Injection intrathoracique pour l’étude du coeur de zebrafish adulte

Biology
 

Summary

Cette méthode repose sur l’injection de 0,5 − 3 μL de solution dans le thorax du zébrafish adulte. La procédure fournit efficacement des protéines et des composés chimiques à la proximité du cœur de zébrafish sans endommager l’organe. L’approche est appropriée pour tester les effets des facteurs exogènes sur divers tissus du cœur.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le cœur de poisson zèbre adulte fournit un modèle puissant dans la recherche de régénération cardiaque. Bien que la force de ce système soit basée sur des approches transgéniques, une livraison rapide de facteurs exogènes fournit une technique complémentaire dans les études fonctionnelles. Ici, nous présentons une méthode qui repose sur l’administration de quelques microlitres de solution dans la cavité péricardique sans causer de dommages myocardiques. Les injections intrathoraciques (TI) peuvent délivrer efficacement des protéines et des composés chimiques directement sur la surface du cœur. Les substances injectées diffusent à travers l’épicardium dans les tissus cardiaques sous-jacents. Par rapport aux injections intrapéritonéales (IP), le principal avantage des injections intrathoraciques est l’administration focale des facteurs testés sur l’organe cible. La livraison de molécules directement dans le péricarde est une stratégie appropriée pour les études de préconditionnement cardiaque et de régénération chez le zébrafish adulte.

Introduction

Parmi les vertébrés, le zébrafish possède une capacité remarquable à régénérer son cœur1,2. Cette aptitude a été rapportée dans plusieurs modèles de blessure, à savoir la résection ventriculaire de l’apex, la lésion cryogénique (ci) et l’ablation des cardiomyocytes génétiques3,4,5,6,7. Après des lésions invasives, la paroi endommagée du ventricule se guérit de façon transitoire par le tissu fibrotique, qui est progressivement remplacé par un nouveau myocarde8,9,10,11. La réaction de guérison des plaies précoces implique l’activation de l’épicardium et le recrutement des cellules immunitaires12,13,14,15. En concomitance, les cardiomyocytes à proximité du myocarde blessé deviennent activés, dédifférencient, multiplient et remplacent progressivement la zone blessée dans les 30 − 90 jours16,17,18, 19. des progrès substantiels ont été accomplis dans le déchiffrage des mécanismes moléculaires et cellulaires de la régénération cardiaque grâce à la disponibilité d’outils génétiques, tels que l’analyse du traçage des lignées cellulaires, la surexpression des gènes inductibles, lignées de reporter de tissus fluorescents, et mutagenèse de gène crispr/Cas920,21.

Nous avons récemment établi un modèle de préconditionnement cardiaque chez l’adulte poisson zèbre par thorotomie22,23. Le préconditionnement augmente l’expression des gènes cardioprotecteurs et élève la rentrée dans le cycle cellulaire dans les cœurs intacts et régénérantes. Ces processus sont associés au recrutement de cellules immunitaires et de remodelage matriciel22,24. Les mécanismes de préconditionnement sont mal compris, et l’établissement de nouvelles techniques est nécessaire pour favoriser ce domaine de recherche. En particulier, l’administration optimisée de protéines de signalisation sécrétées ou d’autres composés chimiques est essentielle pour approfondir ce sujet.

Étant des animaux aquatiques, le zébrafish peut naturellement absorber diverses substances dissoutes dans l’eau par leurs branles et leur peau. Ceci offre une possibilité pour la délivrance non invasive de médicaments par immersion de poissons dans des solutions avec divers produits chimiques, tels que les inhibiteurs pharmacologiques, les hormones stéroïdiennes, le tamoxifène, le BrdU et les antibiotiques. En effet, de nombreuses études de divers laboratoires, y compris les nôtres25,26,27, ont profité de cette méthode, qui est particulièrement précieuse dans le domaine de la biologie régénérative6, 28. cette approche n’est cependant pas appropriée pour la délivrance de peptides, d’ADN, d’ARN, de les morpholinos ou de molécules ayant une perméabilité tissulaire limitée. Dans ces cas, une livraison plus efficace est obtenue par microinjection dans le corps, par exemple, en insérant le capillaire dans le sinus veineux rétro-orbital, dans la cavité intrapéritonéale ou intrapéricardiques29,30, au 31. Ici, nous décrivons une procédure d’injection intrathoracique d’une petite quantité de solution, comme une méthode appropriée pour étudier la régénération cardiaque et le préconditionnement chez les adultes de zébrafish.

Protocol

Les soins aux animaux et toutes les procédures animales décrites dans le protocole suivant ont été approuvés par l’Office vétérinaire cantonal de Fribourg (Suisse).

1. outils et solutions pour les injections

  1. Tirez les capillaires en verre borosilicate adaptés à la microinjection à l’aide d’un extracteur d’aiguilles selon la figure 1a. Conserver les capillaires tirés dans une boîte de Petri de 9 cm avec des rails d’argile à modeler ou de ruban adhésif.
  2. En utilisant des ciseaux communs, coupez un morceau d’éponge (7 cm x 3 cm x 1 cm) et Sculptez une silhouette semblable à celle du poisson au milieu.
  3. Préparez de petites aliquotes de solution injectable avec les protéines testées ou d’autres composés. Ajustez leur concentration de façon dépendante sur le dosage en diluant la substance dans une solution de sel équilibrée de Hanks (HBSS) complétée par 10% de phénol rouge.
    Remarque: Ici, la concentration de la protéine testée était de 100 ng/mL.
  4. Pour préparer une solution de stock d’anesthésiques tricaïques tamponnés, dissoudre 4 g de tricaïne dans 980 mL d’eau distillée. Ajuster le pH à 7,0 − 7,4 à l’aide de 1 M de Tris-HCl pH 9 et remplir d’eau à 1 000 mL. Conserver la solution dans l’obscurité à 4 ° c.
  5. Pour obtenir la concentration de travail des anesthésiques, ajouter 1 − 2 mL de solution de stock de tricaïne dans 50 mL d’eau de poisson dans un bécher.
    Remarque: La concentration de travail des anesthésiques tricaïque doit être préparée fraîchement avant utilisation.

2. préparation de la station d’injection

  1. Allumez le stéréomicroscope avec la lumière du haut et ajustez le grossissement à 16x.
  2. Imbibez l’éponge d’eau de poisson, placez-la sur une boîte de Petri de 9 cm au microscope et ajustez la mise au point.
  3. Sous le stéréomicroscope, couper l’extrémité d’un microcapillaire à ~ 7 mm de la base à l’aide d’une iridectomie ciseaux comme illustré à la figure 1a. Le diamètre de pointe idéal serait ~ 20 μM.
    Remarque: Couper la pointe du capillaire d’une manière oblique est optimal pour les insertions dans le tissu.
  4. Insérez le microcapillaire dans le porte-aiguille de l’appareil de micro-injecteur.
  5. En utilisant des embouts de microchargeur, chargez une solution de contrôle (par exemple, 1x HBSS) pour mettre en place la pression d’injection, afin d’obtenir le débit approprié variant entre 0,3 μL/s et 0,5 μL/s. Videz l’aiguille.
  6. Chargez le volume sélectionné de la solution d’injection (p. ex., facteur neurotrophique ciliaire [CNTF] dilué dans 1x HBSS) dans la pointe du capillaire (figure 1b). Il ne devrait pas y avoir de bulle d’air dans le capillaire.
    Remarque: Le volume maximal de la solution d’injection dépend de la taille du poisson. Pour une longueur standard de 2,5 − 3 cm (distance entre le museau et le pédoncule caudale), le volume maximal d’injection qui prévient le gonflement et le saignement thoraciques EXESSIFS a été déterminé à 5 μL (figure 1F). Des volumes plus importants pourraient être injectés à des poissons plus gros.

3. préparation du poisson pour l’injection intrathoracique

  1. Attraper un poisson zèbre adulte (Danio rerio) avec un filet et le transférer dans la solution anesthésique.
  2. Après 1 − 2 min, lorsque le poisson cesse de nager et que le mouvement de l’opercule est réduit, touchez le poisson avec une cuillère en plastique pour vous assurer qu’il ne réagit pas à tout contact.
  3. Transférez rapidement et soigneusement le poisson avec la cuillère dans la rainure de l’éponge mouillée, avec le côté ventrale vers le haut. La tête du poisson doit pointer loin de la main dominante de l’opérateur.

4. microinjection dans le péricarde

  1. Sous le stéréomicroscope, observez attentivement le mouvement du cœur battant sous la peau du poisson. Déterminer visuellement le point d’injection au-dessus du cœur battant et au milieu du triangle défini par les plaques cartilagineuses ventrales (figure 1d). Insérer la pointe du capillaire à un angle de 30 − 45 ° par rapport à l’axe du corps (figure 1e). Pénétrer doucement la peau avec la pointe du microcapillaire dans le péricarde (figure 1c). Un point d’entrée optimal est plus proche de l’abdomen que de la tête.
    Remarque: Ne pas insérer le capillaire trop profondément dans le corps et le cœur, car cela causera des blessures à l’organe. En cas de perforation cardiaque, l’aiguille se remplit généralement de sang. Si cela se produit, enlevez le capillaire et excluez le poisson de l’expérience.
  2. Une fois que l’aiguille est à l’intérieur du péricarde, l’injection complète en appuyant sur la pédale du dispositif de micro-injecteur.
    Remarque: Veillez à ne pas injecter d’air dans la cavité thoracique.
  3. Après l’injection, retirer délicatement le capillaire du thorax et transférer immédiatement le poisson dans un réservoir avec de l’eau du système pour la récupération.
  4. Surveillez le poisson jusqu’à la récupération totale de l’anesthésie.
  5. Recueillir le cœur au point de temps désiré et le préparer pour une analyse plus approfondie.
    Remarque: Dans le cas où le poisson ne reprend pas le mouvement de l’opercule dans les 30 s, Réanimez le poisson en serrant l’eau dans les branches avec une pipette en plastique.

Representative Results

Après des injections intrathoraciques (TI), les effets de la solution exogène peuvent être analysés. À cette fin, les poissons devraient être euthanasiés et les coeurs recueillis, fixés et traités histologiquement, selon les protocoles publiés antérieurement32,33.

Pour valider la méthode, nous avons d’abord effectué deux expériences de test en injectant de la couleur et des colorants fluorescents. Premièrement, nous avons euthanasié du poisson et post-mortem injecté 3 μL d’encre dans le thorax. Les coeurs ont été recueillis après 5 min, lavés dans une solution saline tamponnée au phosphate (PBS), fixées en formol à 2%, lavées en PBS et photographiées sous le microscope. Deuxièmement, nous avons injecté 3 μL de 1 μg/mL de 4 ′, 6-diamidino-2-phénylindole (DAPI) in vivo, et fixé le cœur après 2 h. Dans les deux essais, l’analyse de la monture entière a révélé l’étiquetage de tout le cœur, y compris le ventricule, l’atrium et le Bulbus artériel (figure 2a, B). Ces résultats révèlent une propagation efficace de la solution injectée sur la surface du cœur.

Un protocole commun pour la délivrance de substances exogènes dans le poisson adulte est l’injection intrapéritonéale (IP). Pour comparer la pertinence de l’IT par rapport aux injections IP pour les études cardiaques, nous avons injecté une quantité similaire de DAPI en utilisant les deux méthodes et fixé les coeurs après 5 min et 120 min (figure 3A). Les coeurs ont été sectionnés et colorés avec phalloïdine Alexa Fluor (AF) 568 que les étiquettes F-actine dans le muscle cardiaque. Aucune cellule positive de DAPI n’a été observée dans les coeurs après l’injection IP aux deux points de temps (figure 3b). En revanche, l’injection de TI a entraîné la présence de noyaux marqués DAPI dans le myocarde (figure 3b). Ces résultats démontrent que l’injection de TI a amélioré la distribution du composé au cœur, par rapport à l’injection IP.

Pour tester la pertinence de cette méthode pour les études de régénération cardiaque, nous avons cryoblessé les ventricules8et effectué des injections de 3 μl de 1 μg/ml de DAPI et 1 μg/ml de phalloïdine AF649 à 3 et 7 jours après la cryolésion (dpci) (figure 4a). À 1 h après l’injection, les coeurs ont été recueillis, fixés, sectionnés et colorés avec de la phalloidine AF568 pour visualiser le myocarde intact. Nous avons constaté que le myocarde et le tissu blessé contenaient de nombreuses cellules positives de DAPI, ce qui indique une pénétration efficace de ce colorant dans le cœur intact et le tissu fibrotique (figure 4b). En outre, la phalloïdine injectée AF649 a également été incorporée par les cardiomyocytes de la zone péri-lésion et quelques fibroblastes recrutés dans la zone blessée. Cette expérience révèle que les médicaments peuvent traverser l’épicardium et pénétrer dans le myocarde sous-jacent.

Après avoir testé l’efficacité des injections informatiques à l’aide de colorants, nous avons analysé les effets des protéines injectées sur le cœur. Nous avons synthétisé une cytokine, appelée CNTF, qui est uprégulée après la thorotomie24. Nous avons étudié les effets du CNTF exogène sur divers procédés, à savoir la prolifération des cardiomyocytes, le dépôt matriciel extracellulaire, le recrutement de cellules immunitaires et l’expression des gènes cardioprotecteurs. Nous avons constaté que tous ces aspects biologiques ont été activés par l’injection de CNTF par l’IT, comparativement aux immunoglobulines de contrôle (figure 5)24. Ces résultats démontrent que la méthode d’injection intrathoracique fournit une stratégie appropriée pour l’administration ciblée de protéines pour étudier leurs effets sur des tissus cardiaques distincts dans une variété d’essais.

Figure 1
Figure 1: injection Intrathorascique (IT) chez le zébrafish adulte. (A) photographie d’un capillaire à microinjection tirée avec filament (6 ", 1,0 mm de diamètre) et valeurs du programme d’extracteur d’aiguilles utilisé. (B) photographie d’un capillaire à microinjection tirée avec un filament (6 ", 1,0 mm de diamètre) rempli de 2,5 μl de solution contenant 10% de phénol rouge. La pointe tirée de l’aiguille est d’une longueur maximale de 7 mm. C) Représentation schématique de la procédure d’injection de TI. (D) photographies de la procédure d’injection de TI. Ce chiffre a été modifié de bise et coll.24. Les nombres dans les panneaux C et D correspondent aux mêmes étapes de la procédure: (1) le poisson est placé côté ventrale vers le haut sur une éponge humidifiée. Le site de ponction (point rouge dans le triangle) est situé au centre de la poitrine près des branlades. (2) pénétration de l’aiguille dans le péricarde. Le point rouge indique le site de ponction. (3) l’injection est surveillée en observant la propagation de la solution rouge dans la cavité périardiale. (E) schéma de l’injection. L’angle entre le capillaire d’injection et l’axe du corps doit être compris entre 30 ° et 45 ° pour éviter la perforation du cœur. F) photographies de thorax de poissons à 1 heure après l’injection de volumes indiqués. Les flèches blanches pointent vers le tissu replat, ce qui pourrait indiquer une hémorragie interne. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2: les solutions injectées par l’informatique se propagent presque uniformément sur la surface du cœur. (A) images stéréomicroscope de coeurs entiers de poissons soumis à une injection de TI post-mortem avec 2,5 ΜL de HBSS ou 2,5 μl d’encre. L’encre A teinté la surface du ventricule (V), de l’Atrium (A) et du Bulbus artériel (BA). Barre d’échelle = 300 μm. (B) images stéréomicroscope à champ lumineux et fluorescents de coeurs entiers de poissons soumis à l’injection de TI avec HBSS et 3 μl de 1 μg/ml de DAPI. La fluorescence DAPI est détectée sur les parties cardiaques peu après l’injection de TI. Barre d’échelle = 300 μm. s’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3: Comparaison de deux méthodes d’injection pour la livraison de DAPI au cœur. A) schéma de la conception expérimentale. Des injections intrapéritonéales (IP) et Intrathorasciques (TI) ont été effectuées avec la même quantité de 1 μg/mL de DAPI (3 μL). Les coeurs ont été recueillis à 5 et 120 min après l’injection. (B) des images de microscopie confocale de sections cardiaques colorées avec de la phalloidine fluorescente (rouge) qui étiquette abondamment les fibres musculaires. Le DAPI injecté a été visualisé dans le canal approprié affiché en vert. Après l’injection IP, DAPI n’est pas détecté dans le cœur à tout moment. Après l’injection d’IT, les cellules positives de DAPI sont présentes dans le ventricule après les deux points de temps. Barre d’échelle = 500 μm. s’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4: injection de TI pour étudier la régénération cardiaque. A) schéma de la conception expérimentale. À 3 et 7 jours après la cryolésion, un mélange de DAPI et de phalloïdine AF649 a été injecté par l’IT (3 μl de 1 μg/ml). Les coeurs ont été recueillis 1 heure après l’injection de TI, fixe, sectionné et teinté avec phalloïdine AF568 (rouge). B) des images de microscopie confocale de sections cardiaques longitudinales à 3 et 7 dpci. Cellules d’étiquetage DAPI (vertes) et phalloïdine AF649 (bleues) injectées de la zone lésée (délimitée par une ligne pointillée blanche) et du myocarde intact (coloration rouge). Les flèches blanches pointent vers la distribution de DAPI (vert) à travers des myocardies compactes et trabeculées intactes et l’épicardium. Barre d’échelle = 500 μm. s’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5: le CNTF injecté par l’IT exogène stimule plusieurs processus biologiques dans le cœur. A) schéma de la conception expérimentale. Premièrement, 2,5 μL d’une solution contenant 250 ng de CNTF de zébrafish ou d’immunoglobulines de contrôle (hIgG) a été injecté dans le péricarde de poissons transgéniques exprimant des DsRed2 nucléaires dans les cardiomyocytes. Les coeurs ont été recueillis à 7 et 1 jours après l’injection (dpi) et analysés par immunofluorescence et hybridation in situ, respectivement. (B-D) Images de microscopie confocale de sections ventriculaires de contrôle et de coeurs injectés par le CNTF. (B) l’immunostation contre un marqueur de cycle cellulaire, composant complexe d’entretien des minichromosomes 5 (MCM5; vert), révèle un nombre plus élevé de cardiomyocytes proliférants en réponse à un CNTF exogène. Barre d’échelle = 500 μm. (C) immunostaining contre le collagène XII montre une augmentation du dépôt de collagène XII dans le myocarde après l’injection de CNTF. Dans le coeur de contrôle, le collagène XII est confiné à l’épicardium34. Barre d’échelle = 500 μm. (D) immunostaining contre un marqueur de cellules immunitaires, L-plastine, détecte un recrutement accru de cellules immunitaires dans le poisson injecté par le CNTF. Barre d’échelle = 500 μm. (E) les images du microscope à champ lumineux des sections transversales ventriculaires après hybridation in situ à l’aide d’une sonde d’ARNm antisens contre la cystatine, un facteur cardioprotecteur, affichent une uprégulation transcriptionnelle de ce gène dans le cœur des poissons injectés par le CNTF. Barre d’échelle = 500 μm. Ce chiffre a été modifié de bise et coll.24. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Discussion

Ici, nous décrivons une méthode pour délivrer des composés exogènes et des protéines dans la cavité péricardique afin d’étudier leurs effets sur le cœur chez le zébrafish adulte. La procédure est basée sur l’injection intrathoracique, qui se traduit par la livraison d’un petit volume de solution dans le voisinage de l’organe. Cette technique a été développée et décrite pour étudier la préconditionnement cardiaque et la régénération.

L’étape cruciale de cette procédure est la pénétration du capillaire en verre dans la cavité thoracique. Cette étape dépend de trois paramètres qui sont: la rigidité et la netteté de la pointe capillaire, l’angle de pénétration et le site de ponction. Pour optimiser la pénétration à travers la peau, la partie tirée du capillaire ne doit pas être trop longue, car ces aiguilles sont trop flexibles et se plient en contact avec la peau. Pour éviter cela, la rigidité peut être adaptée en réduisant la taille de la pointe avec l’iridectomie ciseaux. Bien que l’angle de pénétration puisse varier entre 30 ° et 45 ° c, il peut être adapté à la rigidité de la pointe. En effet, une fine pointe va pénétrer la peau mieux avec un angle plus étroit.

Afin d’optimiser la pénétration de l’aiguille, le site d’insertion doit être immédiatement au-dessus du cœur battant. Le risque de ponction cardiaque est généralement faible variant entre 5% et 8%. L’insertion de l’aiguille postérieure au cœur augmente le risque de ponction cardiaque, comme le montre un saignement accru. Dans de tels cas, les animaux doivent être retirés des expériences.

Une autre source de trouble au cours de l’injection de TI se produit au niveau capillaire. En effet, le capillaire peut se briser lorsque les forces latérales sont exercées sur elle. Pour éviter cela, l’aiguille doit se déplacer le long de l’axe d’injection de manière rectiligne. Occasionnellement, le capillaire peut être bloqué par des résidus tissulaires qui empêchent le liquide de couler. L’aiguille peut être débloquée en retirant doucement l’embout pendant l’injection. Si cela n’améliore pas le débit, nous recommandons de retirer complètement l’aiguille du thorax et de remplacer l’aiguille.

Les lésions peuvent être causées par une aiguille trop profondément insérée dans le péricarde. Afin d’éviter les lésions dans le sac péricarde, l’aiguille ne doit pas être insérée trop (1 − 2 mm) dans le thorax. Certaines fuites ont été observées lorsque le volume d’injection était plus grand que 8 μL.

Dans le zébrafish, la composition exacte du liquide péricarde est inconnue. Cependant, le volume de la cavité périardiale est estimé à ~ 10 μL31. Étant donné que le volume du ventricule poisson zèbre adulte est d’environ 1 − 2 mm3, nous supposons que la cavité péricarde a en conséquence un petit volume, qui doit être considéré avant les injections. À partir de nos études préliminaires, nous avons déterminé que la plage optimale du volume injecté est comprise entre 0,5 et 3 μL pour les poissons mesurant 2,5 − 2,8 cm (distance entre le museau et le pédoncule caudale). Ce volume peut être adapté en fonction de la taille du poisson. L’injection de jusqu’à 5 μL n’a pas induit de lésion chez les poissons de cette taille. Cependant, les volumes de 8 μL étaient suffisants pour provoquer des saignements internes et des gonflants, comme illustré à la figure 1F. Sur la base de ces données, nous estimons qu’une quantité de solution supérieure à 3 μL peut entraîner un stress physique et physiologique sur l’organe. Cette limitation déduit la nécessité de choisir une concentration plus élevée de molécules au lieu d’augmenter la quantité de la solution injectée.

Un autre facteur important est la propriété osmotique de la solution injectée, qui devrait être dans la gamme physiologique. En effet, pour éviter un risque de stress osmotique, nous recommandons HBSS comme milieu d’injection.

Chez le zébrafish, les méthodes courantes utilisées pour délivrer les médicaments sont le traitement de l’eau et l’injection intrapéritonéale30,35. Bien que ces deux techniques conviennent à de nombreuses applications, les injections informatiques fournissent des avantages expérimentaux et économiques, en diminuant les risques d’effets secondaires systémiques non désirés et en réduisant l’utilisation de molécules coûteuses, respectivement. Cette méthode peut être adaptée à la livraison du tamoxifène pour activer le système transgénique cre-ERT2 utilisé pour l’analyse du traçage des lignées cellulaires et guider les ARN modifiés pour les études fonctionnelles dans la recherche sur la régénération.

La méthode d’injection de l’IT dans poisson zèbre a été décrite précédemment31,36. Dans ces rapports, des injections intrathoraciques ont été effectuées avec l’aiguille d’insuline, perforant du côté antérieur. En revanche, notre protocole présente une stratégie alternative avec le capillaire en verre tiré inséré de la direction postérieure. Plus précisément, notre approche tient compte de l’anatomie du péricarde du poisson pour optimiser l’injection avec un risque réduit de ponction cardiaque. En outre, pendant la procédure, le poisson n’est pas maintenu par des pinces métalliques, mais par une éponge humide et molle, qui est une méthode plus appropriée pour éviter toute blessure externe du poisson. Ainsi, la méthode présentée pourrait être mieux adaptée pour les études sur l’homéostasie cardiaque, le préconditionnement et la régénération chez le zébrafish adulte.

Des injections de TI ont déjà été établies chez des organismes modèles de mammifères. En effet, cette méthode a également été appliquée dans des expériences avec des porcs et des études cliniques chez l’homme37,38. Chez la souris, les injections intramyocardiques transthoriques guidées par ultrasons ont été utilisées pour défier leur cœur39. Dans cet article, nous proposons un protocole détaillé pour faciliter l’utilisation de l’injection de TI pour le zébrafish. Cela sera particulièrement utile pour le domaine, afin de compléter les approches génétiques dans l’homéostasie cardiaque, la recherche de préconditionnement et de régénération.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions V. Zimmermann pour son excellente assistance technique et pour la protection des poissons, D. König (Université de Fribourg) pour la lecture critique du manuscrit, D. Kressler (Université de Fribourg) pour l’aide à la synthèse protéique de zCNTF, F. Ruggiero (Institut de génomique Fonctionnelle de Lyon) pour la fourniture de l’anticorps ColXII, et P. Martin (Université de Bristol) pour l’anticorps L-plastine. Nous remercions le centre d’imagerie et la plate-forme protéomique de l’Université de Fribourg. Ce travail a été appuyé par la Fondation nationale suisse de la science, Grant number 310030_179213, et par la Schweizerische Herzstiftung (Fondation Suisse du cœur).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics