CRISPR/Cas9 gebruiken om GM-CSF uit te nemen in CAR-T-cellen

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren we een protocol voor genetisch gemodificeerde CAR-T cellen via een CRISPR/Cas9 systeem.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimeric antigeen receptor T (CAR-T) celtherapie is een Cutting Edge en potentieel revolutionaire nieuwe behandelingsoptie voor kanker. Echter, er zijn aanzienlijke beperkingen aan haar wijdverbreide gebruik bij de behandeling van kanker. Deze beperkingen omvatten de ontwikkeling van unieke toxiciteiten zoals cytokine release Syndrome (CRS) en neurotoxiciteit (NT) en beperkte expansie, Effector functies, en anti-tumor activiteit in vaste tumoren. Een strategie ter verbetering van de werkzaamheid van CAR-t en/of controle toxiciteiten van CAR-T-cellen is om het genoom van de auto-T-cellen zelf te bewerken tijdens de productie van auto-T-cel. Hier beschrijven we het gebruik van CRISPR/Cas9-genbewerking in CAR-T-cellen via transductie met een lentivirale constructie die een RNA-geleiding bevat naar granulocyt macrofaag kolonie-stimulerende factor (GM-CSF) en Cas9. Als voorbeeld beschrijven we CRISPR/Cas9 gemedieerde Knockout van GM-CSF. We hebben aangetoond dat deze GM-CSFk/o Car-t cellen effectief minder GM-CSF produceren met behoud van kritische T cel functie en resulteren in verbeterde anti-tumor activiteit in vivo in vergelijking met wild type auto-T cellen.

Introduction

Chimeric antigeen receptor T (CAR-T) celtherapie vertoont een grote belofte in de behandeling van kanker. 1 , 2 twee Car-T-celtherapieën gericht op CD19 (CART19) werden onlangs goedgekeurd in het Verenigd verklaarde en in Europa voor het gebruik in B celmaligniteiten na het aantonen van opvallende resultaten in multicenter klinische proeven. 3 , 4 , 5 barrières voor meer wijdverbreid gebruik van auto-T-cellen zijn beperkte activiteit in vaste tumoren en geassocieerde toxiciteiten, waaronder cytokine release SYNDROOM (CRS) en neurotoxiciteit (NT). 3 , 5 , 6 , 7 , 8 , 9 om de therapeutische index van Car-t-celtherapie te verbeteren, worden genoom engineering tools zoals zink vinger nucleasen, Talens en crispr gebruikt om de auto-t-cellen verder te wijzigen in een poging om minder toxische of effectievere auto-t-cellen te genereren. 10 , 11

In dit artikel beschrijven we een methode voor het genereren van CRISPR/Cas9 bewerkte CAR-T-cellen. Het specifieke doel van deze methode is het genetisch wijzigen van de auto-T cellen tijdens de productie van CAR-T cel via CRISPR/Cas9 om minder toxische of effectievere auto-T cellen te genereren. De logica voor het ontwikkelen van deze methodologie is gebaseerd op lessen geleerd uit klinische ervaring met CAR-T-celtherapie, die wijst op een dringende behoefte aan nieuwe strategieën om het therapeutische venster van CAR-T-celtherapie te verhogen en de toepassing uit te breiden tot andere tumoren en wordt ondersteund door de recente vooruitgang in de synthetische biologie waardoor meerdere modificaties van auto-T cellen die zijn begonnen met het betreden van de kliniek. Terwijl verschillende genoom engineering tools worden ontwikkeld en toegepast in verschillende instellingen, zoals zink vinger nucleasen, Talens en crispr, beschrijft onze methodologie crispr/Cas9 modificatie van Car-T cellen. 10 , 11 crispr/Cas9 is een op RNA gebaseerd bacterieel afweermechanisme dat is ontworpen om vreemd DNA te elimineren. Crispr vertrouwt op enzym om een doel sequentie te klieven die wordt geïdentificeerd door middel van een RNA geleider (grna). Crispr editing van Car-T cellen biedt verschillende voordelen ten opzichte van andere genoom engineering tools. Deze omvatten nauwkeurigheid van de gRNA-sequentie, eenvoud om een gRNA te ontwerpen die gericht is op het gen van belang, hoge genbewerkings efficiëntie en de mogelijkheid om meerdere genen te targeten, omdat meerdere Grna's tegelijkertijd kunnen worden gebruikt.

Specifiek in de hier beschreven methoden gebruikten we een lentivirus codering CRISPR Guide RNA en Cas9 om een gen te verstoren tijdens auto-transductie van T-cellen. Bij het selecteren van een geschikte techniek om auto-T-cellen te bewerken, stellen we voor dat de hier beschreven techniek een efficiënt mechanisme is voor het genereren van onderzoekskrige auto-T-cellen, maar omdat het lange termijn effect van permanente integratie van Cas9 in het genoom onbekend is, Stel deze methodologie voor om proof of concept Research-cellen te ontwikkelen, maar niet voor het produceren van goede productiepraktijken met grade CAR-T-cellen.

In het bijzonder beschrijven we hier de generatie van granulocyt macrofaag kolonie stimulerende factor (GM-CSF) Knockout CAR-T cellen gericht op Human CD19. Deze auto-T-cellen werden gegenereerd door transductie met linvirale deeltjes die een specifieke RNA-gids coderen, specifiek voor GM-CSF (gennaam CSF2) en Cas9. We ontdekten eerder dat GM-CSF neutralisatie CRS en NT in een xenotransplantaatmodellen is-model uitstraalt. 12 GM-CSFk/o Car-t cellen zorgen voor de REMMING van GM-CSF tijdens het productieproces, effectief vermindering van de productie van GM-CSF terwijl het verbeteren van auto-T cel anti-tumor activiteit en overleving in vivo in vergelijking met wild type Car-t cellen. 12 zo bieden we hier een methodologie voor het genereren van crispr/CAS9 bewerkte Car-T-cellen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Dit protocol volgt de richtlijnen van de instellings Raad voor institutionele toetsing (IRB) en het Comité voor institutionele bioveiligheid (IBC) van de Mayo Clinic.

1. CART19 celproductie

  1. T-cel isolatie, stimulatie en ex-vivo cultuur
    1. Voer alle celkweek werkzaamheden uit in een celcultuurkap met behulp van geschikte persoonlijke beschermingsmiddelen. Oogst perifere bloed mononucleaire cellen (PBMCs) van de geïdentificeerde normale donorbloed kegels die tijdens aferese worden verzameld, aangezien deze bekend staan als een levensvatbare bron van PBMCs.13
    2. Om PBMCs te isoleren, voegt u 15 mL van een dichtheidsgradiënt medium toe aan een scheidingsbuis van 50 mL met dichtheidsgradiënt. Verdun het donorbloed met een gelijk volume fosfaatgebufferde zoutoplossing (PBS) dat 2% foetaal runderserum (FBS) bevat om celovervulling te voorkomen.
      1. Voeg het verdunde donorbloed uit de kegel toe aan de scheidingsbuis, en zorg ervoor dat de interface tussen het bloed en het dichtheidsgradiënt niet wordt verstoord. Centrifugeer bij RT 1.200 x g gedurende 10 minuten.
      2. Decanteren de supernatant in een nieuwe 50 ml conische, wassen met PBS + 2% FBS door te brengen tot 40 ml, centrifugeer bij 300 x g voor 8 min bij RT, aspiraat supernatant, respenderen in 40 ml buffer, en Tel cellen.
    3. Isoleer T-cellen van PBMCs via een negatieve selectie magnetische kraal Kit met behulp van een volledig geautomatiseerde celseparator volgens het Protocol van de fabrikant.
    4. Om de geïsoleerde T-cellen te kweken, bereidt u T Cell medium (TCM) voor, dat bestaat uit 10% humaan AB-serum (v/v), 1% penicilline-streptomycine-glutamine (v/v) en serumvrij hematopoietische celmedium. Steriliseren het medium door te filteren door een 0,45 μm steriele vacuüm filter en vervolgens met een 0,22 μm steriel vacuüm filter.
    5. Op dag 0 (de dag van de stimulatie van de T-cel), wassen CD3/CD28 kralen voorafgaand aan stimulatie van T-cellen. Om te wassen, plaats het benodigde volume kralen (gebruik genoeg CD3/CD28 kralen voor een verhouding van 3:1 kralen: T cellen; opmerking de concentratie van kralen kan variabel zijn) in een steriele 1,5 mL micro centrifugebuis en respenderen in 1 mL TCM.
    6. Plaats in contact met een magneet.
    7. Na 1 min, aspireren de TCM en respenderen in 1 mL verse TCM te wassen van de kralen.
    8. Herhaal deze procedure voor een totaal van drie washes.
    9. Na de derde wasbeurt, de kralen respenderen in 1 mL TCM.
    10. Tel de T-cellen.
    11. Breng kralen over naar de T-cellen in een verhouding van 3:1 kralen: cellen.
    12. Verdun cellen tot een uiteindelijke concentratie van 1 x 106 cellen/ml.
    13. Incuberen bij 37 °C, 5% CO2 voor 24 uur.
  2. T celtransfectie en transductie
    1. Uitvoeren van linviraal werk met behulp van BSL-2 + voorzorgsmaatregelen, met inbegrip van celkweek kappen, persoonlijke beschermingsmiddelen, en desinfectie van gebruikte materialen met bleekwater voor verwijdering.
    2. Verwerven van een CART19 construct in een linvirale vector.
      Opmerking: de CART19 construct gebruikt hier werd ontworpen en vervolgens gesynthetiseerd de Novo met behulp van een commercieel beschikbare eiwitsynthese leverancier. De auto constructie werd vervolgens gekloond tot een derde generatie lentivirus onder controle van een EF-1α-promotor. Het fragment van de enkele keten variabele regio is afgeleid van de FMC63 kloon en herkent menselijke CD19. De CAR19 construct bezit een tweede generatie 4-1BB costimulatory domein en CD3ζ stimulatie (FMC63-41BBz). 12
    3. Voer lentivirale productie uit zoals eerder beschreven. 12
      1. In het kort, om lentivirus te produceren, gebruik 293T cellen die 70-90% confluency hebben bereikt.
      2. Incubatie gedurende 30 minuten bij kamertemperatuur van trans fectie reagentia, waaronder 15 μg van het linvirale plasmide van belang, 18 μg een gag/Pol/tat/Rev Packaging vector, 7 μg VSV-G envelop vector, 111 μL van het pre-complexerende reagens, 129 μL van de transfectie reagens, en 9,0 ml van het transfectie medium alvorens toe te voegen aan de 293t cellen. Dan cultuur de getransfunde cellen bij 37 ° c, 5% CO2.
      3. Oogst, centrifuge (900 x g gedurende 10 min), filter (0,45 μM nylon filter), en concentreer supernatant bij 24 en 48 h door ultracentrifugatie bij ofwel 13.028 x g voor 18 h of 112.700 x g voor 2 uur.
      4. Vries bij-80 °C voor toekomstig gebruik.
    4. Op dag 1, voorzichtig respenderen T cellen te breken van de rozetten van T cellen die was gestimuleerd op 1 x 106/ml op dag 0.
    5. Onder passende BSL-2 + voorzorgsmaatregelen voor alle linviraal werk, voeg vers of bevroren geoogste virus toe aan de gestimuleerde T-cellen bij een veelheid van infecties (MOI) van 3,0.
  3. CAR-T-celuitbreiding
    1. Tijdens de fase van expansie, blijven de getransduceerde T-cellen ininbroden bij 37 °C, 5% CO2. Tel auto-T-cellen op dag 3 en 5 en voeg verse, voorverwarmde TCM toe aan de cultuur om een auto-T-celconcentratie van 1 x 106/mlte behouden.
    2. Verwijder kralen uit de getransduceerde T-cellen 6 dagen na stimulatie (dag 6) met behulp van een magneet. Oogst, respendeer en plaats T-cellen in 50 mL conische buizen in een magneet gedurende 1 minuut. Verzamel vervolgens de supernatant (bevat de auto-T cellen), en gooi de kralen weg.
    3. Plaats de verzamelde auto-T-cellen terug in de cultuur met een concentratie van 1 x 106 cellen/ml om de uitbreiding te hervatten.
    4. Op dag 6, evalueer de oppervlakte uitdrukking van de auto doorstroming cytometrie.
      Opmerking: verschillende methoden kunnen worden gebruikt om de oppervlakte uitdrukking van de auto te detecteren, zoals kleuring met een geadsorbeeerd secundair antilichaam van een geit (H + L) of door kleuring met een CD19 specifiek peptide, geconjugeerd met een fluorchroom. Neem hier een aliquot (ongeveer 100.000 T-cellen) uit de cultuur en was met Flow buffer bereid met Dulbecco's fosfaat-gebufferde zoutoplossing, 2% foetaal runderserum en 1% natrium azide. Beits de cellen met het anti-auto-antilichaam en spoel twee keer. Beits de cellen met levend/dode vlek en CD3 monoklonaal antilichaam (OKT3). Was de cellen en respendeer in de flow buffer. Verwerven op een cytometer om de transductie-efficiëntie te bepalen.
  4. Auto-T-cel cryopreservatie
    1. Om te oogsten en invriezen Car-T cellen 8 dagen na stimulatie (dag 8 van T cel expansie), oogst de cellen uit de cultuur.
    2. Draai gedurende 5 min op 300 x g.
    3. Respenderen in Vries medium bij 10.000.000 cellen per mL per injectieflacon in Vries medium bestaande uit 10% dimethylsulfoxide en 90% foetaal runderserum.
    4. Vries in een vrieskist om een koelsnelheid te bereiken van-1 °C/min in een vriezer van 80 °C en vervolgens over te brengen naar vloeibaar stikstof na 48 uur.
    5. Voorafgaand aan hun gebruik voor in vitro of in vivo experimenten, ontdooien auto-T cellen in warme TCM.
    6. Was de cellen om het dimethylsulfoxide te verdunnen en te verwijderen en te respenderen tot een concentratie van 2 x 106 cellen/ml in warme tcm. Rust 's nachts bij 37 °C, 5% CO2.

2. GM-CSF k/o CART19 productie

  1. Om GM-CSF te verstoren, gebruik maken van een gids RNA (gRNA) gericht op Exon 3 van humaan GM-CSF (CSF2) geselecteerd via screening gRNAs eerder gemeld te hebben hoge efficiëntie voor het CSF2 gen dat codeert voor de menselijke cytokine GM-CSF. 14
    Opmerking: een commercieel gesynthetiseerd onderzoeksniveau Cas9 derde generatie linviral construct met deze gRNA (onder een U6 Promoter) werd gebruikt. De constructie bevat een puromycine resistentie-gen. De sequentie van de gRNA is GACCTGCCTACAGACCCGCC. 12
  2. Om lentivirus te produceren, gebruik maken van 293T cellen die 70-90% confluency hebben bereikt.
  3. Laat 15 μg van het linvirale plasmide van belang, 18 μg een gag/Pol/tat/Rev Packaging vector, 7 μg van een VSV-G-envelop vector, 111 μL van het pre-complexerende reagens, 129 μL van het transfectiereagens, en 9,0 mL van het transfectie medium om 30 min in kamer te inbroed houden.
  4. Voeg transfectie reagentia toe aan de 293t cellen. Dan cultuur bij 37 °C, 5% CO2.
  5. Oogst, centrifuge (900 x g gedurende 10 min), filter (0,45 μM nylon filter) en concentraat supernatant bij 24 en 48 h door ultracentrifugatie bij ofwel 13.028 x g voor 18 h of 112.700 x g voor 2 uur en bevriezen bij-80 °c voor toekomstig gebruik.
  6. Op dag 1 wordt de T-cellen voorzichtig hervat om rozetten te breken.
  7. Voeg in een BSL-2 + goedgekeurd laboratorium bevroren of vers geoogste virussen toe aan de gestimuleerde T-cellen om auto-T-cellen te genereren. Trans Duce T-cellen met zowel de CAR19 lentivirus en GM-CSF gericht op CRISPR lentivirus. Voeg CAR19 lentivirus toe aan een MOI van 3. Aangezien titratie van het CRISPR lentivirus niet haalbaar was, gebruikt u virusdeeltjes gegenereerd uit een 15 UG plasmide preparaat om 10 x 106 T cellen te leiden.
  8. Zie de resterende stappen van T Cell stimulatie, uitbreiding en cryopreservatie zoals besproken in stap 1.
  9. Voor lentiCRISPR-bewerkte T-cellen met puromycine resistentie, behandel cellen met puromycine dihydrochloride in een concentratie van 1 μg puromycine per 1 mL op dag 3 en dag 5.

3. GM-CSF-verstoring efficiëntie en functionele beoordeling van GM-CSF k/o CART19

  1. GM-CSF disruptie efficiency: volgen van indels door ontleding (TIDE) sequencing en analyse
    1. Voor het sequentieren van de Exon van belangstelling in GM-CSF-gen, gebruik de volgende primers. Gebruik een voorwaartse primer voor GM-CSF (CSF2) van TGACTACAGAGAGGCACAGA, en een omgekeerde primer sequentie van TCACCTCTGACCTCATTAACC.
    2. Extraheer DNA uit maximaal 5.000.000 auto-T-cellen met een genomische extractie Kit. Voor de PCR-reactie, gebruik 25 μL van een Taq Mastermix per reactie met een uiteindelijke concentratie van elke primer in de PCR-reactie van μM, 0,1-0,5 μg template DNA, en een totaal volume van de PCR-reactie gebracht tot 50 μL met Nuclease vrij water.
    3. Zie de PCR-fiets condities zoals beschreven in tabel 1.
    4. Voer PCR-samples uit op een 1-2% agarose-gel bij 100 V gedurende 30 minuten en extract met een gel-extractie pakket.
    5. Sequentie PCR amplicons. Bereken allel modificatie frequentie door het uploaden van RAW data naar een gepaste TIDE software. 15
  2. GM-CSF productie en functionele beoordeling van GM-CSFk/o CART19
    1. Om de cytokine-productie van auto-T-cellen te bepalen, inincuberen wild type CART19 cellen en GM-CSFk/o CART19 met de CD19 uitdrukken van acute lymfoblastische leukemie CELLIJN NALM6 bij een 1:5 ratio voor 4 uur bij 37 °c, 5% Co2 in de aanwezigheid van monensin oplossing, Anti-menselijke CD49d, Anti-menselijke CD28, en anti-menselijke CD107a.
    2. Oogst cellen uit cultuur voor Flowcytometrie. Was de cellen met Flow cytometrie buffer. Beits de cellen met een Live/Dead kleuringsset. Inincuberen in het donker bij kamertemperatuur gedurende 15 min. Fixeer de cellen met een fixatie medium en inbroed gedurende 15 minuten in het donker bij kamertemperatuur.
    3. Na het wassen de cellen intracellulair met permeabilization medium in combinatie met anti-humaan IFNγ monoklonaal antilichaam, anti-humane GM-CSF, anti-humane MIP-1β, Anti-menselijke IL-2, en anti-humaan CD3 en inbroed in het donker bij kamertemperatuur 30 min. wassen en rehervatten van de monsters. Het verwerven van monsters op een flow cytometer en geanalyseerd voor percentage van intracellulaire GM-CSF expressie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figuur 1 toont reductie van GM-CSF in GM-CSFk/o CART19 cellen. Om na te gaan of het genoom van de T-cellen werd gewijzigd om GM-CSF te Knockout, werd getij sequencing gebruikt in de GM-CSFk/o CART19 cellen (Figuur 1a). AUTO-T-celoppervlak kleuring verifieert dat de T-cellen de auto-oppervlak receptor in vitro met succes uitdrukken door te geren op levende CD3 + cellen (Figuur 1b). Intracellulaire kleuring van GM-CSF door flow cytometrie toont verminderde expressie van GM-CSF in GM-CSFk/o CART19 cellen door te gating op levende CD3 + cellen, het controleren van functioneel succes van de knockout (figuur 1c). GM-CSFk/o Car-t cellen vertonen een afname van GM-CSF in vergelijking met wild type anti-CD19 Car-t cellen (CART19) via intracellulaire kleuring (Figuur 1b). Bovendien, we hebben eerder aangetoond dat GM-CSFk/o auto-t cellen productie van GM-CSF verminderen terwijl het verbeteren van anti-tumor activiteit en overleving in vergelijking met wild type Car-t cellen in vivo. 12 

Stap Temperatuur (°C) Tijd Cycli
Initiële denaturatie 94 3 min. 1
Denaturatie 94 45 sec 35
Annealing 60 30 sec
Extensie 72 2 min.
Post-rek 72 10 min. 1
4

Tabel 1: PCR-fiets condities voor getijden sequencing van GM-CSFk/o CART19 cellen.

Figure 1
Figuur 1 : GM-CSFk/o CART19 cellen tonen reductie in GM-CSF. A) een representatieve getijden sequentie verifieert genoom wijziging van GM-CSF Crispr/Cas9 GM-CSFk/o CART19 cellen met een verstoring van de efficiëntie van ~ 71%. B) representatieve stromings percelen met een succesvolle auto-T-celproductie met vergelijkbare auto-expressie op wild type CART19 en GM-CSFk/o CART19. C) zoals door intracellulaire kleuring wordt getest, vertonen GM-CSFk/o CART19 cellen verminderde GM-CSF in vergelijking met wild type CART19 wanneer gestimuleerd met de CD19 positieve alle cellijn NALM6. Klik hier om een grotere versie van dit cijfer te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In dit rapport beschrijven we een methodologie om CRISPR/Cas9-technologie te gebruiken voor het opwekken van secundaire wijzigingen in CAR-T-cellen. Specifiek, dit wordt aangetoond met behulp van lentivirale transductie met een virale vector die gRNA gericht op het gen van belang en Cas9 voor het genereren van GM-CSFk/o CART19 cellen. We hadden eerder aangetoond dat GM-CSF neutralisatie CRS en NT in een xenotransplantaatmodellen is-model uitstraalt. 12 zoals eerder beschreven, maken GM-CSFk/o Car-T-cellen de REMMING van GM-CSF mogelijk tijdens het fabricageproces, waardoor de productie van GM-CSF effectief wordt verminderd met behoud van andere kritieke T-celfuncties, en resulteren in verbeterde anti-tumor activiteit in vivo in vergelijking met wild type CAR-T cellen. 12

Aangezien de permanente integratie van Cas9 in het genoom gepaard zou kunnen gaan met ongewenste effecten bij de vertaling naar een klinisch levensvatbaar product, stellen wij deze specifieke methodologie voor als een manier om onderzoeksniveau CRISPR/Cas9 gemodificeerde CART19 te genereren voor een proof of concept Experimenten.

Terwijl auto-T cellen beloven in kankertherapie,1,2 hun werkzaamheid kan blijven worden verbeterd en de bijbehorende toxiciteiten beter gecontroleerd. CRISPR/Cas9 technologie biedt een strategie om het genoom van CAR-T cellen direct te richten op oplossingen voor de huidige klinische tekortkomingen. In dit artikel beschrijven we de generatie van GM-CSFk/o CART19 cellen.

GM-CSFk/o Car-t cellen werden gegenereerd door transductie met een lentivirale vector voor de Car-T Cell plasmide en een lentivirusconstructie met een RNA gids voor GM-CSF en Cas9. Om de GM-CSFk/ote genereren, werd een derde generatie lentivirusconstructie (lentiCRISPRv2) met Cas9 en een gerapporteerde High efficiency Guide RNA (grna) gericht op Exon 3 van Human GM-CSF (CSF2)14 onder de controle van een U6 Promoter werd gebruikt. Er moet bijzondere aandacht worden besteed aan de transductie stappen van de procedure, aangezien deze het meest kritisch zijn voor de ontwikkeling van de gemodificeerde auto-T-cellen. De knock-outefficiëntie kan worden geverifieerd en geëvalueerd via het volgen van indels door ontledings sequenties (getijden). Functionele activiteit van auto-T cellen wordt onderzocht door de antigeen specifieke stimulatie van de auto constructie met CD19 + doelcellen, gevolgd door meting van verschillende T-celfuncties, waaronder de productie van GM-CSF. 12 van aantekening, KLEURING voor auto-expressie met een geit anti-muis antilichaam moet plaatsvinden vóór andere antilichaam kleuring met twee spoelingen die zich voordoen vóór de oppervlakte kleuring als gevolg van het enkele keten variabele regio fragment van het CART19 wezen van muis oorsprong. Dit is een punt van nadruk in het oplossen van problemen als een goede auto expressie in eerste instantie niet wordt waargenomen.

Deze gemodificeerde auto-T cellen kunnen worden gebruikt in in vitro studies en in vivo xenotransplantaatmodellen is modellen voor bewijs van concept experimenten. Een voordeel van deze techniek is dat auto-T celproductie en genetische manipulatie beide in één stap kunnen voorkomen met een goede efficiëntie in vergelijking met andere technieken. 10 , 11 terwijl Dual lentivirale transductie een handige en effectieve methode is om de cellen van het ONDERZOEKSNIVEAU GM-CSFk/o CART19 te genereren, wordt het DNA opgenomen in het genoom en langdurige Cas9 expressie kan het genoom destabiliseren en de risico op off-target effecten. Een beperking van deze techniek is dat goed-fabricagepraktijk grade Knockouts zou vereisen wijziging van de techniek om een RiboNucleoProteïne crispr/Cas9 systeem, aangezien deze methodologie niet leidt tot permanente integratie van Cas9 in het genoom en vermindert het potentieel voor off-target effecten. De in het protocol beschreven methodologie kan mogelijk worden toegepast op verschillende genen om de auto-T-cellen genetisch te wijzigen via CRISPR/Cas9 om minder toxische of effectievere auto-T-cellen te genereren.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK is een uitvinder van octrooien op het gebied van auto T-Cell therapie die zijn gelicentieerd aan Novartis (onder een overeenkomst tussen Mayo Clinic, University of Pennsylvania, en Novartis). Deze studies werden deels gefinancierd door een subsidie van Humanigen (SSK). RMS, MJC, RS en SSK zijn uitvinders van octrooien die verband houden met dit werk. Het laboratorium (SSK) ontvangt financiering van Tolero, Humanigen, kite, Lentigen, MorphoSys en actinium.

Acknowledgments

Dit werk werd ondersteund door subsidies van K12CA090628 (SSK), het National Comprehensive Cancer Network (SSK), het Mayo Clinic Center for geïndividualiseerde geneeskunde (SSK), de Predolin Foundation (SSK), de Mayo Clinic Office of translation to practice (SSK), en de Mayo Clinic Medical Scientist training programma Robert L. Howell arts-wetenschapper beurs (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics