til "Kjøre" posisjon.
  3. Åpne Kontrollpanelet under Hent i programvaren, og program til posten utslipp av Cul1AMC over 30 s. Så ta et eneste skudd. Fluorescerende signalene øke over tid etter miksing løsninger fra sprøyten A og sprøyte B (figur 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Teste båndet mellom Cul1AMC og FlAsHCand1, vi først bestemt utslippsintensitet 70 nM Cul1AMC (giveren) og 70 nM FlAsHCand1 (acceptor), henholdsvis (figur 3A-C, blå linjer). I hver analyse, bare én utslipp toppen var nåtid og utslipp av FlAsHCand1 var (acceptor) lav. Når 70 nM i Cul1AMC og FlAsHCand1 ble blandet for å generere bånd, to utslipp toppene var tilstede i utslipp spectra, og toppen av Cul1AMC ble lavere og toppen av FlAsHCand1 ble høyere (figur 3A -C, røde linjer). Når den fulle Cand1 ble brukt for bånd, donor toppen viste en 10% reduksjon i intensitet (figur 3A, rød linje), og når Cand1 med sin første helix avkortet ble brukt, ble reduksjon av donor peak intensitet økt til 30% (figur 3B D, røde linjer), tyder på høyere bånd effektivitet. Bekrefte at signalet endringene var resulterte fra bånd mellom Cul1AMC og FlAsHCand1, 70 nM Cul1AMC (giveren) ble blandet med 700 nM umerkede Cand1 (chase) og 70 nM FlAsHCand1 (acceptor). Som et resultat giveren toppen ble totalrestaurert og acceptor toppen ble redusert (Figur 3 c, grønn linje), som bekreftet at det observerte båndet er avhengig av dannelse av Cul1AMCFlAsHCand1 komplekset. Legge til 700 nM Skp1•Skp2 til 70 nM Cul1AMCFlAsHCand1 også ferdig restaurert donor toppen (figur 3D, grønn linje), antyder at Cul1•Cand1 komplekset ble fullstendig forstyrret av Skp1•Skp2 på likevekt.

Figure 3
Figur 3: representant bånd analysen for Cul1•Cand1 komplekse formasjonen. Eksemplene i bånd bufferen (30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL ovalbumin, pH 7.6) var begeistret på 350 nm og utslippene ble scannet fra 400 nm til 650 nm. (A) utslipp spektra av 70 nM Cul1AMC, 70 nM FlAsHCand1 (full), og en blanding av to (bånd). Cand1 (full) står for full lengde Cand1. (B) utslipp spektra av 70 nM Cul1AMC, 70 nM FlAsHCand1, og en blanding av to (bånd). Cand1 med sin første helix slettet ble brukt i dette eksperimentet og etterpå. (C) utslipp spektra av 70 nM Cul1AMC, 70 nM FlAsHCand1, en blanding av to (bånd), og jakten kontroll på bånd (Chase). Chase utvalget inneholdt 70 nM Cul1AMC, 700 nM Cand1 og 70 nM FlAsHCand1. (D) utslipp spektra av 70 nM Cul1AMC, en blanding av 70 nM Cul1AMC og 70 nM FlAsHCand1 (bånd) og 700 nM Skp1•Skp2 lagt til 70 nM Cul1AMCFlAsHCand1 komplekset. I hver tomten, utslipp signalene var normalisert til utslipp av 70 nM Cul1AMC ved 450 nm. Klikk her for å se en større versjon av dette tallet.

For å måle den k av Cul1•Cand1 med etablerte bånd analysen ved å overvåke reduksjon av donor signalet over tid på stoppet-flow fluorimeter, vi først testet og fastslått konsentrasjonen av proteinet skal brukes. Når 5 nM i Cul1AMC og FlAsHCand1 ble brukt, lite signalet endres ble observert (figur 4A), mens, når konsentrasjonen av hver protein ble økt til 50 nM, reduksjon av signalet over tid ble observert ( Figur 4B) og denne endringen ble avskaffet Hvis bufferen uten FlAsHCand1 ble lagt (figur 4C). Derfor 50 nM Cul1AMC ble brukt for videre analyser, og en rekke observert association rate konstanter (kobs) ble målt ved å blande 50 nM Cul1AMC med økende konsentrasjoner av FlAsHCand1. Kobs for hvert eksperiment ble beregnet ved å montere peker til en enkelt eksponentiell kurve, og kobs fra samme FlAsHCand1 konsentrasjonen var gjennomsnitt. Ved plotting av gjennomsnittlig kobs med Cand1 konsentrasjonen og utføre en lineær regresjon (Figur 4 d), den k var bestemt7,27.

Figure 4
Figur 4: representant måling av foreningen rate konstant. (A) fluorescens 5 nM Cul1AMC ble overvåket av en stoppet-flow fluorimeter over tid på tillegg 5 nM FlAsHCand1. (B) fluorescens 50 nM Cul1AMC ble overvåket av en stoppet-flow fluorimeter over tid etter tillegg av 50 nM FlAsHCand1. (C) fluorescens 50 nM Cul1AMC ble overvåket av en stoppet-flow fluorimeter over tid etter tillegg av bånd bufferen. (D) k for Cand1 binding til Cul1. kobs på Cul1•Cand1 i ulike konsentrasjoner av Cand1 tegnes. Lineær skråningen gir k på 1,8 x 107 M-1 s-1. Feilfelt representerer ±SEM; n = 4. Alle prøver ble utarbeidet i bånd bufferen og spent på 350 nm. Filtere båndpass ble brukt til å samle inn signaler fra AMC og utelukke signaler fra FlAsH. Ingen data ble normalisert. Klikk her for å se en større versjon av dette tallet.

Ligner måling av k, vi målt observert dissosiasjon rate konstant av Cul1•Cand1 ved å overvåke økning (gjenopprette) av donor signalet over tid på stoppet-flow fluorimeter. Cul1AMC og FlAsHCand1 ble blandet først, og deretter Skp1•Skp2 ble lagt til den prefabrikkerte Cul1AMCFlAsHCand1 på stoppet-flow fluorimeter. Donor signalet økt raskt, og det avslørt et kobs på 0,4 s-1 (figur 5). I kontrast, når bufferen ble lagt til den prefabrikkerte Cul1AMCFlAsHCand1, ingen signal økning ble observert, tyder på rask dissosiasjon av Cul1•Cand1 ble utløst av Skp1•Skp2.

Figure 5
Figur 5: representant måling av dissosiasjon rate konstant. Endringen i donor fluorescens versus tid ble målt etter tillegg av 150 nM Skp1•Skp2 eller bånd bufferen til 50 nM Cul1AMCFlAsHCand1 kompleks. Signalet endringer var skikket til en enkelt eksponentiell kurve, og det gir observert dissosiasjon rate konstant av 0,4 s-1. Eksperimentelle forhold var lik som beskrevet i Figur 4. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

BÅND er et fysisk fenomen av stor interesse for å studere og forstå biologiske systemer19. Her presenterer vi en protokoll for testing og bruk av bånd bindende kinetics to samspill proteiner. Når du utformer bånd, vi vurdert tre viktige faktorer: spectral overlappingen mellom donor utslipp og acceptor eksitasjon, avstanden mellom de to fluorophores og dipol retningen av fluorophores28. Velg fluorophores for bånd, vi kledde eksitasjon og utslipp spektra av fluorophores, og søkte på fluorophores som utslipp topper skilles godt mens utslipp spekteret av donor overlapper betydelig magnetisering spekteret av acceptor (figur 2). For å optimalisere interfluorophore avstand og retning, vi brukte krystallstruktur for hjelp, og vi vurdert hovedsakelig knytter fluorophores til protein termini, hovedsakelig på grunn av lavere risikoen av forstyrre proteinstruktur og aktivitet. Fordi avstanden mellom N-terminus av Cand1 (Cand1NTD) og C-terminus av Cul1 (Cul1CTD) er kortere enn avstanden mellom C-terminus av Cand1 og N-terminus av Cul1 (figur 1), bestemte vi oss å merke Cand1NTD og Cul1CTD. Fordi vi hadde vært i stand til å oppnå 80-90% merking effektiviteten av N-terminus et protein med tetracysteine koden25, valgte vi å merke Cand1NTD med FlAsH gjennom tetracysteine koden. Vi først merket Cul1CTD med cyan fluorescerende protein (CFP), som har noen fordeler fremfor AMC. Først, det er en genetisk kodet fluorescerende kode, så det ikke krever ytterligere merking prosessen eller trinn som renser merket fluorescerende protein fra forløperen sin umerkede. Andre CFP er lysere enn AMC, og derfor tilbyr høyere analysen følsomhet (se diskusjon nedenfor). Tredje har CFP et større spekter overlapper med FlAsH, potensielt gir mer effektiv bånd med FlAsH. Til tross for disse fordelene, men er CFP protein mye større enn AMC koden, som kan forstyrre protein konformasjon og inter molekylær samhandlingen. Faktisk vi ikke observerer bånd mellom Cul1CFP og FlAsHCand1 i vår test, som trolig på grunn av utilstrekkelig dipol retning eller avbrudd i Cul1-Cand1 samspillet av CFP koden. Vi deretter merket Cul1CTD med AMC, og vi observerte bånd mellom Cul1AMC og FlAsHCand1. Første bånd med full lengde Cand1 førte til 10% reduksjon av donor utslipp (figur 3A). Vi fant videre at sletter den første helix av Cand1, avstanden mellom Cul1 og Cand1 er forkortet fra 26.8 Å til 15.5 Å (figur 1), og Cand1 mangler den første helix gitt en mye sterkere bånd med Cul1, viser 30% reduksjon av donor utslipp Peak (figur 3B). I tillegg kan en forbedrer bånd effektiviteten ved å velge en donor fluorophore med høyere quantum avkastning og en acceptor fluorophore med en større utryddelse koeffisient.

Karakteristisk for bånd er at når bånd oppstår, utslipp av donor fellingene og utslipp av acceptor øker (figur 3B). Men fluorophores kan vise følsomhet til miljøet, og dermed utslippsintensiteten kan endres når en annen protein er tilstede, selv i fravær av bånd29. Bekrefte at endrede utslipp vi observerte skyldes bånd mellom Cul1AMC og FlAsHCand1, vi lagt 10 x overskytende beløp umerkede acceptor protein (Cand1) som en jakt. Jakten konverterer utslipp av donor og acceptor tilbake til det normale (Figur 3 c), som støtter som endret utslipp av Cul1AMC og FlAsHCand1 avhenger av protein-protein samhandling, og derfor dette resultatet bekrefter at vi etablert en bånd-analysen som rapporterer foreningen og av Cul1•Cand1. Videre har vi lagt til Skp1•Skp2 til prefabrikkerte Cul1AMCFlAsHCand1 komplekse, og Skp1•Skp2 er kjent for å kunne forstyrre Cul1-Cand1 interaksjon6. Vi fant ut at båndet mellom Cul1AMC og FlAsHCand1 forsvant (figur 3D, grønn linje) og utslipp spektrum ble lik utslipp spekteret av chase prøven (Figur 3 c, grønn linje), tyder Cul1AMCFlAsHCand1 er atskilt av Skp1•Skp2 og Cul1AMC viser ikke unormal utslipp når Skp1•Skp2.

Ved å overvåke endringen i donor utslipp, kan vi direkte observere foreningen og av Cul1AMCFlAsHCand1 på en stoppet-flow fluorimeter. Stoppet-flow-systemet fungerer ved å injisere reaktantene til en blande kammer å raskt blande reaktantene og stoppe flyten når de blandet reaktantene flyttes i en observasjon kammer5. Signalet deteksjon starter vanligvis 1-2 millisekunder (ms) etter blanding, som muliggjør studere interaksjoner som forekommer millisekunder tidsskalaen. Men når halveringstiden av observerte reaksjonen er kortere enn nødvendig å blande reaktantene på en bestemt enhet, dette er ikke sensitive nok og er ikke lenger aktuelle30. Stoppet-flow analyser har blitt brukt til å bestemme prisen konstanter 10-6– 106 s-1 for første orden reaksjoner, og 1-109 M-1 s-1 for andre-ordens reaksjoner5. For å få pålitelig måling av kinetic parametere bruke stoppet-flow fluorimeter, er en betydelig endring i fluorescerende signalet mellom start- og likevekt punktene nødvendig. Vi brukte FlAsH-Cand1 mangler den første spiralen som acceptor, fordi det gir bedre bånd med Cul1AMC, og vi testet konsentrasjonen av proteiner som skal brukes for måling. Når 5 nM i Cul1AMC og FlAsHCand1 ble blandet, ingen endring i Cul1AMC signalet ble observert (figur 4A), tyder denne konsentrasjonen er utilstrekkelig for målingen. Når protein konsentrasjoner ble økt til 50 nM, nedgangen i Cul1AMC signalet over tid ble tilsynelatende (figur 4B), og denne endringen oppstår ikke når acceptor protein var fraværende (figur 4C). Basert på dette resultatet, vi brukte Cul1AMC på 50 nM concertation å måle den k for Cul1•Cand1. Konsentrasjonen av donor protein brukes til å måle kan være forskjellige fluorophores brukes. For eksempel når Cul1 er merket med CFP, 5 nM i CFPCul1 er tilstrekkelig for måling av k6. Derfor optimal konsentrasjon av proteinet skal testes for hvert bånd par, og i prinsippet lysere fluorophores tillater bruk av lavere protein konsentrasjoner og gir bedre signal-til-støy forholdet31.

For å studere protein-protein interaksjoner av bånd, krever det feste fluorophores proteiner til riktige posisjoner uten å forstyrre proteinstruktur og aktivitet, som potensielt begrenser bruken av bånd. I denne protokollen, vi merket den N-terminalen av Cand1 med en tetracysteine tag, som spesifikt bindes FlAsH fargestoff og FlAsH fargestoff blir fluorescerende bare når det binder seg til målet protein32. Vi merket Cul1 ved hjelp av sortase-mediert transpeptidation, som festes en kort peptid bærer en fluorophore i sortase-koden på C-terminus Cul121,22. Merking effektiviteten er > 80% med tetracysteine koden, og nesten 100% med sortase-hans6 koden etter fjerning Ureagert protein bruker Ni-NTA perler (trinn 2.4.3–2.4.4). Begge metodene legger til noen aminosyrer målet protein, innføre minimale endringer protein strukturen. Lignende tilnærminger, slik som transglutaminase anerkjennelse sekvens (Q-koden)33 og ybbR tag34, kan også brukes til å merke målet protein på en områdespesifikk måte. I tillegg kan photostability av fluorescerende fargestoffer også begrense bruken av bånd. Gjentakende eller lang eksponering for eksitasjon lys kan føre til photobleaching av fluorophore, som resulterer i unøyaktig kvantifisering resultater35. Giver og acceptor proteiner bør derfor beskyttes mot lys under forberedelse og lagring trinnene. Når du bruker bånd måle hendelser som forekommer sakte, i stedet for kontinuerlig overvåke endringen i donor utslipp over tid, kort målinger av donor utslipp bør tas med lengre tidsintervaller og prøven bør holdes i mørket under hele eksperiment6.

BÅND er følsom og kvantitativ, har det blitt et viktig verktøy for å studere samspillet mellom makromolekyler. Denne protokollen gir et eksempel på bruk av bånd dynamikken i et protein kompleks i løsningen. BÅND er også brukt live cellen å studere molekylære interaksjoner i levende celler36, som er kraftig i avslørende dynamikken i protein avhengige fysiologiske forhold. Videre kan bånd også brukes på enkelt-molekylet nivå for å studere real-time dynamikken i macromolecular komplekser37,38, gir innsikt i conformational endring av komplekset. For å forbedre effektiviteten og påvisning av bånd, fluorophores og biosensors med forbedret lysstyrke og photostability er av stor interesse, som er aktivt utviklet og studerte28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi takker Shu-Ou Shan (California Institute of Technology) for innsiktsfulle diskusjon om utviklingen av bånd analysen. M.G., Y.Z. og X.L. ble finansiert av oppstart penger fra Purdue University til Y.Z. og X.L.This arbeidet var støttes delvis av frø stipend fra Purdue University Center for plante biologi.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics