वयस्क Zebrafish दिल के अध्ययन के लिए अंतर्वक्षीय इंजेक्शन

Biology
 

Summary

यह विधि वयस्क zebrafish के वक्ष में समाधान के 0.5 − 3 μL के इंजेक्शन पर निर्भर करती है । प्रक्रिया कुशलता से शरीर को नुकसान पहुंचाए बिना zebrafish दिल की निकटता में प्रोटीन और रासायनिक यौगिकों उद्धार । यह उपागम हृदय के विभिन्न ऊतकों पर बहिर्जात कारकों के प्रभावों के परीक्षण के लिए उपयुक्त है ।

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

वयस्क zebrafish दिल हृदय उत्थान अनुसंधान में एक शक्तिशाली मॉडल प्रदान करता है । हालांकि इस प्रणाली की शक्ति ट्रांसजेनिक दृष्टिकोण पर आधारित है, बहिर्जात कारकों की एक तेजी से वितरण कार्यात्मक अध्ययन में एक पूरक तकनीक प्रदान करता है । यहाँ, हम मायोकार्डियल क्षति के कारण के बिना हृदयावरणी गुहा में समाधान के कुछ microliters के प्रशासन पर निर्भर करता है कि एक विधि प्रस्तुत करते हैं । अन्तर्वक्षीय (IT) इंजेक्शन कुशलतापूर्वक प्रोटीन और रासायनिक यौगिकों सीधे दिल की सतह पर वितरित कर सकते हैं । यह अंतःक्षिप्त पदार्थ एपिकार्डियम के माध्यम से हृदय के ऊतकों में विसरित होते हैं । Intraperitoneal (आईपी) इंजेक्शन की तुलना में, intraवक्ष इंजेक्शन का मुख्य लाभ लक्ष्य अंग पर परीक्षण किया कारकों का फोकल प्रशासन है. सीधे हृदयावरण में अणुओं की डिलीवरी वयस्क zebrafish में कार्डिएक प्रीकंडीशनिंग और उत्थान के अध्ययन के लिए एक उपयुक्त रणनीति है ।

Introduction

रीढ़ की हड्डीयों में, zebrafish के पास अपने दिलों को पुनर्जीवित करने के लिए एक उल्लेखनीय क्षमता है1,2। यह क्षमता कई चोट मॉडलों में सूचित किया गया है, अर्थात् वेंट्रिकुलर एपेक्स लकीर, cryoinjury (सीआई) और आनुवंशिक कार्डिओसाइटोसाइट अपक्षरण3,4,5,6,7. आक्रामक चोटों के बाद, वेंट्रिकल की क्षतिग्रस्त दीवार transiently ऊतक, जो उत्तरोत्तर एक नए मायोकार्डियम8,9,10,11द्वारा प्रतिस्थापित किया जाता है द्वारा चंगा हो जाता है । जल्दी घाव भरने की प्रतिक्रिया एपिकरडियम सक्रियण और प्रतिरक्षा कोशिकाओं की भर्ती शामिल12,13,14,15। सहवर्ती, घायल मायोकार्डियम के पास cardiomyocytes सक्रिय हो जाते हैं, dedifferentiate, पैदा करना और उत्तरोत्तर 30 के भीतर घायल क्षेत्र की जगह − 90 दिन16,17,18, 19. हृदय उत्थान के आणविक और सेलुलर तंत्र के गूढ़ रहस्य को हासिल किया गया है, जो आनुवंशिक साधनों की उपलब्धता की बदौलत प्राप्त हुआ है, जैसे कोशिका-वंशावली अनुरेखण विश्लेषण, इंदुच्य जीन अधिव्यंजक, फ्लोरोसेंट ऊतक रिपोर्टर लाइनों, और crispr/Cas9 जीन mutagenesis20,21

हम हाल ही में thoracotomy22,23द्वारा वयस्क zebrafish में कार्डियक प्रीकंडीशनिंग के एक मॉडल की स्थापना की है । Preconditioning हृदय सुरक्षात्मक जीन की अभिव्यक्ति बढ़ जाती है और बरकरार है और regenerating दिल में कोशिका चक्र में फिर से प्रवेश उठ । इन प्रक्रियाओं प्रतिरक्षा कोशिकाओं और मैट्रिक्स remodeling22,24की भर्ती के साथ जुड़े रहे हैं । प्रीकंडीशनिंग के तंत्र खराब समझ रहे हैं, और नई तकनीकों की स्थापना के लिए अनुसंधान के इस क्षेत्र को बढ़ावा देने की आवश्यकता है । विशेष रूप से, स्रावित संकेतन प्रोटीन या अन्य रासायनिक यौगिकों के अनुकूलित प्रशासन आगे इस विषय की जांच करने के लिए आवश्यक है.

जलीय पशु होने के नाते, zebrafish स्वाभाविक रूप से उनके गहरे नाले और त्वचा के माध्यम से पानी में घुले हुए विभिन्न पदार्थों को अवशोषित कर सकता है । यह विविध रसायनों के साथ समाधान में मछली के विसर्जन के माध्यम से गैर इनवेसिव दवा वितरण के लिए एक संभावना प्रदान करता है, ऐसे औषधीय inhibitors, स्टेरॉयड हार्मोन, tamoxifen, BrdU और एंटीबायोटिक दवाओं के रूप में. वास्तव में, हमारे25,26,27सहित विभिन्न प्रयोगशालाओं से कई अध्ययनों ने इस पद्धति का लाभ उठाया है, जो कि पुनर्योजी जीव विज्ञान के क्षेत्र में विशेष रूप से मूल्यवान है । 28. तथापि, यह तरीका है, पेप्टाइड, डीएनए, आरएनए, morpholinos या एक सीमित ऊतक पारगम्यता के साथ अणुओं की डिलीवरी के लिए उपयुक्त नहीं है । इन मामलों में, एक और अधिक कुशल प्रसव के शरीर में microinjection द्वारा हासिल की है, उदाहरण के लिए, रेट्रो नेत्रगुहा शिरापरक साइनस में केशिका डालने के द्वारा, intraperitoneal या intrapericardial गुहिका में29,30, ३१। यहाँ हम वयस्क zebrafish में दिल पुनर्जनन और प्रीकंडीशनिंग का अध्ययन करने के लिए एक उपयुक्त विधि के रूप में, समाधान की एक छोटी राशि के अंतर्वक्षीय इंजेक्शन की एक प्रक्रिया का वर्णन ।

Protocol

जानवरों की देखभाल और सभी पशु प्रक्रियाओं को निम्नलिखित प्रोटोकॉल में वर्णित, फ्रीबोर्ग, स्विट्जरलैंड के छानियल पशु चिकित्सा कार्यालय द्वारा अनुमोदित किया गया था ।

1. उपकरण और इंजेक्शन के लिए समाधान

  1. खींचो microinjection-अनुकूलित बोरोसिलिकेट ग्लास केशिकाओं चित्रा 1aके अनुसार एक सुई खींचने का उपयोग । दुकान एक 9 सेमी पेट्री डिश में मॉडलिंग क्ले या चिपकने वाला टेप की पटरियों के साथ केशिकाओं खींच लिया ।
  2. आम कैंची का प्रयोग, स्पंज का एक टुकड़ा (7 सेमी x 3 सेमी x 1 सेमी) में कटौती और इसके बीच में एक मछली की तरह सिल्हूट उत्कीर्ण ।
  3. जांच प्रोटीन या अंय यौगिकों के साथ इंजेक्शन समाधान के छोटे aliquots तैयार करते हैं । 1x Hanks संतुलित नमक समाधान (HBSS) 10% phenol लाल के साथ पूरित में पदार्थ को कमजोर द्वारा परख पर dependently उनकी एकाग्रता समायोजित करें ।
    नोट: यहां, परीक्षण प्रोटीन की एकाग्रता १०० एनजी/एमएल था ।
  4. बफ़र्ड ट्राइकेन एनेस्थेटिक्स के स्टॉक समाधान तैयार करने के लिए, ९८० मिलीलीटर आसुत जल में 4 ग्राम ट्राइकेन भंग । पीएच को 7.0 − 7.4 का उपयोग करके 1 मीटर ट्रिक् स-एचसीएल पीएच 9 को समायोजित करें और १,००० मिलीलीटर तक पानी भरें । विलयन को 4 ° ब् पर अंधेरे में भंडारित करिए ।
  5. एनेस्थेटिक्स के काम एकाग्रता को प्राप्त करने के लिए, एक बीकर में ५० मिलीलीटर मछली के पानी में tricaine स्टॉक समाधान के 1 − 2 मिलीलीटर जोड़ें ।
    नोट: ट्राइकेन एनेस्थेटिक्स के काम एकाग्रता का उपयोग करने से पहले हौसले से तैयार किया जाना चाहिए.

2. इंजेक्शन स्टेशन की तैयारी

  1. ऊपर से प्रकाश के साथ stereomसूक्ष्मदर्शी पर मुड़ें और 16x के लिए आवर्धन समायोजित करें ।
  2. स्पंज को मछली के पानी से भिगोएं, इसे माइक्रोस्कोप की अवस्था पर 9 सेमी पेट्री डिश पर रखें और फ़ोकस समायोजित करें ।
  3. Stereomicroscope के तहत, एक माइक्रोकेशिका के अंत में कटौती ~ 7 मिमी के आधार पर एक iridectomy कैंची का उपयोग कर के रूप में चित्र 1aमें दिखाया गया है. आदर्श टिप व्यास ~ 20 μm होगा ।
    नोट: एक तिरछी तरह से केशिका की नोक काटना ऊतक में निवेशन के लिए इष्टतम है ।
  4. माइक्रोइंजेक्टर उपकरण की सुई धारक में माइक्रोकेशिका डालें ।
  5. Microloader युक्तियों का प्रयोग, एक नियंत्रण समाधान लोड (जैसे, 1x HBSS) को इंजेक्शन के दबाव को स्थापित करने के लिए उपयुक्त प्रवाह प्राप्त करने के लिए ०.३ μL/s और ०.५ μL/
  6. इंजेक्शन समाधान के चयनित मात्रा लोड (जैसे, पक्ष्माभ neurotrophic कारक [CNTF] 1x HBSS में पतला) केशिका की नोक में (चित्र 1b). केशिका में हवा का बुलबुला नहीं होना चाहिए ।
    नोट: इंजेक्शन समाधान का उच्चिष् ठ आयतन मछली के आकार पर निर्भर करता है । 2.5 − 3 बउ की एक मानक लंबाई के लिए (थूबाहर से पुच्छ डंठल तक की दूरी), अधिकतम इंजेक्शन आयतन जो अप्रभावी वक्ष सूजन और रक्तस्राव को रोकता है, 5-एल (चित्र 1F) होना निर्धारित किया गया था । बड़ी मात्रा बड़ी मछली को इंजेक्ट किया जा सकता है ।

3. अन्तर्वक्षीय इंजेक्शन के लिए मछली की तैयारी

  1. एक नेट के साथ एक वयस्क zebrafish (danio rerio) पकड़ो और यह संवेदनाहारी समाधान में स्थानांतरण ।
  2. 1 − 2 मिनट के बाद, जब मछली तैरना बंद कर देती है और प्रच्छद की गति कम हो जाती है, तो यह सुनिश्चित करने के लिए मछली को एक प्लास्टिक के चम्मच से स्पर्श करें कि यह किसी भी संपर्क पर प्रतिक्रिया नहीं करता है ।
  3. जल्दी और ध्यान से मछली चंमच के साथ गीला स्पंज की नाली में स्थानांतरित, अधर पक्ष के साथ । मछली के सिर ऑपरेटर के प्रमुख हाथ से दूर बिंदु चाहिए ।

4. Pericardium में microinjection

  1. Stereomसूक्ष्मदर्शी के तहत, ध्यान से मछली की त्वचा के नीचे धड़क रहा है दिल के आंदोलन का पालन करें । धड़कन दिल के ऊपर और अधर उपास्थिय प्लेटों द्वारा परिभाषित त्रिकोण के बीच में इंजेक्शन बिंदु को नेत्रहीन निर्धारित करें (चित्र 1D). केशिका की नोक को 30 − 45 डिग्री के कोण से शरीर अक्ष के सापेक्ष प्रविष्ट करें (चित्र 1E) । धीरे से माइक्रोकेशिका की नोक के साथ त्वचा में घुसना हृदयावरण (चित्रा 1 सी). एक इष्टतम प्रविष्टि बिंदु सिर की तुलना में पेट के करीब है ।
    नोट: केशिका को शरीर और दिल में भी गहराई से न डालें, क्योंकि इससे ऑर्गन को इंजरी होगी । दिल पंचर होने की स्थिति में आम तौर पर सुई खून से भर जाती है । अगर ऐसा होता है तो केशिका को हटा दें और प्रयोग से मछलियों को बाहर निकालें ।
  2. एक बार सुई pericardium के अंदर है, microinjector डिवाइस के पेडल दबाकर पूरा इंजेक्शन.
    नोट: वक्ष गुहा में हवा सुई नहीं करने के लिए सावधान रहें ।
  3. इंजेक्शन के बाद, धीरे छाती से केशिका वापस लेने और तुरंत वसूली के लिए प्रणाली के पानी के साथ एक टैंक में मछली हस्तांतरण ।
  4. संज्ञाहरण से कुल वसूली जब तक मछली की निगरानी ।
  5. वांछित समय बिंदु पर दिल ले लीजिए और इसे और अधिक विश्लेषण के लिए तैयार करते हैं ।
    नोट: इस मामले में मछली 30 के भीतर प्रच्छद की आवाजाही फिर से शुरू नहीं करता है, एक प्लास्टिक के पिपेट के साथ गहरे नाले में पानी फैलाएंगे द्वारा मछली फिर से जीवित ।

Representative Results

अंतर्वक्षीय (आईटी) इंजेक्शन के बाद, बहिर्जात समाधान के प्रभाव का विश्लेषण किया जा सकता है । इस उद्देश्य के लिए, मछली euthanized होना चाहिए और दिल एकत्र, तय और histologically संसाधित, पहले प्रकाशित प्रोटोकॉल३२,३३के अनुसार ।

विधि को मान्य करने के लिए, हम पहले रंग और फ्लोरोसेंट रंगों इंजेक्शन द्वारा दो परीक्षण प्रयोगों प्रदर्शन किया. सबसे पहले, हम मछली और पोस्ट-मार्टम छाती में स्याही की 3 μL इंजेक्शन euthanized । दिल 5 मिनट के बाद एकत्र, फॉस्फेट में धोया-buffered खारा (PBS), 2% formalin में तय, PBS में धोया और खुर्दबीन के नीचे फोटो खिंचवाने थे । दूसरा, हम vivo में 1 μg/एमएल 4 ′, 6-diamidino-2-phenylindole (DAPI) के 3 μL इंजेक्शन, और 2 घंटे के बाद दिल फिक्स्ड । दोनों assays हैं, में पूरे माउंट विश्लेषण वेंट्रिकल सहित पूरे दिल के लेबल से पता चला, atrium और बल्बस वाहीनी (चित्रा 2a, B). इन परिणामों के दिल की सतह पर इंजेक्शन समाधान के कुशल प्रसार प्रकट करते हैं ।

वयस्क मछली में बहिर्जात पदार्थों की डिलीवरी के लिए एक आम प्रोटोकॉल intraperitoneal (आईपी) इंजेक्शन है । यह की उपयुक्तता की तुलना करने के लिए आईपी इंजेक्शन के दिल के अध्ययन के लिए, हम दोनों तरीकों का उपयोग कर DAPI की एक समान राशि इंजेक्ट और 5 मिनट और १२० मिनट के बाद दिल तय (चित्रा3 ए) । दिल sectioned थे और (AF) ५६८ कि लेबल एफ actin हृदय की मांसपेशी में phalloidin Alexa के साथ दाग । कोई DAPI-सकारात्मक कोशिकाओं दोनों समय अंक पर आईपी इंजेक्शन के बाद दिल में मनाया (चित्रा 3b) थे । इसके विपरीत, इसका परिणाम मायोकार्डियम में दपी-लेबल वाले नाभिक की उपस्थिति में हुआ (चित्र 3बी) । इन परिणामों को प्रदर्शित करता है कि यह इंजेक्शन दिल के लिए यौगिक की डिलीवरी में सुधार, के रूप में आईपी इंजेक्शन की तुलना में.

दिल पुनर्जनन अध्ययन के लिए इस पद्धति की उपयुक्तता की जांच करने के लिए, हम निलय8cryoinjured, और यह इंजेक्शन प्रदर्शन किया 3 μl की 1 μg/एमएल dapi और 1 μg/एमएल phalloidin AF649 3 और 7 दिनों के बाद cryoinjured (dapi) (चित्रा 4a) । 1 एच के बाद इंजेक्शन, दिल, एकत्र तय किया गया, sectioned और phalloidin AF568 के साथ दाग को बरकरार myocardium कल्पना । हमने पाया है कि दोनों मायोकार्डियम और घायल ऊतक कई dapi सकारात्मक कोशिकाओं निहित, अक्षुण्ण दिल और फाइकोटिक ऊतक में इस डाई के एक कुशल पैठ का संकेत (चित्रा 4b). इसके अलावा, phalloidin AF649 इंजेक्ट भी peri के cardiomyocytes द्वारा शामिल किया गया था चोट क्षेत्र और घायल इलाके के कुछ भर्ती फाइब्रोब्लास्ट । इस प्रयोग से यह पता चलता है कि औषधियां एपिकार्डियम को पार कर सकती हैं और अंतर्निहित मायोकार्डियम में प्रवेश करती हैं ।

यह रंग का उपयोग कर इंजेक्शन की दक्षता परीक्षण के बाद, हम दिल पर इंजेक्शन प्रोटीन के प्रभाव का विश्लेषण किया । हम एक cytokine, CNTF कहा जाता है, जो thoracotomy24के बाद upregulated है synthetized । हम विभिंन प्रक्रियाओं पर बहिर्जात cntf के प्रभाव की जांच की, अर्थात् cardiomyocyte प्रसार, extracellular मैट्रिक्स बयान, प्रतिरक्षा सेल भर्ती और कार्डियोप्रोटेक्टिव जीन अभिव्यक्ति । हमने पाया है कि इन सभी जैविक पहलुओं यह cntf के इंजेक्शन द्वारा सक्रिय थे, के रूप में नियंत्रण इम्युनोग्लोबुलिन की तुलना में (चित्रा 5)24. इन परिणामों को प्रदर्शित करता है कि अंतर्वक्षीय इंजेक्शन की विधि प्रोटीन की एक किस्म assays हैं कि अलग दिल के ऊतकों पर उनके प्रभाव का अध्ययन करने के लिए लक्षित वितरण के लिए एक उपयुक्त रणनीति प्रदान करता है.

Figure 1
चित्रा 1: वयस्क zebrafish में Intrathorascic (आईटी) इंजेक्शन । () रेशे के साथ खींचे गए माइक्रोइंजेक्शन केशिका (6 ", १.० मिमी व्यास में) की फोटोग्राफ और प्रयुक्त सुई खींचने वाले प्रोग्राम के मूल्य । () फिलामेंट (6 ", १.० मिमी व्यास वाले) के साथ खींचे गए माइक्रोइंजेक्शन केशिका का फोटोग्राफ, 10% फिनॉल रेड युक्त विलयन के २.५ μl से भरा हुआ है । सुई के खींचा टिप अधिकतम 7 मिमी लंबी है । () आईटी इंजेक्शन प्रक्रिया का योजनाबद्ध निरूपण । () आईटी इंजेक्शन प्रक्रिया की तस्वीरें । यह आंकड़ा Bise एट अल24से संशोधित किया गया है । ग और घ के पैनलों में संख्याएं प्रक्रिया के समान चरणों के अनुरूप होती हैं: (1) मछली को एक ह्यूमिडिफाइड स्पंज पर अधर की ओर रखा जाता है । पंचर साइट (लाल त्रिकोण में डॉट) गहरे नाले के पास छाती के केंद्र में स्थित है । (2) परिहृद में सुई की पैठ । लाल बिंदी पंचर साइट इंगित करता है । (3) इंजेक्शन हृदयावरणी गुहा में लाल समाधान के प्रसार को देख कर की निगरानी की है । () आईटी इंजेक्शन की स्कीम । दिल पंचर से बचने के लिए इंजेक्शन केशिका और शरीर अक्ष के बीच कोण 30 डिग्री और ४५ डिग्री के बीच होना चाहिए । () यह संकेत मात्रा के इंजेक्शन के बाद 1 घंटे में मछली छाती की तस्वीरें । सफेद तीर रिडिश ऊतक है, जो आंतरिक रक्तस्राव का संकेत हो सकता है पर इशारा कर रहे हैं । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 2
चित्रा 2: यह इंजेक्शन के समाधान लगभग समान रूप से दिल की सतह पर फैल गया. () २.५ ΜL HBSS या २.५ μl स्याही के साथ पोस्ट-मार्टम आईटी इंजेक्शन के अधीन मछली के पूरे दिलों की स्टीरिओमाइक्रोस्कोप छवियां । स्याही ने वेंट्रिकल (वी), एट्रीअम (ए) और बल्बस आर्डिओसस (Ba) की सतह को दाग दिया । स्केल पट्टी = ३०० μm. () यह एचबीएसएस और 1 μg/ML dapi के 3 μl के साथ इंजेक्शन के अधीन मछली के पूरे दिल के उज्ज्वल क्षेत्र और फ्लोरोसेंट स्टीरिओमाइक्रोस्कोप छवियों । DAPI प्रतिदीप्ति यह इंजेक्शन के बाद जल्द ही दिल के अंगों पर पाया जाता है । स्केल पट्टी = ३०० μm इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें

Figure 3
चित्रा 3: दिल के लिए DAPI के वितरण के लिए दो इंजेक्शन विधियों की तुलना. () प्रायोगिक डिजाइन की योजना । Intraperitoneal (आईपी) और Intraperitoneal (आईटी) इंजेक्शन 1 μg/एमएल DAPI (3 μL) की एक ही राशि के साथ प्रदर्शन किया गया । दिल इंजेक्शन के बाद 5 और १२० मिनट पर एकत्र किए गए । () फ्लोरोसेंट phalloidin (लाल) कि बहुतायत से लेबल मांसपेशी फाइबर के साथ दाग दिल वर्गों की confocal माइक्रोस्कोपी छवियां । Dapi इंजेक्शन उपयुक्त हरे रंग में दिखाया चैनल में कल्पना था । आईपी इंजेक्शन के बाद, DAPI दिल में किसी भी समय बिंदु पर पता नहीं है । आईटी इंजेक्शन के बाद, DAPI सकारात्मक कोशिकाओं दोनों समय अंक के बाद वेंट्रिकल में मौजूद हैं । स्केल पट्टी = ५०० μm इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें

Figure 4
चित्रा 4: दिल उत्थान का अध्ययन करने के लिए IT इंजेक्शन. () प्रायोगिक डिजाइन की योजना । Cryoinjury के बाद 3 और 7 दिनों में, DAPI और phalloidin AF649 का मिश्रण यह इंजेक्शन था (1 μg/एमएल के 3 μL) । दिल 1 घंटे के बाद यह इंजेक्शन, तय, sectioned और phalloidin AF568 (लाल) के साथ दाग एकत्र किए गए । () 3 और 7 dpci पर अनुदैर्ध्य दिल वर्गों की confocal माइक्रोस्कोपी छवियां । Dapi (हरा) और phalloidin AF649 (नीला) घायल क्षेत्र के लेबल कोशिकाओं (सफेद डैश्ड लाइन द्वारा सीमांकित) और बरकरार मायोकार्डियम (लाल धुंधला) इंजेक्शन । सफेद तीर अक्षुण्ण कॉंपैक्ट और trabeculated myocardia और एपिकार्डियम के माध्यम से DAPI (हरी) वितरण पर इशारा कर रहे हैं । स्केल पट्टी = ५०० μm इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें

Figure 5
चित्रा 5: Exogenous यह इंजेक्शन CNTF दिल में कई जैविक प्रक्रियाओं को उत्तेजित करता है । () प्रायोगिक डिजाइन की योजना । सबसे पहले, एक समाधान का २.५ μl जिसमें zebrafish cntf या नियंत्रण इम्युनोग्लोबुलिन (higg) के २५० एनजी ट्रांसजेनिक मछली के हृदयावरण में परमाणु DsRed2 हृदय में व्यक्त किया गया था cardiomyocytes । दिल 7 और 1 दिन के बाद इंजेक्शन (डीपीआई) में एकत्र किए गए और इम्यूनोफ्लोरेसेंस और स्वस्थानी संकरण में क्रमशः द्वारा विश्लेषण किया गया । (ख-घ) नियंत्रण और CNTF-दिल इंजेक्शन के वेंट्रिकुलर वर्गों के confocal माइक्रोस्कोपी छवियों । () कोशिका चक्र मार्कर, मिनीक्रोमोसोम रख-रखाव काम्प्लेक्स कंपोनेंट 5 (MCM5; ग्रीन) के विरुद्ध प्रतिरक्षा अभिरंजन, बहिर्जात सीएनटीएफ के प्रत्युत्तर में हृदयरोग के प्रसार की अधिक संख्या का पता चलता है । स्केल पट्टी = ५०० μm । () कोलेजन-xii के प्रति प्रतिरोधगलन से पता चलता है कि सीएनटीटीएफ इंजेक्शन के बाद मायोकार्डियम में कोलेजन बारहवीं का जमाव बढ़ जाता है । नियंत्रण दिल में, कोलेजन बारहवीं एपिकरडियम३४तक ही सीमित है । स्केल पट्टी = ५०० μm. () प्रतिरक्षा कोशिका मार्कर, एल-प् लामिन के विरुद्ध प्रतिरक्षा अभिरंजन, सीएनटीएफ में प्रतिरक्षा कोशिकाओं की बढ़ी हुई भर्ती का पता लगाता है । स्केल पट्टी = ५०० μm. (E) सिस्टेलीन के खिलाफ एक एंटीसेंस एमआरएनए जांच का उपयोग करते हुए स्वस्थाने संकरण के बाद वेंट्रिकुलर क्रॉस वर्गों के उज्ज्वल क्षेत्र माइक्रोस्कोप छवियों, एक कार्डियोप्रोटेक्टिव फैक्टर, हृदय में इस जीन की ट्रांस्क्रिप्शनल upregulation प्रदर्शित करता है CNTF-इंजेक्शन मछली की । स्केल पट्टी = ५०० μm । यह आंकड़ा Bise एट अल24से संशोधित किया गया है । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Discussion

यहाँ, हम हृदयावरणी गुहा में बहिर्जात यौगिकों और प्रोटीन देने के लिए एक विधि का वर्णन करने के लिए वयस्क zebrafish में दिल पर उनके प्रभाव का अध्ययन करने के लिए । प्रक्रिया अंतर्वक्षीय इंजेक्शन, जो अंग के आसपास के क्षेत्र में समाधान की एक छोटी सी मात्रा की डिलीवरी में परिणाम पर आधारित है । इस तकनीक को विकसित किया गया था और कार्डिएक प्रीकंडीशनिंग और उत्थान का अध्ययन करने के लिए वर्णित है ।

इस प्रक्रिया में महत्वपूर्ण कदम वक्ष गुहा में कांच केशिका के प्रवेश है । इस कदम तीन मापदंडों पर निर्भर करता है: कठोरता और केशिका टिप के sharpness, प्रवेश के कोण, और पंचर साइट । त्वचा के माध्यम से प्रवेश का अनुकूलन करने के लिए, केशिका का खींचा हिस्सा बहुत लंबा नहीं होना चाहिए, के रूप में इस तरह की सुई भी लचीला कर रहे हैं और त्वचा के साथ संपर्क में झुकना. इस से बचने के लिए, कठोरता iridectomy कैंची के साथ टिप आकार को कम करने के द्वारा अनुकूलित किया जा सकता है । हालांकि प्रवेश के कोण 30 डिग्री और ४५ ° के बीच भिंन हो सकते हैं, यह टिप की कठोरता के लिए अनुकूलित किया जा सकता है । वास्तव में, एक पतली टिप एक संकरा कोण के साथ बेहतर त्वचा घुसना होगा ।

आदेश में सुई प्रवेश का अनुकूलन करने के लिए, प्रविष्टि साइट तुरंत धड़कन दिल से ऊपर होना चाहिए । दिल पंचर होने का खतरा आमतौर पर 5% और 8% के बीच लेकर कम है । दिल के पीछे सुई की प्रविष्टि दिल पंचर का खतरा बढ़ जाता है, के रूप में बढ़ाया रक्तस्राव से देखा । ऐसे मामलों में पशुओं को प्रयोग से दूर करना चाहिए ।

आईटी इंजेक्शन के दौरान परेशानी का एक अंय स्रोत केशिका स्तर पर होता है । वास्तव में केशिका टूट सकता है जब पार्श्व बलों पर exerted हैं । इससे बचने के लिए सुई को सीधे रास्ते में इंजेक्शन की धुरी के साथ-साथ चलना चाहिए । कभी-कभार, केशिका को ऊतक के अवशेषों द्वारा अवरुद्ध किया जा सकता है जो तरल को बहने से रोकते हैं । सुई धीरे से टिप whilst इंजेक्शन को वापस लेने के अनब्लॉक किया जा सकता है । इस प्रवाह में सुधार नहीं करता है, तो हम पूरी तरह से छाती से सुई वापस लेने और सुई की जगह की सलाह देते हैं ।

पेरिकरडियम में बहुत गहराई से डाली गई सुई के कारण घाव हो सकते हैं । हृदयावरण कोश में घावों से बचने के लिए सुई को वक्ष में बहुत अधिक (1 − 2 मिमी) नहीं डाला जाना चाहिए । इंजेक्शन की मात्रा 8 μL से बड़ी थी, जब कुछ लीक देखा गया ।

Zebrafish में, हृदयावरणी द्रव की सटीक संरचना अज्ञात है । हालांकि, हृदयावरणी गुहा की मात्रा ~ 10 μl31का अनुमान है । यह देखते हुए कि वयस्क zebrafish वेंट्रिकल की मात्रा लगभग है 1 − 2 मिमी3, हम मानते है कि हृदयावरणी गुहा तदनुसार एक छोटे मात्रा है, जो इंजेक्शन से पहले विचार किया जाना है । हमारे प्रारंभिक अध्ययनों से, हमने निर्धारित किया है कि इंजेक्शन की मात्रा की इष्टतम रेंज के बीच है ०.५ और मछली के लिए 3 μL मापने के लिए 2.5 − 2.8 सेमी (थून से पुच्छल peduncle की दूरी) । इस मात्रा मछली के आकार के आधार पर अनुकूलित किया जा सकता है । 5 μL तक के इंजेक्शन इस आकार की मछली में किसी भी घाव पैदा नहीं किया । हालांकि, 8 μL से मात्रा उभड़ा हुआ और आंतरिक रक्तस्राव के रूप में चित्र 1Fमें दिखाया गया करने के लिए पर्याप्त थे । इस डेटा के आधार पर, हम अनुमान लगाते है कि 3 μL से बड़ा समाधान की मात्रा अंग पर शारीरिक और शरीरक्रियात्मक तनाव पैदा कर सकती है । इस सीमा के बजाय इंजेक्शन समाधान की मात्रा में वृद्धि के अणुओं की एक उच्च एकाग्रता का चयन करने की जरूरत है infers ।

एक अंय महत्वपूर्ण कारक इंजेक्शन समाधान के परासरणी गुण है, जो शारीरिक सीमा में होना चाहिए । दरअसल, परासरणी तनाव के जोखिम से बचने के लिए, हम इंजेक्शन माध्यम के रूप में HBSS सलाह देते हैं ।

Zebrafish में, आम तरीकों दवाओं देने के लिए इस्तेमाल किया जल उपचार और intraperitoneal इंजेक्शन के माध्यम से कर रहे हैं30,३५. हालांकि इन तकनीकों के दोनों कई अनुप्रयोगों के लिए उपयुक्त हैं, यह इंजेक्शन प्रयोगात्मक और आर्थिक लाभ प्रदान करते हैं, अवांछित प्रणालीगत दुष्प्रभाव के जोखिम को कम करने और महंगा अणुओं के उपयोग को कम करने, क्रमशः । इस विधि tamoxifen की डिलीवरी के लिए उपयुक्त हो सकता है कोशिका वंश विश्लेषण अनुरेखण के लिए इस्तेमाल किया Cre-ERT2 ट्रांसजेनिक प्रणाली को सक्रिय करने के लिए, और गाइड पुनर्जनन अनुसंधान में कार्यात्मक अध्ययन के लिए RNAs संशोधित.

Zebrafish में आईटी-इंजेक्शन विधि पहले31,३६वर्णित किया गया है । उन रिपोर्टों में, अंतर्वक्षीय इंजेक्शन इंसुलिन सुई के साथ प्रदर्शन किया गया, पूर्वकाल पक्ष से पंचर. इसके विपरीत, हमारे प्रोटोकॉल खींचा ग्लास केशिका पीछे की दिशा से डाला के साथ एक वैकल्पिक रणनीति प्रस्तुत करता है । विशेष रूप से, हमारे दृष्टिकोण खाते में मछली हृदयावरण के एनाटॉमी दिल पंचर के एक कम जोखिम के साथ इंजेक्शन का अनुकूलन लेता है । इसके अलावा, प्रक्रिया के दौरान, मछली धातु forceps द्वारा आयोजित नहीं है, लेकिन एक नम और नरम स्पंज, जो एक अधिक उपयुक्त तरीका है मछली के किसी भी बाहरी चोट से बचने के द्वारा । इस प्रकार, प्रस्तुत की विधि बेहतर कार्डिएक homeostasis के अध्ययन के लिए अनुकूल हो सकता है, वयस्क zebrafish में प्रीकंडीशनिंग और उत्थान ।

स्तनधारी मॉडल जीवों में आईटी इंजेक्शन पहले ही स्थापित हो चुके हैं । दरअसल, इस विधि भी सूअरों और मनुष्यों में नैदानिक अध्ययन के साथ प्रयोगों में लागू किया गया है३७,३८. चूहों में, transthoracic intramyocardial इंजेक्शन ultrasounds द्वारा निर्देशित उनके दिल३९को चुनौती देने के लिए इस्तेमाल किया गया है । इस लेख के भीतर हम zebrafish के लिए IT इंजेक्शन के उपयोग को कम करने के लिए एक विस्तृत प्रोटोकॉल का प्रस्ताव । यह विशेष रूप से क्षेत्र के लिए मूल्यवान होगा, क्रम में हृदय homeostasis में आनुवंशिक दृष्टिकोण पूरक, प्रीकंडीशनिंग और पुनर्जनन अनुसंधान ।

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम उत्कृष्ट तकनीकी सहायता के लिए और मछली की देखभाल के लिए V. Zimmermann धंयवाद, डी König (फ्रीबोर्ग विश्वविद्यालय) पांडुलिपि के महत्वपूर्ण पढ़ने के लिए, डी Kressler (फ्रीबोर्ग के विश्वविद्यालय) zCNTF प्रोटीन संश्लेषण, एफ Ruggiero (Institut de Génomique के साथ मदद के लिए) Fonctionnelle डी ल्यों) ColXII एंटीबॉडी प्रदान करने के लिए, और पी मार्टिन (ब्रिस्टल विश्वविद्यालय) एल के लिए-प्लास्टर एंटीबॉडी. हम इमेजिंग कोर सुविधा और fribourg विश्वविद्यालय में प्रोटियोमिक् मंच धंयवाद । इस काम के स्विस राष्ट्रीय विज्ञान फाउंडेशन, अनुदान संख्या 310030_179213, और Schweizerische Herzstiftung (स्विस हार्ट फाउंडेशन) द्वारा समर्थित था ।

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics