Лентивирусные вектор платформа для эффективной доставки Epigenome-инструменты для редактирования в человека индуцированных плюрипотентных стволовых клеток болезни моделей

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Целевые epigenome ДНК, редактирования представляет собой мощный терапевтический подход. Этот протокол описывает производства, очищения и концентрации все-в-одном лентивирусные векторы, укрывательство трансген ТРИФОСФАТЫ dCas9-DNMT3A для epigenome редактирование приложений в человеческое индуцированных плюрипотентных стволовых клеток (hiPSC)-производных нейронов.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Использование производных hiPSC клеток представляет собой ценный подход к изучению человека нейродегенеративных заболеваний. Здесь мы описываем оптимизированный протокол для дифференциации hiPSCs, производного от пациента с постулатов Локус гена (SNCA) альфа synuclein в болезнь Паркинсона (PD)-отношение дофаминергической нейрональных популяций. Накопление доказательств показывает, что высокий уровень SNCA каузативных для развития PD. Признавая неудовлетворенных необходимо создать новые терапевтические подходы для PD, особенно направленными на регуляцию экспрессии SNCA , мы недавно разработанных ТРИФОСФАТЫ/dCas9-ДНК Метилировани-на базе системы эпигеномно модулировать транскрипции SNCA , обогащая уровень метилирования в регионе нормативных Интрон 1 SNCA . Чтобы доставить система, состоящая из мертвых (отключен) версия Cas9 (dCas9) сливается с каталитического домен 3A фермента ДНК метилтрансфераза (DNMT3A), используется лентивирусные вектор. Эта система применяется к ячейкам с постулатов Локус SNCA и уменьшает SNCA-мРНК и уровни белка, около 30% через целевые метилирования Интрон SNCA 1. Доработаны Даунрегуляция SNCA уровней спасает сотовой фенотипов, связанных с болезнью. В текущем протоколе мы стремимся описать пошаговую процедуру для дифференциации hiPSCs в нейронных прогениторных клеток (НПС) и создание и проверка пиросеквенирования анализов для оценки профиля метилирования в SNCA Интрон 1. Более подробно изложить человека ТРИФОСФАТЫ/dCas9 система, используемая в этих экспериментах, этот протокол описывает, как производить, очищают и сконцентрировать лентивирусные векторы и подчеркнуть их пригодности для epigenome - и -изменения генома приложений, использующих hiPSCs и НПС. Протокол может быть легко адаптирована и могут быть использованы для производства высокого титра lentiviruses для приложений в vitro и in vivo.

Introduction

Epigenome редактирования платформ недавно была разработана для любых последовательностей ДНК в регионах, которые контролируют ген выражение1,2. Созданные инструменты редактирования epigenome предназначены для (i) регулируют транскрипцию, (ii) изменять Посттрансляционная гистона модификации, (iii) изменения метилирования и (iv) модулировать регуляторные элементы взаимодействия. Подход к якорь транскрипция/хроматина модификаторы списанного (мертвый) Cas9 (dCas9) поднял из ранее развитых epigenome редактирования платформ, таких как цинк палец белки (ZFPs) и транскрипции активатор как эффекторов (сказки), укрывательство мощным transcriptional эффекторных домен (Эд) сливается с дизайном ДНК связывающий домен (DBD)3. Результаты желаемого фенотип, такие как активация или репрессий определяется эффекторные молекулы, привязанный к эндогенной локусов (рис. 1). Для создания программируемой transcriptional активаторы, dCas9/gRNA модули связаны с VP164,5,6 (рис. 1а), вирусные активации домена, новобранцев Pol II и механизмы общего транскрипции. Модификации этой системы включает VP64, Тетрамер VP16 доменов, обеспечивая еще более надежной активации ставка5,6. Система успешно работает для того чтобы активировать кодирования и некодирующей регионов путем промоутеров и нормативных элементов. Важно отметить, что даже несмотря на то, что VP64 молекулы изменить структуру хроматина в целевом регионе непосредственно, он новобранцев хроматина модификаторы, которые связывают результаты осаждения активный (euchromatin) знаков, включая как H3/H4 ацетилирования и H3-K4 di / Tri метилирования5,6. В дополнение к VP64 субъединица p65 человека NF-κB комплекса были привязаны к dCas9/gRNA модуль7. Интересно привязывая Эти эффекторы в регионы вверх по течению транскрипции начала сайтов (тссс) и в пределах промоутеров приводит к сильным гена индукции. Тем не менее VP64 и p65 эффекторов можно также оказывают activatory эффекты во время связаны с регионов, расположенных ниже по течению, ТССС и дистальной усилители7,8. Для получения более надежной транскрипционный анализ ответа, несколько dCas9-VP64 или dCas9-p65 сплавливания нужно набираться для одной цели Локус9,10. Таким образом недавнее развитие активаторы следующего поколения, которые набору несколько доменов эффекторных одного dCas9-gRNA комплексом, таких как SunTag, привело к сильной активации возможности по сравнению с dCas9-VP64 фьюжн партнерам11 , 12. Улучшение transcriptional активации были получены через слияние VP64, Р65 и Rta (VPR), transactivation домена от гамма Герпесвирусы, C-конечная dCas913 (рис. 1A). Подобные системы ТРИФОСФАТЫ/dCas9 были разработаны для конкретных целевых объектов репрессий (рис. 1B).

Эндогенные гена репрессий с инженерии репрессор сплавливания можно добиться различных механизмов (рис. 1B). Было продемонстрировано, что ТРИФОСФАТЫ/dCas9 систем, связанных с репрессор DBD (даже без домена эффекторных/s), можно эффективно замолчать экспрессии генов в то время как привязанный к промоутер или вверх/вниз по течению TSS регионы3,6 ,14. Влияние на транскрипции обусловлено их пространственной помех привязки фактор транскрипции и обработки РНК-полимеразы. Тем не менее необходимы более всеобъемлющие подходы, как ген репрессии их пространственной помех только часто не достаточно для надежной глушителей. Последние разработки следующего поколения глушители на основе ТРИФОСФАТЫ/dCas9 систем перевозящих transcriptional репрессор домены (TRDs), модификаторы гистонов (H3-K9 ди-/ tri метилирования, H3-K27 ди-/ tri метилирования; H3-K36 ди-/ tri метилирования, H3/H4 диацетилморфина) и привело к строительству эпигеномные инструментов, позволяя более надежной, глушителей эффекты4,5,,1516, метилирование ДНК (CpG) 17,18,19,20. Было продемонстрировано, что набор эти эпигеномные модификаторов для ДНК может привести к формированию более закрытой и конденсированных хроматина, который обычно генерируют более мощным глушителей исход21,22. Наиболее часто глушителей домен, используется с DBDs — это связанные Krüppel box (краб)4,5. Набор фактора была продемонстрирована в соответствие с изменениями chromatin; Тем не менее механизмы этих изменений еще не должны быть проясненного16,17,18. Недавно было показано, что локализация краб ДНК может содействовать Ассамблея метилтрансфераза гистона SETDB1 и гистонов диацетилморфина (HDAC) NuRD комплексов, предлагая возможность того, что эти взаимодействия посредником формирования конденсацию хроматина и transcriptional глушителей3,13. В качестве альтернативного подхода эффекторные домены можно сливается с DBDs для создания пользовательских эпигеномные глушителей белка. Эта система непосредственно катализирует репрессивных ДНК знаки или изменения гистона.

Недавно использование синтетических ТРИФОСФАТЫ/dCas9 систем, привязанный к DNMT3A фермента был многоцелевых transcriptional дезактивации. DNMT3A катализирует метилирование ДНК, которая оказывает транскрипционный анализ репрессий на протяжении формирования гетерохроматин эндогенного генным стимуляторам и других регулирующих регионов (рис. 1B)18,20. McDonald et al.18 и войта et al.20 были первые авторы сообщить что метилирование ДНК может использоваться для epigenome-генов или репрессий, демонстрируя, что доставлено плазмида dCas9-DNMT3A системы фьюжн мощно может повысить метилирование цитозина вокруг18,ТП20. Макдональд и coworkers продемонстрировал, что занятости стратегия может привести к значительному сокращению (около 40%) в опухоль супрессирующем Гене CDKN2A мРНК уровнях18. Аналогичным образом ориентация региона unmethylated промоутера генов, Бах или IL6ST показывает увеличение метилирования CpG, что был коррелирует с сокращением вдвое выражение гена20. Наша лаборатория недавно многоцелевых использование метилирование ДНК для ослабления патологических результатов SNCA гиперэкспрессия (рис. 2)23. Стратегия основана на избирательное повышение метилирование ДНК в регионе Интрон 1 SNCA , как ранее сообщалось, чтобы быть hypomethylated в PD и деменции с Леви органов (ДЛБ) мозги24,25, 26. Этот hypomethylation связан с SNCA гиперэкспрессия, таким образом предлагая привлекательной мишенью для терапевтического вмешательства24,27,28. Недавно мы показали низкий уровень метилирования ДНК в SNCA Интрон 1 региона в hiPSC производные дофаминергической НИПы, полученную от PD пациента с SNCA постулатов23. Преимуществом этой экспериментальной модели является что NPC может быть надежно распространен в культуре или далее дифференцированной в зрелых нейронов, позволяя эффективный скрининг для выявления генетических факторов, которые посредником сотовой фенотипов, включая окислительного стресс и апоптоз29. Кроме того эта модель система позволяет ученым охарактеризовать развития событий, которые произошли до появления симптомов у больных. Кроме того hiPSC производные НИПы представляют собой прекрасный инструмент для тестирования клеточном и молекулярном пути, связанные с выражением генов. Важно отметить, что hiPSC производные НПС, в сочетании с технологией ТРИФОСФАТЫ/Cas9-epigenome искусство может значительно облегчить развитие «next-generation наркотиков» для многих нейродегенеративных заболеваний.

Чтобы уменьшить патологического уровня SNCA выражение, мы недавно разработали системы, основанной на человека, dCas9-DNMT3A синтез белка и gRNA специально целевой метилирования CpG внутри SNCA Интрон 1 (рисунок 2A)23. Этот протокол будет описывать лентивирусные вектор (LV) проектирование и производство в деталях. LVs являются эффективным средством доставки компонентов ТРИФОСФАТЫ/dCas9 по нескольким причинам, а именно: (i) их способности выполнять громоздкие ДНК вставляет, (ii) высокой эффективности преобразователя широкий спектр клеток, включая клетки деления и nondividing30 и (iii) их способность вызывать минимальное цитотоксических и иммуногенные ответы. Недавно мы обратились LV системы hiPSC производные дофаминергические нейроны от пациента с постулатов Локус SNCA и продемонстрировал терапевтический потенциал LVs для доставки epigenome редактирования метилирования инструменты23 ( Рисунок 2B). Действительно LV-gRNA/dCas9-DNMT3A системы вызывает значительное увеличение метилирование ДНК в регионе Интрон 1 SNCA . Этот рост соответствует снижением уровня мРНК и белка SNCA 23. Кроме того SNCA Даунрегуляция спасает PD-связанных фенотипы в SNCA постулатов/hiPSC производные дофаминергических нейронов (например, митохондриальной ROS производства и клеток жизнеспособности)23. Важно отметить, что мы показали, что сокращение в выражении SNCA LV-gRNA-dCas9-DMNT3A системы способны обратить вспять фенотипов, которые характерны для hiPSC производные дофаминергические нейроны от PD пациента, который нес SNCA постулатов, например митохондриальной ROS производства и клеток жизнеспособности23. Целью настоящего Протокола является 1) чтобы наметить протокол производства и концентрации LV платформу для создания высокой tittered вирусных препаратов и 2) описывают дифференцирование hiPSCs в NPC, рисунком стать зрелой дофаминергической нейроны31,32 и характеристика уровень метилирования целевого региона в рамках SNCA Интрон 1.

Лентивирусные платформы имеют значительное преимущество над самой популярной платформы вектор, а именно аденоассоциированный векторов (AAVs), который является бывший возможность разместить большие генетические вставки33,34. AAVs могут быть собраны в значительно более высокие урожаи, но обладают низким упаковки емкостью (< 4.8 КБ), ущерба для их использования для доставки все-в-одном ТРИФОСФАТЫ/Cas9 систем. Таким образом оно кажется, что рН будет выбор платформы приложений, участвующих в доставке ТРИФОСФАТЫ/dCas9 инструментов. Таким образом протокол, изложенные здесь будет ценным инструментом для исследователей, желающих эффективно передавать epigenome редактирования компонентов клеток и органов. Протокол также излагается стратегия для увеличения производства и выражения возможности векторов через изменения в СНГ элементов в вектор выражения кассеты30,35. Стратегия основана на романе система разработана и учился в нашей лаборатории и подчеркивается его способность производить вирусных частиц в диапазоне 1010 вирусных единиц (VU) / мл30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. системы проектирования и производства вирус

  1. Плазмиды проектирование и строительство
    Примечание: Строительство вектор LV-gRNA-dCas9-DNMT3A все-в-одном осуществляется с помощью производства- и оптимизированный выражение выражение кассеты, опубликованные Ортинский et al.30. Вектор кассеты носит повторение признание сайта транскрипционный фактор Sp1 и удаления состояние искусства в непереведенные (U3') региона терминал 3'-Лонг повторить30,(LTR) (рисунок 2A)36. Было установлено, что вектор позвоночника эффективно доставлять и выражая ТРИФОСФАТЫ/Cas930,35.
    1. Получить версию деактивировать (мертвых) SpCas9 (dCas9) через сайт Направленный мутагенез (данные не показаны). Замените клон, укрывательство D10A и H840A мутации в доменах каталитического HNH и RuvC фермента, соответственно, с активной Cas9 в pBK30129 путем обмена между фрагментами АИОД-BamHI (рис. 3).
    2. Получить домен каталитического DNMT3A от pdCas9-DNMT3A-eGFP (см. Таблицу материалы) путем усиления DNMT3A часть BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' BamHI-429/Л 5' - CTCTCCACTGCCGGATCCGG - 3' (рис. 3). Для того чтобы усилить региона, содержащие DNMT3A, используйте следующие условия: (1) 95 ° C 60 s, (2) 95 ° C 10 s, (3) 60 ° C для 20 s, (4) 68 ° C для 60 s. повторить условия 2-4 30 x. Для окончательного расширения используйте 68 ° C 3 мин и удерживайте 4 ° C.
    3. Клон DNMT3A фрагмент, усваивается энзима ограничения BamHI, на BamHI сайт модифицированных pBK301 вектора, перевозящих dCas9. Проверьте клонирования прямой Сэнгером последовательности. Обратите внимание, что привело плазмида затаивает трансген dCas9-DNMT3A-p2a-puromycin. Плазмида выражает gRNA лески от человека U6 промоутер (рис. 3).
    4. Замените puromycin Репортер ген Зеленый флуоресцентный белок (ГПУП) для создания dCas9-DNMT3A-p2a-GFP. Дайджест dCas9-DNMT3A-p2a-Puro плазмида с ФГОУ. Очищайте фрагмента вектор, с помощью метода очистки гель. Подготовьте insert, переваривание pBK201a (pLenti-GFP) с ФГОУ. Клонирование фрагмента ФГОУ в вектор. Результате плазмида pBK539 гавани dCas9-DNMT3A-p2a-GFP трансген (рис. 3).
  2. Культивирование клеток ГЭС 293T и покрытие клетки для transfection
    Примечание: Человеческих эмбриональных почки 293T (ГЭС 293T) клетки культивировали в полной высокой глюкозы Дульбекко модифицированная орла среднего (DMEM; 10% говядину телячьей сыворотки, 1 x антибиотик противогрибковое, 1 x пируват натрия, 1 x заменимая аминокислота, 2 мм L-глютамин) при 37 ° C с 5% CO 2. для воспроизводимости протокола, рекомендуется проверить телячьей сыворотки при переключении на другой много/партии. До шести 15 см пластины необходимы для лентивирусные производства.
    1. Используйте низкий проход клетки для начала новой культуры (ниже, чем проезд 20). После того, как клетки достигают 90%-95% слияния, аспирационная СМИ и осторожно промыть стерильной 1 x фосфат амортизированное saline (PBS).
    2. Добавить 2 мл трипсина-ЭДТА (0,05%) и проинкубируйте его при 37 ° C для 3-5 мин. Для инактивации диссоциации реагента, добавьте 8 мл полной DMEM высокой глюкозы и x-15 пипетки 10 x с 10 мл Серологические Пипетки для создания одной ячейки подвеска 4 х 106 клеток/мл.
    3. Для transfections пальто 15 см пластины с 0,2% желатина. Добавьте 22,5 мл среды высокого глюкозы и семян клетки путем добавления 2,5 мл суспензии клеток (всего ~ 1 x 107 клеток/плита). Инкубируйте пластины при 37 ° C с 5% CO2 , вплоть до 70%-80% слияния.
  3. Transfection клетки ГЭС 293T
    1. Готовить 2 x BES-амортизированное решение BBS и CaCl 1 M2, по данным Vijayraghavan и Кантор35. Фильтр решения, передавая их через фильтр 0,22 мкм и хранить их на 4 ° C. Трансфекция смеси должно быть ясно перед его добавлением к клеткам. Если смесь становится мутным во время инкубации, подготовьте свежие 2 x BBS (рН = 6.95).
    2. Подготовить смесь плазмида, использовать четыре плазмид, как указано (следующая смесь является достаточным для одной плиты 15 см): 37,5 мкг ТРИФОСФАТЫ/dCas9-передачи вектора (pBK492 [DNMT3A-Puro-NO-gRNA] или pBK539 [DNMT3A-GFP-NO-gRNA]); 25 мкг pBK240 (psPAX2); 12,5 мкг pMD2.G; 6.25 мкг pRSV-rev (рис. 4A). Рассчитать объем плазмид, основанный на концентрации и добавьте необходимые количества в коническую пробирку 15 мл. 312.5 мкл CaCl 1 М2 и принести окончательный объем до 1,25 мл, используя стерильные dd-H2O. осторожно добавить 1,25 мл раствора 2 x BBS во время vortexing смеси. Инкубируйте 30 мин при комнатной температуре. Клетки готовы к трансфекции после того, как они являются 70%-80% притока.
    3. Аспирационная СМИ и заменить его с 22,5 мл свежеприготовленные высокой глюкозы DMEM без сыворотки. Добавьте 2.5 мл смеси трансфекции каплям на каждой пластине 15 см. Вихрем пластины и инкубировать при 37 ° C с 5% CO2 на 2-3 ч.
    4. После 3 h добавьте 2,5 мл (10%) сыворотки на пластину и инкубировать на ночь при 37 ° C с 5% CO2.
    5. На 1 день после трансфекции, наблюдать клетки, чтобы убедиться, что нет или минимальным клеточную смерть и что клетки образуется вырожденная культуры (100%).
      1. Измените СМИ, добавив 25 мл свежеприготовленные DMEM и 10% сыворотки высокой глюкозы в каждой плиты.
    6. Инкубируйте при 37 ° C с 5% CO2 в течение 48 часов.
  4. Урожай вируса
    1. Собирать супернатант от всех transfected клеток и объединить их в 50 мл конические трубы. Центрифуга в 400 – 450 x g 10 мин фильтр супернатант через блок вакуумного фильтра 0.45 мкм. После фильтрации супернатанта может храниться при температуре 4 ° C для кратковременного хранения (до 4 дней). Для длительного хранения подготовить аликвоты и хранить их в-80 ° C.
      Примечание: Предполагается, что nonconcentrated вирусных препаратов являются ~ 2 x 107 до 3 x 107 vu/мл (обратитесь к разделу 1.5 для определения титра антител). Настоятельно рекомендуется подготовить аликвоты одноразового использования, поскольку несколько циклов замораживания оттаивания приведет к потере 10% – 20% в функциональных титры.
  5. Концентрация вирусных частиц
    Примечание: Для очистки двухэтапный метод двойной сахароза, с участием шага градиентного сахарозы и сахароза подушки шаг выполняется (рис. 4В).
    1. Чтобы создать градиент, сахароза, подготовить трубы конической ultracentrifugation в следующем порядке: 0,5 мл 70%-ая сахароза в однократном ПБС, 0,5 мл 60% сахарозы в среде DMEM, 1 мл 30% сахарозы в среде DMEM и 2 мл 20% сахарозы в однократном ПБС.
    2. Осторожно добавьте супернатанта, собранных согласно статье 1.4, градиента. Так как общий объем собранных из четырех 15 см пластины составляет 100 мл, используйте шесть ultracentrifugation трубы для обработки вирусный супернатант.
    3. Равномерное распределение вирусный супернатант среди каждой трубы ultracentrifugation. Чтобы избежать поломки труб в процессе центрифугирования, заполните ultracentrifugation трубы для по меньшей мере три четверти их общего объема емкости. Баланс трубки с ПБС. Центрифугуйте образцы на 70000 x g на 2 ч в 17 ° C.
      Примечание: Поддерживать уровень сахарозы во время ускорения и замедления шаги, позволяют ультрацентрифуга для медленно ускорения и замедления ротора от 0 до 200 x g и от 200 до 0 x g во время первого и последнего 3 мин спина, соответственно.
    4. Аккуратно Соберите 30% – 60% сахарозы фракций в чистой трубы (рис. 4В). Добавьте 1 x PBS (холодной) вверх к 100 мл общего объема. Смешайте закупорить несколько раз.
    5. Осторожно слоиться вирусной подготовки на подушке сахарозы, добавив 4 мл 20%-ая сахароза (в ПБС) на трубу. Продолжить, дозирования ~ 20-25 мл вирусный раствора в каждую пробирку. Заполните трубы с ПБС, если объем их содержание составляет менее чем три четверти в трубку. Тщательно сбалансировать трубы. Центрифуга на 70000 x g на 2 ч в 17 ° C. Инвертировать трубы на бумажные полотенца для разрешить оставшиеся и пустые супернатант жидкости стечь.
    6. Удалите все жидкости, осторожно аспирационных оставшуюся жидкость. Обратите внимание, что на данном этапе, едва видна, как небольшие пятна полупрозрачные гранулы, содержащие вирус. 70 мкл ПБС, к первой трубки Ресуспензируйте гранулы. Тщательно Пипетка подвеска и перенести его на следующий трубку до тех пор, пока все гранулы высокомобильна.
    7. Промойте трубы с дополнительной 50 мкл 1 x PBS и смесь как раньше. Обратите внимание, что на данном этапе объем окончательное приостановление ~ 120 мкл и появляется немного Млечный. Для получения четких подвеска, перейти с 60 центрифугирования s на 10000 x g. Супернатант передать новой трубки, сделать 5 мкл аликвоты и хранить их при температуре-80 ° C.
      Примечание: Лентивирусные вектор препараты чувствительны к повторных циклов замораживания и оттаивания. Кроме того предполагается, что оставшиеся шаги в культуре ткани сдерживания или в специально отведенных местах, квалифицированных в том смысле, на адекватном уровне стандартов биобезопасности (Рисунок 4B).
  6. Количественная оценка вирусной титры
    Примечание: Оценка вирусной титры выполняется с помощью метода p24 иммуноферментного анализа (ИФА) (p24gag ELISA) и согласно программе вакцины против СПИДа национальных институтов здравоохранения (НИЗ) протокол Assay захвата антиген p24 ВИЧ-1 с незначительные изменения.
    1. Используйте 200 мкл 0,05% анимации 20 в холодной ПБС (PBS-T) для мытья скважин 96-луночных пластины 3 x.
    2. Чтобы покрыть пластину, используйте 100 мкл антител моноклонального анти p24 разбавляют в 1:1,500 в однократном ПБС. Инкубировать пластину на ночь при 4 ° C.
    3. Подготовить блокировки реагента (1% альбумина bovine сыворотки [BSA] в однократном ПБС) и 200 мкл метки для каждой скважины, чтобы избежать неспецифического связывания. Используйте 200 мкл PBS-T мыть хорошо 3 x для по крайней мере 1 час при комнатной температуре.
    4. Приступайте к подготовке образца. При работе с концентрированной вектор препараты, разбавляют вектор на масштаба 1: 100, используя 1 мкл пример, 89 мкл dd-H20 и 10 мкл X-100 Тритон (в конечной концентрации 10%). Для nonconcentrated подготовки развести образцы в 1:10.
    5. Получите стандартам ВИЧ-1, используя двойную серийный разрежения (Начальная концентрация составляет 5 нг/мл).
    6. Разбавьте концентрированный образцы (подготовленных на шаге 1.6.4) в RPMI 1640 дополнены 20 анимации и 1% BSA 0,2% для получения 1:10 000, 1:50 000 и растительного разведениях. Аналогичным образом, разбавить nonconcentrated образцы (подготовленных на шаге 1.6.4) в RPMI 1640 с 0,2% 20 анимации и 1% BSA установить 1: 500, 1:2, 500 и 1:12,500 растворов.
    7. Добавление образцов и стандартов на плите в triplicates. Инкубируйте на ночь при 4 ° C.
    8. Следующий день, промыть скважин 6 x.
    9. 100 мкл кролика polyclonal антитела анти p24, разбавляют в 1:1,000 в RPMI 1640, 10% плода бычьим сывороточным (ФБС), BSA 0,25% и 2% нормальной мыши сыворотки (NMS) и инкубировать при 37 ° C в течение 4 ч.
    10. Промыть лунки 6 x. Добавить козье анти кролик пероксидаза IgG, разбавляют в мэм в RPMI 1640 с 5% нормальной козьего сыворотки, 2% NMS, 0,25% BSA и 0,01% 20 анимации. Инкубируйте при 37 ° C в течение 1 ч.
    11. Промыть лунки 6 x. Добавление ТМБ пероксидазы субстрата и инкубации при комнатной температуре в течение 15 мин.
    12. Чтобы остановить реакции, добавьте 100 мкл 1 N HCl. В Считыватель микропланшетов измерять поглощение на 450 Нм.
  7. Измерение интенсивности флуоресцентные репортер
    1. Используйте вирусный подвеска для получения десятикратного серийный разрежения (от 10-1 -10-5) в однократном ПБС.
    2. Пластина 5 x 105 ГЭС 293T клеток в каждой скважине 6-ну плиты. Применить к ячейкам 10 мкл каждого вирусный разрежения и инкубировать при 37 ° C с 5% CO2 в течение 48 часов.
    3. Перейдите к активации флуоресценции клеток, сортировка (FACS) анализ следующим: отсоединение клетки путем добавления 200 мкл 0,05% раствор трипсина ЭДТА. Инкубировать клетки при 37 ° C за 5 мин и Ресуспензируйте их в 2 мл DMEM среднего (с сывороткой). Сбор образцов в 15 мл Конические трубки и центрифуги на 400 x g при 4 ° C. Ресуспензируйте гранулы в 500 мкл холодной ПБС.
    4. Исправьте клетки путем добавления 500 мкл параформальдегида 4% (PFA) и проинкубируйте втечение 10 мин при комнатной температуре.
    5. Центрифуга на 400 x g при 4 ° C и Ресуспензируйте гранулы в 1 мл ПБС. Анализируйте экспрессия гена GFP с помощью инструмента СУИМ, как описано в Ортинский et al.30. Чтобы определить функциональные титр вируса, используйте следующую формулу.
      Equation 1
      Здесь,
      TG = количество GFP-положительных клеток;
      TN = общее количество клеток;
      N = общее количество transduced клеток;
      V = объем, используемый для трансдукции (в микролитров).
  8. Подсчет GFP-положительных клеток
    Примечание: Определите кратность инфекции (МВД), который используется для трансдукции. Тестировать широкий диапазон MOIs (от МВД = 1 мои = 10).
    1. 5 семян 3 x 10-4 x 105 ГЭС 293T клеток на каждой скважине 6-ну плиты.
    2. Когда клетки достичь > 80% слияния, передают их с вектором на мой интерес.
    3. Инкубировать при 37 ° C с 5% CO2и контролировать GFP сигнала в клетках на 1 – 7 дней.
    4. Подсчитать количество GFP-положительных клеток. Использовать флуоресцентный микроскоп (план 4 x цель, 0.1 н.а., 40 кратном) с использованием GFP фильтра (длина волны возбуждения = 470 Нм, длина волны излучения = 525 Нм). Используйте untransduced клетки для задания управления популяция клеток GFP-отрицательные.
    5. Используют следующую формулу для определения функциональных титр вируса.
      Equation 2
      Здесь,
      N = количество GFP-положительных клеток;
      D = коэффициент разрежения;
      M = коэффициент увеличения;
      V = объем вирус используется для трансдукции.
      Примечание: Вычислить результаты этого примера: за 10 GFP-положительных клеток (N) учитываются в разведении 10-4 (1:10, 000) при 20-кратном (M) в 10 мкл пример (V) (D), ту на миллилитр будет (10 х 104) x (20) x (10) х (100) = 2 x 108 vu/мл.

2. дифференциация дофаминергической нейронных прогениторных клеток

  1. Выращивание hiPSCs
    Примечание: hiPSCs от пациента с постулатов Локус SNCA, ND34391, были получены от Национальный институт неврологических нарушений и инсульта (NINDS) каталог (см. таблицу материалы).
    1. Культура hiPSCs в условиях фидер независимые в свободной подачи ESC-iPSC питательной среды (см. Таблицу материалы) на квалифицированных Госкомсанэпиднадзором базовой матрицы мембраны (BMM)-покрытием пластин (см. Таблицу материалы). Мыть вырожденная колоний с 1 мл раствора DMEM/F12, добавьте 1 mL реагента диссоциации (см. Таблицу материалы) и Инкубируйте 3 мин при комнатной температуре.
    2. Аспирационная диссоциации реагента и добавьте 1 mL фидер бесплатно ESC-iPSC питательной среды.
    3. Скрип пластину, используя погрузчик клетки и Ресуспензируйте колоний в 11 мл свободной подачи ESC-iPSC питательной среды, дозирования 4 x-5 x с использованием боросиликатного пипетки.
    4. Пластина 2 мл суспензии колонии на BMM-покрытием пластин и поместите пластины при 37 ° C с 5% CO2. Выполнять ежедневные изменения средних и разбить ячейки каждые 5 – 7 дней.
  2. Дифференциация в дофаминергической нейронных прогениторных клеток
    Примечание: Дифференциация hiPSCs в дофаминергической нейронных прародитель клетки (MD NPC) осуществляется с помощью коммерчески доступных нейронной индукции средних протокола в соответствии с инструкциями производителей, с незначительными изменениями (32 )31, см Таблицу материалы). В первый день дифференциация рассматривается как день 0. Высокое качество hiPSCs, необходимые для эффективного нейронных дифференциации. Индукции MD NPC – performedusing embryoid тело (EB)-на основе протокола.
    1. Перед началом дифференциация hiPSCs, подготовить микрорезервуар культуры плиты (см. Таблицу материалы) согласно инструкциям ее производителя.
    2. После подготовки пластину микрорезервуар культуры, добавьте 1 mL нейронной индукции среды (NIM; см. Таблицу материалы) с 10 мкм Y-27632.
    3. Отложите пластины до готовой к использованию.
    4. Мыть hiPSCs с DMEM/F12, добавить 1 мл раствора отряд клеток (см. Таблицу материалы) и инкубировать в течение 5 минут при 37 ° C с 5% CO2.
    5. Ресуспензируйте единичных клеток в среде DMEM/F12 и центрифуги их на 300 x g за 5 мин.
    6. Тщательно удалить супернатант и Ресуспензируйте клетки в NIM + 10 мкм Y-27632 для получения конечной концентрации 3 х 106 клеток/мл.
    7. Добавить 1 мл суспензии одноклеточных одного хорошо плиты культуры микрорезервуар и центрифуги пластину на 100 g x 3 мин.
    8. Изучить пластину под микроскопом, чтобы обеспечить равномерное распределение ячеек среди микрорезервуар и инкубации клеток при 37 ° C с 5% CO2.
    9. На дней 1 – 4выполните ежедневное частичное изменение средних.
    10. 1 мл микропипеткой, удалите 1,5 мл среды и выбросите. Медленно добавьте 1,5 мл свежего NIM без Y-27632.
    11. Повторите шаг 2.2.10 до дня 4.
    12. На 5 деньпальто одной скважиной 6-ну плиты с БММ.
    13. Место стрейнер реверсивные 37 мкм (см. Таблицу материалы) на вершине 50 мл Конические трубки (отходы). Точка стрелку реверсивные фильтр вверх.
    14. Удалите носитель с микрорезервуар культуры пластины не нарушая сформированные EBs.
    15. Добавьте 1 mL DMEM/F12 и оперативно собирать EBs с пипеткой боросиликатное и фильтровать их через сито.
    16. Повторите шаг 2.2.15 до тех пор, пока все EBs удаляются из пластины микрорезервуар культуры.
    17. Инвертировать фильтр над новой 50 мл Конические трубки и добавить 2 мл NIM собрать все EBs.
    18. Пластина 2 мл суспензии EB в одну скважину BMM-покрытием плиты с помощью пипетки боросиликатное. Инкубируйте EBs при 37 ° C с 5% CO2.
    19. На 6 день, подготовить 2 мл NIM + 200 нг/мл Тсс (см. Таблицу материалы) и выполнять ежедневные средние изменения.
    20. На 8 деньпроверьте процент нейронной индукции.
    21. Подсчет всех присоединенных EBs и, в частности, определить количество каждого индивидуального EB, которая заполняется с нейронных розеток. Количественно розетка нейронной индукции, по следующей формуле.
      Equation 3
      Примечание: Если нейронной индукции < 75%, выбор нейронных розетка может быть неэффективным.
    22. День 12Подготовьте 250 мл N2B27 среды с 119 мл neurobasal средний, 119 мл в среде DMEM/F12, 2,5 мл GlutaMAX, 2,5 мл NEAA, 2,5 мл N2 дополнения, 5 мл B27 без витамина A, 250 мкл гентамицина (50 мг/мл) и 19. 66 мкл BSA (7 мг/мл).
    23. Для приготовления 50 мл полного среднего N2B27, добавить 3 мкм CHIR99021, 2 мкм SB431542, bFGF 20 нг/мл, 20 нг/мл EGF и 200 нг/мл ТСС.
      Примечание: Важно подготовить заполненные средних прямо перед использованием.
    24. Аспирационная среднего из скважин, содержащий нейронных розеток и мыть с 1 мл раствора DMEM/F12.
    25. Объявление 1 mL реагента нейронных розетка отбора (см. Таблицу материалы) и инкубировать при 37 ° C с 5% CO2 на 1 ч.
    26. Удалить выбор реагента и, используя 1 мл дозаторов, направлены непосредственно на кластерах розетка.
    27. Добавьте подвеска 15 мл Конические трубки и повторить шаги 2.2.25 и 2.2.26 до большинства кластеров нейронных розетки были собраны.
      Примечание: Чтобы избежать загрязнения с nonneuronal клеток, не overselect.
    28. Центрифуга розетка подвеска на 350 x g 5 мин аспирата супернатант и Ресуспензируйте нейронных розеток в N2B27 + 200 нг/мл ТСС. Добавьте нейронных розетка подвеска хорошо BMM-покрытием и инкубировать пластины при 37 ° C с 5% CO2.
    29. На дней 13 – 17выполните ежедневных средних изменений с использованием завершенных среднего N2B27. Проход клетки культуры при 80%-90% притока.
    30. Чтобы разбить ячейки, подготовьте BMM-покрытием плиты.
    31. Вымыть клетки с 1 мл раствора DMEM/F12, аспирационная среды и добавьте 1 mL реагента диссоциации (см. Таблицу материалы).
    32. Инкубировать в течение 5 минут при 37 ° C, добавляют 1 мл DMEM/F12 и выбить прилагаемый клетки, закупорить вверх и вниз. Соберите подвеска NPC в 15 мл Конические трубки. Центрифуга на 300 x g за 5 мин.
    33. Аспирационная супернатант и Ресуспензируйте клеток в 1 мл полного N2B27 + 200 нг/мл ТСС.
    34. Подсчитать количество ячеек и их пластины на плотности 1,25 x 105 клеток/см2, инкубации клеток при 37 ° C с 5% CO2.
    35. Изменение среднего каждый день, используя полный N2B27 + 200 нг/мл ТСС.
      Примечание: В этом отрывке, НИПы, считаются проход (P) 0. Тсс могут быть выведены из N2B27 среды в точке P2.
    36. Проход клетки, как только они достигают 80%-90% слияния.
    37. На данном этапе убедитесь, что клетки Экспресс маркеры Nestin и FoxA2 с помощью иммуноцитохимии и ПЦР. Этот протокол приводит к генерации 85% двойной положительных клеток на маркеры Nestin и FoxA2.
    38. Для пассированый клетки, повторите шаги 2.2.31–2.2.36.
    39. Заблокировать ячейки, начиная от прохода P2. Для замораживания клеток, повторите шаги 2.2.31–2.2.36 и Ресуспензируйте Пелле клеток в6 2 x 10-4 х 106 клеток/мл с помощью холодной нейронных прародитель замораживание среднего (см. Таблицу материалы).
    40. Перевести 1 мл суспензии клеток в каждой cryovial и заморозить клетки, с помощью стандартного замедлить скорость контролируемые системой охлаждения. Для длительного хранения держите клетки в жидком азоте.
  3. Размораживание MD РНУ
    1. Подготовить тарелку BMM-покрытием и теплое полное N2B27. Добавьте 10 мл теплой среде DMEM/F12 15 мл Конические трубки. Место cryovial в блоке 37 ° C тепла на 2 мин.
      1. Передать клетки от cryovial трубка, содержащая DMEM/F12. Центрифуга на 300 x g за 5 мин.
      2. Аспирационная супернатанта, Ресуспензируйте клетки в 2 мл N2B27 и добавьте суспензию клеток одной скважиной BMM-покрытием плиты. Инкубируйте клетки при 37 ° C с 5% CO2.

3. трансдукции MD НПС и анализ изменений метилирования дна

  1. Трансдукция MD РНУ
    1. Передают MD НИПы в 70% слияния с LV-gRNA/dCas9-DNMT3A векторов в MOI = 2. Замените posttransduction средних 16 h N2B27.
    2. Добавьте N2B27 с 5 мкг/мл puromycin, 48 ч после трансдукции. Культура клетки на 3 недели в N2B27 плюс puromycin для получения стабильной линии MD NPC. Клетки будут готовы к течению приложений (ДНК, РНК, белков анализы, фенотипические характеристики23, замораживания и пассированый).
  2. Характеристика метилирования профиля SNCA Интрон 1
    1. Извлечь ДНК из каждой стабильно transduced ячейки строки с помощью экстракции ДНК комплекта (см. Таблицу материалы).
    2. Использование 800 нг ДНК, чтобы выполнить преобразование бисульфита, использование коммерчески доступных комплект (см. Таблицу материалы). После преобразование бисульфита элюировать ДНК бисульфит преобразованы к 20 нг/мкл.
  3. ПЦР для анализа пиросеквенирования
    1. Подготовка мастер смесь ПЦР в трубу нуклеиназы бесплатно. Для каждой реакции, используйте 0.4 мкл обратного праймера (10 мкм), 0,4 мкл вперед праймера (10 мкм), 1,6 мкл MgCl2 (25 мм), 2 мкл 10 x CoralLoad концентрата, 10 мкл 2 x PCR мастер смеси, 4 мкл 5 x Q-раствор, 1 мкл ДНК и 0,6 мкл воды, свободной от нуклеиназы.
    2. Передать Термоциклер пластину реакции и выполнять ПЦР с использованием следующих условий: 95 ° C в течение 15 мин, 50 циклов 94 ° C за 30 s, 56 ° C за 30 s и 72 ° C за 30 сек, с шагом расширение окончательного 10 мин при 72 ° C. Праймеры для пиросеквенирования SNCA Интрон 1 перечислены в таблице 1, рис. 7Aи дополнительная цифра 1.
    3. После усиления Визуализируйте ампликонами, используя 2 мкл продукта PCR бромидом ethidium окрашивание, следующие электрофорез геля агарозы.
    4. Пиросеквенирование проверяются с помощью смеси unmethylated (U) и метилированию (М) преобразование бисульфита ННО в следующих соотношений, а именно 100U:0M, 75U:25M, 50U:50M, 25U:75M и 0U:100M (см. Таблицу материалы).
    5. Проводить пиросеквенирования с помощью пиросеквенирования реагентов (см. Таблицу материалы) и рассчитать значения метилирования для каждого сайта CpG, используя пиросеквенирования программного обеспечения. Для подробного пиросеквенирования протокол обратитесь к Бэссил et al.37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Проверка производства титры LV-dCas9-DNMT3A-GFP/Puro векторов, по сравнению с коллегой GFP наивно

Мы исполняли p24gag ELISA для сравнения между физической титры LV-dCas9-DNMT3A-GFP/Puro с коллегами GFP/Puro наивными. Представитель результаты, представленные в Рисунок 5A, продемонстрировать, что физическая урожайности векторов, создается с использованием протокола здесь говорится, сопоставимы. Это свидетельствует о том, что утилита оптимизированный вектор позвоночника, в сочетании с протоколом оптимизации производства, результаты титра высокодоходные ТРИФОСФАТЫ/dCas9 векторов. Для оценки эффективности упаковки трансген dCas9-DNMT3A в вирусных частиц, мы провели трансдукции концентрированной вектора в ГЭС 293T клетки (Рисунок 5B). Несмотря на это результаты, полученные в Рисунок 5A показал, что ставки трансдукции LV-dCas9-DNMT3A-GFP вектора был значительно ниже, чем у наивных GFP вектора (Рисунок 5B). В самом деле функциональные титр LV-dCas9-DNMT3A-GFP вектора был четыре раза ниже, чем у наивных коллегой, предполагая, что снижается эффективность упаковка ТРИФОСФАТЫ/dCas9 РНК. Кроме того вектор LV-dCas9-DNMT3A-Puro формируется puromycin устойчивостью колоний по курсу, который был в пять раз ниже по сравнению с коллегой наивно Пуро. Мы также протестировали эффективность трансдукции LV-dCas9-DNMT3A-Puro векторов в MD РНУ. С этой целью клетки были преобразованы с наивными LV-GFP вектор и LV-dCas9-DNMT3A-Пуро в MOI = 1. Как показано на рис. 5 c, ставки трансдукции Puro управления вектора были пять раз выше по сравнению с dCas9-DNMT3A вектора. Эти результаты были подтверждены с помощью GFP версий векторов (рис. 5 d). Как предлагается в разделе обсуждение с нижней упаковка/выражение характеристики системы LV-epigenome редактирования, описанных здесь ее уровни являются достаточно, чтобы побудить устойчивого метилирование ДНК на последовательности. Кроме того эти характеристики могут быть улучшены путем расширения масштабов производства процедуры.

Дифференциация MD РНУ

EB-протокол на основе описанных здесь позволяет дифференциации MD NPC (рис. 6A). Мы оценили процесс дифференциации с помощью определенных маркеров на разных стадиях. hiPSCs выразил плюрипотентности маркер OCT4, в то время как MD НИПы выразил Nestin и FOXA2 (Рисунок 6B, C). Мы ранее сообщали, что этот протокол дифференциации производит 83,3% клеток, которые являются двойной положительный для Nestin и FOXA2 маркеры31, подтверждающий успешное дифференциации этих клеток. По крайней мере 75%-80% клеток нужно показать ячейки специфических маркеров. Снижению урожайности (< 50%) положительных клеток для маркеров потребует другой протокол дифференциации.

Проверка пиросеквенирования assays для SNCA Интрон 1 метилирования профиль

Семь пиросеквенирования анализов (Таблица 1, дополнительная цифра 1, рис. 7A) были разработаны и протестированы для количественного определения статуса метилирования в Интрон SNCA 1. Chr4: 89,836,150-89,836,593 (GRCh38/hg38) область содержит 23 СКП. Разработанные анализы были проверены для линейности, с использованием различных смесей unmethylated (U) и метилированию (М) преобразование бисульфита ННО как стандарты. Смеси были использованы в следующих соотношений, а именно: 100U:0M, 75U:25M, 50U:50M, 25U:75M и 0U:100M. Все семь анализов были проверены (рис. 7B) и показал линейной корреляции R2 > 0,93. Были переработаны анализов, которые не были проверены. Использование проверенных анализов, можно было определить уровень метилирования в 23 СКП в Интрон SNCA 1 (рис. 7 c).

Figure 1
Рисунок 1: Epigenome-инструменты для редактирования для активации генов и репрессии в. (A) закрытые конформации ДНК показывает организация гетерохроматина. Эффекторных молекул, включая VP64, Р65, РТС, деметилирования фермента ДНК и тет-1 могут быть набраны в нормативных регионы (промоутеров, интронов, и т.д.) через сопряжения с системой dCas9-gRNA. Набор системы приводит к хроматина ремоделирования, что приводит к созданию открытой хроматина Организации (euchromatin), связанной с активации генов. (B) на основе Epigenome глушитель может быть достиган вербовки dCas9 repressory комплексов, включая краб, гда и ДНК метилирования фермента, DNMT3A для регулирования регионов (промоутеров, интронов, и т.д.) через привязывать с gRNA компонента. Набор системы приводит к деактивации гена (глушителей), связанные с ДНК chromatin remodeling и недоступность механизма общего транскрипции к структуре хроматина. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: дизайн лентивирусные векторы для целевых метилирование ДНК в SNCA triplicated локусов. (A) производства и выражение оптимизированный подробно вектор позвоночника, Кантор et al.23, Ортинский et al.30и35Vijayraghavan и Кантор. Аннотации элементы вектора СНГ являются упаковка элементов вектора (ψ, psi), Rev ответ элемента (RRE), Sp1-привязки сайтов (Sp1), человека U6 промоутер (hU6), удлинение основной фактор 1α промоутер (EFS-NC) и вирус гепатита сурок посттранскрипционного регулирования элемент (WPRE). (B) схематическое представление SNCA triplicated Локус. Метилирование ДНК является важным регуляцию механизмом, который прямо или косвенно ограничивает доступность ДНК21. Низкий уровень метилирования CpG в SNCA Интрон 1 случайно наблюдалось увеличение SNCA выражение (зеленые стрелки метка активированные ген выражение состояния triplicated SNCA Локус). Набор векторов LV-gRNA/dCas9-DNMT3A Теетер метилтрансфераза фермента в регионе Интрон 1 SNCA . Это приводит к Ассамблее закрытых хроматина, что приводит к transcriptional Даунрегуляция SNCA (красные стрелки). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: строительство лентивирусные вектора выражения кассеты, перевозящих трансген dCas9-DNMT3A. Родительский вектор, pBK301, описан в Ортинский et al.30. Вектор был клонирован с dCas9-DNMT3A-Пуро (pBK492) или dCas9-DNMT3A-GFP (pBK539) (клонирование потока можно найти в протоколе и в Кантор et al.23). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: лентивирусные вектор упаковка, производство и очищение. (A) переходных трансфекции протокол, используемый для производства LV-gRNA/dCas9-DNMT3A. Для генерации векторов, ГЭС 293T клетки были transfected с вирусом везикулярного стоматита G-белка (VSV-G), Упаковка и выражение плазмид23. Вирусные частицы были собраны из supernatants культуры. Второе поколение системы упаковки использовался в дополнение кассеты выражение. Система укрывал ТАТ и Rev белков. Rev плазмида, pRSV-REV, была дополнена отдельно. Сокращения: pCMV = промоутер цитомегаловирус; Л = долго терминала повторяется; VSV-G = вирус везикулярного стоматита G-белок; RRE = элемент Rev ответ; SP1 = сайтов Sp1-связывания фактор транскрипции; Ψ = упаковка элементов вектора (psi); WPRE = сурок вирус гепатита посттранскрипционного нормативные элемент; EFS-NC = удлинение основной фактор 1α промоутер; hU6 = человека U6 промоутер. (B) вектор очищения и концентрации была выполнена следующим образом: двойной сахароза градиента протокол был использован для очищения и концентрации вирусных частиц после переходных трансфекции (см. выше). Вкратце супернатанта культуры (SN) собирались и загружен на градиент сахарозы. Чтобы создать градиент, 70%, 60%, 30% и 20% сахарозы решения растворяют в 1 x PBS были использованы. На втором этапе очистки включен ultracentrifugation против подушку 20% сахарозы. Сформированные гранулы был высокомобильна в однократном ПБС. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: оценка вирусной титры. (A) p24 анализа ELISA. Tittering процедура была выполнена как описано Кантор et al.23. Наивный (ГПУП) вектор выделяется черная полоса. Выделяются также LV-dCas9-DNMT3A-Puro вектор (светло голубой бар) и LV-dCas9-DNMT3A-GFP вектор (зеленая полоска). Производство физических частиц векторов были оценены. Результаты записываются в количестве копирования на миллилитр, где 1 нг p24gag = 1 х 104 вирусных частиц. Данные диаграммы представляет среднее ± SD от трех независимых экспериментов. (B) Оценка функционального титры, после трансдукции в ГЭС 293T клетки. LVs Puro содержащих были преобразованы в ГЭС 293T клетки, как описано в представительных результатов. Функциональные титры вирусный производства были измерены путем подсчета количества колоний после выбора puromycin. Результаты были рассчитывается как отношение числа колоний, полученные из лентивирусные вектор Пуро (вектор управления) по отношению к dCas9-DNMT3A-Puro коллегой. Гистограмма представляет среднее ± SD от трех независимых экспериментов. (C) Оценка эффективности трансдукция и выражение векторов в ГЭС 293T клетки (Верхняя панель) и НПС (Нижняя панель). Левой панели представляют собой transductions вектор наивный (ГПУП). Правой панели представляют собой transductions dCas9-DNMT3A-GFP вектора. Три дня posttransduction, изображения были собраны с помощью флуоресцентным микроскопом (40 x). (D) Оценка функционального титры, после трансдукции в NPC. LVs Puro содержащих были преобразованы в NPC, как описано в представитель результаты и результаты были рассчитаны как группа B. Гистограмма представляет среднее ± SEM три биологических реплицирует. Сокращения: ГЭС 293T = человеческих эмбриональных почек 293T; НИПы = нейронных прогениторных клеток. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: дифференциация и характеристика hiPSC производные MD РНУ. Хронология (A), показаны различия hiPSC производные MD РНУ. Количественная оценка MD NPC маркеров с помощью immunocytochemistry (B и C) и (D и E) в реальном времени (RT) ПЦР. Уровни каждого мРНК были рассчитаны по отношению к геометрическое GAPDH-мРНК и PPIA-мРНК ссылающиеся на элементы управления с помощью метода 2- ΔΔCT . Каждый столбец представляет среднее двух биологических и технических реплицирует. Планки погрешностей представляют SEM. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 7
Рисунок 7: количественной проверки пиросеквенирования assays таргетинга SNCA Интрон 1. (A) Обзор пиросеквенирования анализов в SNCA Интрон 1. (B) разработан анализы были проверены с использованием различных соотношениях unmethylated (U) и метилированию бисульфит преобразованы ДНК (М), а именно 100U:0M, 75U:25M, 50U:50M, 25U:75M и 0U:100M. (C) Validated анализов были использованы для измерения доли метилирования 23 СКП в Интрон SNCA 1 в hiPSC производные MD НПС от пациента с постулатов Локус SNCA . Бары представляют собой среднее процент метилированной СКП в двух независимых экспериментов, и погрешностей Показать SEM. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Проба # Грунтовка вперед (5' - 3') Грунтовка реверс (5' - 3') Секвенирование грунт (5' - 3') CpG покрыты
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7,8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 23, 20, 21, 22
* Указывает biotyniliated грунтовки

Таблица 1: Пиросеквенирования assays для оценки уровней метилирования CpG Интрон 1 SNCA.

Дополнительный рисунок 1: обзор пиросеквенирования assays в SNCA Интрон 1. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs начали появляться как транспортное средство выбора для редактирования epigenome, особенно в контексте генетических заболеваний, главным образом из-за их способности (i) размещения больших нагрузок ДНК и (ii) эффективно передают широкий спектр деления и nondividing клетки. Крупногабаритная тара эффективность LVs особенно полезно для приложений, связанных с упаковки ТРИФОСФАТЫ/dCas9 систем, которые являются негабаритных. С этой точки зрения LVs представляют собой платформы оф выбор для доставки все-в-одном ТРИФОСФАТЫ/Cas9 систем. Действительно Аав платформа, которая обычно используется для приложений доклинических и клинических генной терапии, является не вполне способна вместить упаковки больших размеров dCas9-эффекторных систем. В самом деле строгой упаковки требованиям векторы AAV запрещающие их использования для доставки компонентов ТРИФОСФАТЫ/dCas9. Чтобы улучшить возможности упаковки AAV, были разработаны несколько Роман AAV-платформ. Например Сплит intein подход, отделяя Cas9 системы в две кассеты AAV была недавно построена38. Этот подход увеличилась общая упаковка потенциала; Однако он требует производства и cotransduction два вектора AAV38. Открытие SaCas9, производные от золотистого стафилококка, позволила SaCas9/руководство РНК системы39,40. SaCas9, короче, но столь же мощным Cas9 фермента, легко упакованы в векторы AAV. В экспериментах in vivo показали, что эта система эффективно целей регулирования холестерин гена PCSK940. Тем не менее упаковка эффективность векторы AAV все-в-одном требует дальнейшего улучшения. Учитывая явные преимущества системы доставки LV мы недавно разработали и использовали трансген лентивирусные укрывал магистрали dCas9-DNMT3A, а также gRNA леску. Чтобы проверить терапевтический потенциал этой новой системы, мы обратились в его PD hiPSC производные нейронов осуществляется SNCA локусов постулатов23. Мы проверить эффективность этой системы, которая привела к тонкой Даунрегуляция SNCA-мРНК и белка уровнях23. Важно отметить, что система продемонстрировала способность спасти связанных с болезнью сотовой фенотипов, предлагая большой потенциал подхода для терапии на базе epigenome23.

Для увеличения производства векторов, мы недавно представил несколько модификаций в векторные выражения кассету, включая интеграцию Sp1 сайтов, удаление в 3' LTR и вниз калибровки выражение плазмида (см. в следующем пункте)30 .

Изменения в существующих платформ

Метод производства, представленные здесь, позволяет создавать LV-ТРИФОСФАТЫ/dCas9 векторов на титры в диапазоне от 1 x 1010 vu/мл (рис. 5). Как отмечалось выше для достижения более высоких производственных титры, мы добавили повторение Sp1-привязки сайта фактор транскрипции в все-в-одном ТРИФОСФАТЫ/Cas9 выражение вектор кассету и представил состояние искусства исключения в регионе U3 3' LTR. Эти изменения привели к значительным upregulation в вектор эффективности упаковки (~2.5x) а также выражение трансген (около всемеро)30,35. Эти улучшения являются в соответствии с ранее созданных данных41,42,,4344.

Важнейшие шаги и устранение неполадок

Оптимизированный вектор кассеты, упакованы в вирусных частиц, генерирует титры приблизительно 1 x 1010 vu/мл на ~ 5 x 107 продюсер клетки. В случае производства векторов на нижней титры следует рассмотреть следующие усовершенствования. 1) использование ГЭС 293T клеток на ряд низкий проход. Замените клеток регулярно после каналов ≥20 проходы. Кроме того замените клеток, когда они показывают медленный темп роста. 2) регулярно проверяйте компоненты среды, поскольку они могут способствовать изменениям в титр вируса. Заменить плода сыворотки с рентабельных космических телячьей сыворотки. 3) различных клеточных линий, используемых для создания векторных продемонстрировать собственный производства фитнес. К примеру, ГЭС 293T клетки способны генерировать векторов на уровнях, которые в три раза выше, чем клетки ГЭС - 293FT (данные не показаны). 4 оптимальное трансфекции будет достигнута, когда клетки при впадении в 70 – 80%. Более низких плотностей приведет к преждевременной клеточную смерть как фактор вирусных токсичности. Однако более высокой плотности приведет к существенному снижению эффективности производства. Как общее правило плотность клеток до трансфекции должны позволить клетки к делению один раз до создания полностью вырожденная культуры. 5) transfection титры также зависит от pH реагента BBS. Как правило мы предлагаем тестирование новой партии BBS в условиях экспериментального трансфекции до его использования. 2 x BBS рН должна быть 6.95.

Производства урожаев против электромеханической эффективности/выражение

Она должна быть указал, что хотя Sp1-LVs нося ТРИФОСФАТЫ/dCas9 трансгенов способны создавать титры в непосредственной близости от 1 x 1010 vu/мл на ~ 5 x 107 продюсер клеток, которая сопоставима с наивными вектор (Рисунок 5A), с dCas9-DNMT3A трансген значительно нарушается эффективности упаковки РНК вируса. Действительно, мы демонстрируем приблизительно пятикратное снижение функциональных титры и возможности выражения LV-dCas9-DNMT3A-Puro/GFP векторов (Рисунок 5B-D). Снижение эффективности упаковки и выражение векторов может быть результатом Сверхэкспрессия DNMT3A. В этой связи было продемонстрировано, что метилирование ДНК могут играть важную роль в контроле репликации ВИЧ-1 и его экспрессии генов. Таким образом было бы необходимо определить ли LVs подлежат аналогичное положение и, если это так, разрабатывать стратегии индуцибельной молчание DNMT3A деятельности на этапе производства вектор. Несмотря на ниже доходности производства векторы продемонстрировать достойной функциональных титры (в низких 10 диапазоне9 , которое должно быть достаточно для многих приложений, включая те, которые требуют в естественных условиях доставки). Стоит отметить, что процедура производства может быть легко расширены, как описано в обзоре, который должен позволить соответствие титры, полученные с другими системами выражение.

Вектор управляемость и безопасность

Для создания ЛВС, следует рассмотреть следующие вопросы безопасности. Во-первых LVs требуют внутриреакторные 2-го уровня биобезопасности. Несмотря на относительную безопасность LVs (которых проистекает из характера их ГРЕХ) остаточная активность транскрипционный анализ был продемонстрировали22. Кроме того LV геномов может быть спасен ВИЧ-1-22. Из-за все это мы настоятельно рекомендуем выполнять репликацию компетенции анализов (особенно на концентрированные препараты). Для безопасности процедуры, касающиеся обработки lentiviruses, мы ссылаемся здесь биобезопасности в микробиологические и биомедицинских лабораториях, 4-е издание, Опубликовано центрами по контролю за заболеваниями (CDC; доступна онлайн). Для клинического применения используйте третье поколение системы упаковки. Тем не менее следует отметить, что использование третьего поколения систем упаковки связывает с нижней титры, сравнивая с второго поколения упаковочных систем.

Значение и будущие направления деятельности

Новые платформы, изложенные здесь повышает постоянно расширяет инструментарий для доставки epigenome редактирования компонентов и другие молекулярные грузов для клеток и органов. Несмотря на последние достижения в разработке систем на основе ВИЧ-1 только несколько платформ продемонстрировать устойчивой урожайности вирусный производства. Оптимизации векторной основой сообщили здесь стало возможным решить некоторые вопросы, связанные с относительно низкой производственной эффективности векторов. Для дальнейшего улучшения вектор характеристик производства, было бы полезно для тестирования ли вектор дает и выражение может быть улучшена добавлением multi копирование повторяет тот же мотив привязки или мультиплексирование Sp1 мотив с признанием сайтов для других факторов. В этой связи результаты, представленные здесь может предложить общую стратегию для улучшения относительно слабый ткани конкретных промоутеров, например человека, синапсины I (hSyn) и CamKIIa.

Недавно мы продемонстрировали, что долгосрочные выражение LV-доставлены Cas9/руководство РНК может привести к нежелательным эффектам пробить30. Даже несмотря на то, что это понятие применяется главным образом для деления клеток, было бы весьма полезно разработать episomal векторных систем может временно предоставлять терапевтические грузов. Как упоминается выше векторы AAV являются очень ценными, временно доставки транспортных средств; Тем не менее способность низкая упаковки значительно влияние их использования, особенно для редактирования epigenome приложений. По этой причине интеграза недостаточным лентивирусные векторы (IDLVs) будет предлагать привлекательным средством для доставки и выражения epigenome-инструменты для редактирования на основе ТРИФОСФАТЫ/dCas9. Следующие характеристики платформы IDLV являются особенно привлекательными: (i) способность доставить генетических грузов к широкому спектру клеток и органов; (ii) в превосходной упаковочного потенциала — это значительное преимущество над векторы AAV; (iii преходящий характер доставки (который является значительное преимущество по сравнению с интеграза компетентных LVs)45,30. Episomal характер IDLV геномов подчеркивается их очень низкой интеграции ставок и, как таковые, являются весьма полезным для уменьшения риска инсерционному мутагенезу. Недавно мы оптимизировали IDLV производства и выражение характеристики, создание платформы, которая является безопасной и эффективной для доставки компонентов ТРИФОСФАТЫ/Cas930. Действительно улучшение IDLVs были способны индуцировать быстрый и устойчивый генома, редактирования в ячейках ГЭС 293T и в Постмитотические мозга, нейроны. Система характеризуется переходных выражения и было установлено более безопасным, чем соответствующий интеграза компетентных LVs. Адаптация IDLV векторов для приложений, связанных с epigenome редактирования манипуляции бы весьма выгодным для поля терапии гена.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Университет Дьюка подал предварительной патентной заявки, связанные с настоящим исследованием.

Acknowledgments

Эта работа частично финансируется Кан нейротехнология развития премию (O.C.) и национальных институтов из здравоохранения/Национальный институт от неврологических расстройств и инсульта (NIH/NINDS) (R01 NS085011 для O.C.).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics