Een convergerende strategie voor het genereren van een virtueel Gesequentieerde cDNA-Bibliotheek van niet-gerefereerde Pacifische oesters

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

We beschrijven een strategie voor het gebruik van RNA-monsters van niet-gerefereerde Pacifische oester specimens en evalueren het genetische materiaal in vergelijking met openbaar beschikbare genoom gegevens om een virtueel gesequentieerde cDNA-Bibliotheek te genereren.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De toegang tot biologisch materiaal van referentie soorten, die voorheen werden gebruikt in belangrijke experimenten zoals bij de ontwikkeling van nieuwe cellijnen of genoom volgorde projecten, zijn vaak moeilijk te voorzien voor verdere studies of derden als gevolg van de het verbruik van de monsters. Hoewel de individuele Pacifische oester specimens nu op grote schaal over de Pacifische kusten van Azië, Australië en Noord-Amerika verdeeld zijn, zijn ze genetisch vrij divers en daarom niet direct geschikt als uitgangsmateriaal voor genbibliotheken. In dit artikel demonstreren we het gebruik van niet-gerefereerde Pacifische oester specimens verkregen van regionale vismarkten om cDNA-bibliotheken te genereren. Deze bibliotheken werden vervolgens vergeleken met het publiek beschikbare oester genoom, en de dichtstbijzijnde gerelateerde bibliotheek werd geselecteerd met behulp van de mitochondriale referentie genen cytochroom C oxidase subeenheid I (COX1) en NADH dehydrogenase (ND). De geschiktheid van de gegenereerde cDNA-Bibliotheek wordt ook aangetoond door het klonen en de expressie van twee genen die de enzymen UDP-glucuronic acid dehydrogenase (UGD) coderen en UDP-xylose synthase (UXS), die verantwoordelijk zijn voor de biosynthese van UDP-xylose van UDP-glucose.

Introduction

De overname van biologisch materiaal waarnaar wordt verwezen, kan een uitdaging zijn als gevolg van lange levertijden, ondernemende redenering of landspecifieke douanevoorschriften. Als alternatief kan het vereiste biologisch materiaal ook worden opgevangen uit fenotypisch identieke specimens. Deze monsters kunnen echter aanzienlijk variëren op het niveau van genotype, en daarom worden vergelijkingen met digitaal opgeslagen referentie-genoom van dezelfde soort vaak moeilijk of zelfs nutteloos als gevolg van onverenigbaarheid van het nieuw geproduceerde materiaal met bestaande DNA-versterkings methoden. Sequentiëren van sterk gecondengeerde genen van individuele monsters is een veelgebruikte en krachtige tool voor het identificeren van soorten1, zoals gecondengeerde mitochondriale genen die vaak worden gebruikt als referentie genen voor de kwaliteitsbeoordeling van cDNA-bibliotheken2 ,3,4,5,6. De achterliggende gedachte voor de hierin gepresenteerde methode is dat een hoog behoud van mitochondriale gensequenties in individuele anonieme oester monsters ten opzichte van de corresponderende sequenties van het referentie genoom aangeeft dat andere genen ook een lage mate van divergentie, gezien de over het algemeen snellere snelheid van mitochondriale DNA-evolutie ten opzichte van nucleair DNA7, waardoor de versterking en isolatie van een breed scala aan wetenschappelijk en industrieel relevante genen door simpelweg het gebruik van openbare beschikbare sequentiegegevens als referentie.

Het algemene doel van de hierin beschreven methode is het presenteren van een geoptimaliseerde workflow voor het genereren van een vrijwel geordend Oyster cDNA-bibliotheek die kan worden gebruikt als template-DNA voor het klonen van oester genen. In virtuele sequentiëren wordt de Novo genoome-sequencing omzeild; in plaats daarvan wordt een bekende, digitaal opgeslagen referentie sequentie direct gebruikt om primers te gebruiken of te ontwerpen voor de productie van Cdna's die uiteindelijk een bibliotheek zullen omvatten (of worden toegevoegd aan een reeds bestaande). Het doel is om een convergente cDNA-Bibliotheek te produceren, wat betekent dat overeenkomsten tussen de gegenereerde cDNA-sequenties en de referentie volgorde kunnen worden gerangschikt van laag naar hoog divergentie. Een belangrijk voordeel van het gebruik van cytochroom C oxidase subeenheid 1 (COX1) en NADH dehydrogenase (ND) als referentie-genen is dat zelfs zeer geografisch nieuwe oester specimens kunnen worden geprofileerd als gevolg van het hoge behoud van deze mitochondriale genen. Nadat we de aanpak met deze gevestigde markers hebben bewezen, tonen we vervolgens de toepassing ervan aan twee enzym kandidaten die betrokken zijn bij de biosynthese van suiker nucleotide en die van industrieel belang kunnen zijn8,9, 10. het biotechnologische potentieel van de Pacifische oester is nog niet verkend. Daarom zijn wij van mening dat deze convergerende methode voor de voorbereiding van een virtueel gesequentieerde cDNA-Bibliotheek ook geschikt zal zijn voor niet-gespecialiseerde onderzoekers die cDNA van dit relevante biologische materiaal willen genereren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Opmerking: een schematisch overzicht wordt weergegeven in afbeelding 1.

1. monsterverzameling

  1. Verkrijgen van oester preparaten. Houd oesters op ijs tijdens de Pluk periode, het transport en voorafgaand aan het laboratoriumgebruik en het proces binnen 4-7 dagen na aankoop.
    Opmerking: voor dit protocol werden oesters gekocht van Zhong Cai Wholesale Market in Nanjing (afkomstig uit Ningde, Fujian, China en Lianyungang, Jiangsu, China), Haijie Aquatic product Company in Qingdao (afkomstig uit Qingdao, Shandong, China), Jucheng Aquatic product Company in Yantai (afkomstig uit Yantai, Shandong, China) en Jinxiu Aquatic product Company in Qingdao (afkomstig uit Qingdao, Shandong, China)).

2. RNA-isolatie door teruggehydrolyseerd thiocyanaat-fenol extractie

  1. Bereiding van het oester weefselmonster
    1. Knip ongeveer 100 mg homogeen zacht weefsel uit het geschatte geometrische middelpunt van elk oester specimen met een gesteriliseerde scalpel en breng de monsters over in vloeibare stikstof.
    2. Euthaniseer het overgebleven deel van de oesters door bevriezing bij-80 °C gedurende 1 uur en gooi af als biologisch afval.
    3. Slijp het met Flash bevroren oester weefsel tot een fijn poeder in een mortel (200 mL) gevuld met 50 mL vloeibare stikstof.
    4. Weeg 75 mg van het bevroren weefsel van elk preparaat af in een steriele centrifugebuis van 1,5 ml en meng met 1 ml van het teruggehydrolyseerd thiocyanaat-fenol extractie reagens. Centrifugeer het monster met 14.000 x g bij 4 °c gedurende 15 minuten.
  2. Breng de supernatant over naar een nieuwe centrifugebuis van 1,5 mL, voeg 200 μL chloroform toe en meng grondig door een Vortex-mixer voor 10-15 s te gebruiken totdat het mengsel melkachtig wit wordt.
  3. Centrifugeer op 14.000 x g bij 4 °c gedurende 15 minuten en breng de bovenste waterige laag voorzichtig over met een pipet van 200 μL zonder de interfase te storen in een nieuwe centrifugebuis van 1,5 ml.
  4. Voeg 500 μL isopropylalcohol toe en meng de monsters zachtjes door de inversie en laat de monsters 20 minuten op ijs liggen. Centrifugeer op 14.000 x g bij 4 °c gedurende 8 minuten en verwijder het supernatant.
  5. Respendeer elk van de pellets in 1 mL van 75% EtOH en centrifugeer bij 4 °C gedurende 5 minuten bij 14.000 x g . Verwijder alle supernatant.
  6. Herhaal stap 2,5 eenmaal. Droog de pellets gedurende 6 minuten bij kamertemperatuur. Niet langer drogen; anders kan het moeilijk zijn om de RNA-pellet in de volgende stap op te lossen.
  7. Los de gedroogde RNA-pellet op in 25 μL DEPC (diethylpyrocarbonaat)-behandeld water en houd de buis op ijs. Gebruik RNA-samples binnen 24 uur.

3. cDNA-Bibliotheek generatie door omgekeerde transcriptie

  1. Bereid voor elk RNA-monster een reactiemengsel met behulp van een commercieel reverse transcriptie systeem met een pipet van 10 μL: Voeg 4 μL MgCl2 -oplossing, 2 μl 10X-reactie buffer, 2 μl dNTP-oplossing, 0,5 ΜL RNase-remmer, 0,7 ΜL AMV-achteruit Transcriptase, 0,5 μL oligo (dT) 15 primer, 1 μL van het geëxtraheerde RNA-monster en 9,3 μL H2O in een PCR-buis van 300 μl.
  2. Incuberen mengsel in een PCR-Thermocycler gedurende 60 min bij 42 °C en verhoog de temperatuur tot 95 °C gedurende 5 minuten.
  3. Bewaar de gegenereerde cDNA-Bibliotheek tot 12 maanden bij-20 °C.

4. mitochondriale genamplificatie en zuivering

  1. Bereid een PCR-mengsel met een pipet van 10 μL. Voeg 0,25 μL (1,25 U) van High-Fidelity DNA-polymerase toe, 2 μL dNTP-oplossing (2,5 mM van elke dNTP), 0,5 μL van de COX1 of ND-voorwaartse primer (100 μM), 0,5 μL van de corresponderende COX1 of ND reverse primer (100 μM), 1 μL van de cDNA-Bibliotheek , 5 μL 5x bufferoplossing en 16 μL gedistilleerd H2O in een PCR-buis van 300 μL.
  2. Voer de PCR-amplificatie uit met de volgende parameters: na een initiële denaturatiestap bij 95 °C (duur 5 min), 35 PCR-reactie cycli bestaande uit een gloeien stap bij 55 °C (30 s), rek bij 72 °C (2 min), en denaturatie stap bij 95 °C (30 s) , voer één finaliserende rekstap gedurende 5 min bij 72 °C uit.
  3. Gebruik 5 μL van het PCR-product om te controleren door agarose-gel elektroforese de kwaliteit van het verkregen PCR-product. Observeer het versterkte COX1 of het ND-gen als één band op respectievelijk 759 of 748 basis paren.
  4. Reinig de rest van het PCR-product met een PCR clean-up Kit.
    1. Voeg 100 μL oplossing "PCR-A" (DNA-bindende buffer die hoge concentraties van chaotrope zouten11bevat) toe aan het monster. Vortex kort om de inhoud te mengen.
    2. Plaats de zuiverings kolom in een centrifugebuis van 2 mL. Pipetteer het reactiemengsel van 4.4.1. in de kolom. Centrifugeer op 14.000 x g gedurende 1 minuut bij kamertemperatuur.
    3. Gooi het filtraat weg van de centrifugebuis. Keer de kolom terug naar de 2 mL centrifugebuis, voeg 700 μL oplossing ' W2 ' toe aan de kolom en centrifugeer bij 14.000 x g gedurende 1 minuut bij kamertemperatuur (' W2 ' is een wasoplossing die hoge concentraties ethanol bevat voor het verwijderen van rest chaotrope zouten uit de zuiverings kolom).
    4. Gooi het filtraat weg en keer de kolom terug naar de 2 mL centrifugebuis. Voeg 400 μL oplossing ' W2 ' toe aan de kolom en centrifugeer bij 14.000 x g gedurende 1 minuut bij kamertemperatuur.
    5. Verwarm 1 mL gedeïoniseerd water tot 65 °C in een metalen blok verwarmer. Breng de kolom over in een nieuwe centrifugebuis van 1,5 mL. Pipetteer 25 μL van het warm voorverwarmde gedeïoniseerd water van 65 °C in het midden van het witte kolom membraan. Laat het membraan 1 minuut weken bij kamertemperatuur.
    6. Centrifugeer op 14.000 x g gedurende 1 minuut bij kamertemperatuur en gooi de kolom weg.
  5. Bewaar het gezuiverde PCR-product tot 12 maanden bij-20 °C.

5. mitochondriale gensequencing en vergelijking

  1. Stuur de gezuiverde PCR-monsters van stap 4,5 voor Sanger-sequencing met behulp van de relevante COX1 of ND forward primers als sequencing-primers. Optioneel kunnen de COX1 of ND reverse primers ook worden gebruikt voor bidirectionele sequencing.
  2. Na het ophalen van de resultaten van de sequentiëren, vergelijkt u de sequenties met de genoom volgorde van de Pacifische Oyster-referentiestam (NCBI-taxonomie-ID: 29159) met behulp van het hulpprogramma NCBI nucleotide BLAST online (blast.ncbi.nlm.nih.gov) (Figuur 2 en Figuur 3 ).

6. toepassing van de cDNA-Bibliotheek voor het klonen van de genen MgUGD en MgUXS

  1. Versterk en reinig de MgUGD-en MgUXS-genen met behulp van de respectievelijke voorwaartse en omgekeerde primers van MgUGD en MgUXS door PCR volgens de stappen 4,1. tot 4,4.
  2. Breng 2 μL verterings buffer (10x geconcentreerd) en 6 μL gedeïoniseerd water over in een centrifugebuis van 1,5 mL. Voeg 10 μl van de gezuiverde mgugd-of mguxs-PCR-producten toe, samen met de restrictie-enzym nde i en xho I (1 μL elk, 20 U). Inincuberen bij 37 °C gedurende 3 uur.
  3. Bereid de predigested pET-30A vector: Breng 500 ng van de pET-30A vector over in een nieuwe centrifugebuis van 1,5 mL en zet het volume op 16 μL met gedeïoniseerd water. Voeg 2 μl verterings buffer (10x geconcentreerd) toe samen met de restrictie-enzym nde i en xho I (elk 1 μl, 20 U).
    1. Na het mengen van het mengsel bij 37 °C gedurende 3 uur, voeg 1 μL alkalische fosfatase (1 U) toe en inincuberen bij 37 °C gedurende een extra uur. Inactiveren van de alkalische fosfatase door verwarmen bij 75 °C gedurende 10 minuten in een voorverwarmde metalen blok verwarmer.
  4. Breng 4 μL van de verteerde MgUGD-of MgUXS-DNA-producten over in verse 1,5 mL centrifugebuizen en voeg 4 μL van de verteerde pET-30A vector toe. Voeg 1 μL Ligatie buffer (10x), 1 μL T4 ligase (3 U) toe en inbroed het reactiemengsel bij 22 °C gedurende 3 uur.
  5. Transformeer elektrocompetente E. coli Mach1 competente cellen door middel van elektroporation met behulp van de ligatie producten. Verdeel de getransformeerde cellen op LB agar platen met 50 μg/mL kanamycine. Incuberen cellen bij 37 °C gedurende 16 uur.
  6. Verifieer kolonies voor de gewenste plaatsing door Sanger-sequencing met behulp van de plasmide-specifieke T7 promoter en Terminator primers. Bereid plasmiden uit de gevalideerde bacteriële klonen.

7. expressie-en activiteitstests van MgUGD en MgUXS

  1. Transformeer E. coli BL21 (DE3) bevoegde cellen met plasmiden die de MgUGD-en MgUXS-genen dragen en verdeel de getransformeerde cellen op lb agar-platen met 50 μg/ml kanamycine. Incuberen cellen bij 37 °C gedurende 16 uur.
  2. Cultiveer een enkele kolonie in 5 mL LB medium met 50 μg/mL kanamycine 's nachts. Breng de cultuur over in 400 mL LB medium en schud continu bij 200 rpm bij een temperatuur van 37 °C tot de optische dichtheid bij een golflengte van 600 nm (OD600) een absorptie van ongeveer 0,5 bereikt.
    1. Verlaag de incubatietemperatuur tot 20 °C en Voeg 400 μL Isopropyl β-D-thiogalactopyranoside toe (concentratie 1 M). Induceren van de expressie van de recombinant eiwitten voor 3 h.
  3. Oogst cellen door centrifugeren bij 4.500 x g gedurende 15 minuten bij 4 °c. Suspendeer pellets in 10 mL lysisbuffer (100 mM NaCl, 50 mM tris/HCl, 1% Triton X-100, 1 mM fenylmethylsulfonyl-fluoride (PMSF), pH 8,0).
  4. Verstoren cellen door sonicatie voor 20 min (40 aan/uit cycli met 20 μm amplitude voor 15 s bij 4 °C). Centrifugeer gedurende 20 minuten bij 4 °C bij 14.000 x g en verzamel het supernatant voor de activiteit test.
  5. Voer de activiteitstest van MgUGD uit door 2 μL cellysaat met 2 μL UDP-glucose (10 mM) te bebroed, 4 μL NAD+ (10mm), 4 μl MgCl2 (10 mm), 2 μl tris/HCl-buffer (500 mm, pH 7,5) en 6 μl gedeïoniseerd H2O in een nieuwe 1,5 mL centrifugebuis en inincuberen bij 37 °C gedurende 30 min.
  6. Voer de activiteitstest van MgUXS uit door 2 μL cellysaat te bebroed met 2 μL UDP-glucuronzuur (10 mM), 2 μL tris/HCl-buffer (500 mM, pH 7,5) en 14 μL gedeïoniseerde H2O in een nieuwe centrifugebuis van 1,5 ml en inincuberen bij 37 °c gedurende 30 minuten.
  7. Quencheer de reacties in stap 7,5 en 7,6 door aan elk mengsel 20 μL methanol en 40 μL chloroform toe te voegen. Centrifugeer na het monster mengsel op 14.000 x g gedurende 6 minuten bij 4 °c en verzamel de bovenste waterige laag van elke buis.
  8. Analyseer de reactieproducten met behulp van MALDI-TOF massaspectrometrie in negatieve ionisatie modus in het m/z-bereik van 500-700. Meng 1 μL monster mengsel met 1 μL van 2,5-dihydroxybenzoinezuur-monstermatrix (1% g/V in 50% waterige acetonitril). Observeer de verwachte m/z-waarden bij respectievelijk 579 en 535 voor UDP-glucuronic acid en UDP-xylose (Figuur 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figuur 1 toont een schematisch overzicht van de beschreven bereidingswijze van de convergente cDNA Library, afgeleid van Pacific Oyster individuen. Figuur 2 toont de sequenties van de COX1 en ND genen van een verre verwant oester specimen met een hoge divergentie van de COX1 en ND gen sequenties van het referentiemateriaal. Figuur 3 toont de sequenties van de COX1 en ND genen van een nauw verwant oester specimen met een geringe divergentie van de COX1 en ND gensequenties van het referentiemateriaal. Figuur 4 toont de succesvolle toepassing van de cDNA-Bibliotheek om de industrieel relevante genen MgUGD en MgUXS te klonen.

Figure 1
Figuur 1 : Schematisch overzicht van de beschreven analysemethode voor moleculaire identificatie van Pacifische oester specimen met behulp van COX1 en ND als referentie genen. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 : Sequentie uitlijning van de COX1-en ND-gensequenties van een sterk divergente specimen vergeleken met de COX1-en ND-gensequenties van de referentie Pacifische oester stam. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Sequentie uitlijning van de COX1-en ND-gensequenties van een nauw verwant specimen vergeleken met de COX1-en ND-gensequenties van de referentie Pacifische oester stam. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 : Schematisch overzicht van moleculair klonen, recombinant expressie en detectie van de reactieproducten van MgUGD en MgUXS. Klik hier om een grotere versie van dit cijfer te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het gepresenteerde protocol maakt de genetische identificatie mogelijk van niet-gerefereerde oester specimens met soortgelijk fenotype van regionale vismarkten door vergelijking van de COX1-en ND-genen met een publiekelijk beschikbare oester-DNA-genoom-database. Het belang van deze methode ligt in zijn eenvoud, omdat er slechts één PCR-reactie nodig is voor de evaluatie van de virtuele cDNA-Bibliotheek. De twee geconjugeerde mitochondriale COX1 en ND-genen werden versterkt uit een cDNA-bibliotheek die werd gegenereerd door omgekeerde transcriptie van RNA-extracten van elke oester. De methode van RNA-isolatie (stap 2,1) werd vereenvoudigd door het oester weefsel rechtstreeks in vloeibare stikstof te slijpen. Na het sequentiëren van de COX1 en ND genen van elk specimen, bleek sequentie overeenstemmingen dat sommige monsters een hoge gelijkenis vertonen met de referentiestam. De naaste verwant toonde volledige identiteit van zowel de COX1 en de ND gen sequenties.

De meest kritieke stappen van deze procedure zijn de RNA-extractie stap; om de afbraak van RNA te minimaliseren, is het essentieel om de tijd te verkorten tussen het oogsten van het oester weefsel en de RNA-extractie.

Succesvolle klonen werd onlangs geïllustreerd door het klonen van de Oyster UGE Gene12 en hierin door het klonen van de MgUGD en MgUXS genen13, die de uitvoerbaarheid van de gegenereerde cDNA-Bibliotheek gevalideerd, waardoor klonen van een aantal genen van belang zonder de noodzaak van omslachtige kloon strategieën met ontaarde primers. Deze methode van moleculaire identificatie door versterking van de COX1-en ND-genen om vrijwel gesequentieerde cDNA-bibliotheken te genereren, kan ook worden gebruikt in toekomstige toepassingen voor andere biologische materialen die geen fysieke monsters hebben van gerefereerde genomen Beschikbaar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd deels gesteund door de Natural Science Foundation van China (Grant nummers 31471703, A0201300537 en 31671854 tot J.V. en ll, grantnummer 31470435 tot G.Y.) en het 100 buitenlands talenten plan (subsidie nummer JSB2014012 aan J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics