Intrathoracic injektion til studiet af voksne Zebrafish hjerte

Biology
 

Summary

Denne metode er afhængig af injektion af 0,5 − 3 μL opløsning i thorax af voksne zebrafisk. Proceduren effektivt leverer proteiner og kemiske forbindelser i nærheden af zebrafiskhjertet uden at beskadige orgel. Fremgangsmåden er velegnet til afprøvning af udefrakommende faktorers virkninger på forskellige væv i hjertet.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den voksne: zebrafisk hjerte giver en kraftfuld model i hjerte regenerering forskning. Selv om styrken af dette system er baseret på transgene tilgange, en hurtig levering af eksogene faktorer giver en supplerende teknik i funktionelle undersøgelser. Her præsenterer vi en metode, der er afhængig af administration af et par mikroliter af opløsningen i perikardiel hulen uden at forårsage Myokardie skader. Intrathoracic (IT) injektioner kan effektivt levere proteiner og kemiske forbindelser direkte på hjerte overfladen. De injicerede stoffer spredes gennem epicardiet til det underliggende kardiale væv. Sammenlignet med intraperitoneale (IP) injektioner er den største fordel ved intrathoraciske injektioner den fokale administration af de testede faktorer på målorganet. Leveringen af molekyler direkte ind i hjertesækken er en passende strategi for studier af hjerte forkonditionering og regenerering hos voksne zebrafisk.

Introduction

Blandt vertebrater besidder: zebrafisk en bemærkelsesværdig evne til at regenerere deres hjerter1,2. Denne evne er blevet rapporteret i flere skade modeller, nemlig ventrikulær Apex resection, kryoskade (CI) og genetisk kardiomyocyte ablation3,4,5,6,7. Efter invasive skader, den beskadigede væg af ventrikel bliver transitidigt helbredt af fibrotisk væv, som gradvist erstattes af en ny myokardiet8,9,10,11. Den tidlige sårheling respons involverer epicardium aktivering og rekruttering af immunceller12,13,14,15. Samtidig bliver kardiomyocytter i nærheden af det skadede myokardiet aktiveret, dedifferentierer, formere sig og erstatter gradvist det sårede område inden for 30 − 90 dage16,17,18, 19. der er opnået betydelige fremskridt med hensyn til at dechifrere de molekylære og cellulære mekanismer i hjerte regenerering takket være tilgængeligheden af genetiske værktøjer, såsom celle-Lineage sporings analyse, inducerbar gen overekspression, fluorescerende vævs reporter og crispr/Cas9 genmutagenese20,21.

Vi har for nylig etableret en model af hjerte forkonditionering i den voksne: zebrafisk af torakotomi22,23. Forkonditionering øger ekspressionen af cardioprotective gener og hæver genindgangen i cellecyklussen i det intakte og regenererende hjerte. Disse processer er forbundet med rekruttering af immunceller og matrix remodeling22,24. Mekanismerne til forkonditionering er dårligt forstået, og det er nødvendigt at indføre nye teknikker for at fremme dette forskningsområde. Især er optimeret administration af udskillede signalering proteiner eller andre kemiske forbindelser er afgørende for yderligere at undersøge dette emne.

At være akvatiske dyr, kan: zebrafisk naturligt absorbere forskellige stoffer opløst i vand gennem deres gyller og hud. Dette giver mulighed for ikke-invasiv medicin levering gennem nedsænkning af fisk i løsninger med forskellige kemikalier, såsom farmakologiske hæmmere, steroid hormoner, Tamoxifen, BrdU og antibiotika. Faktisk har talrige undersøgelser fra forskellige laboratorier, herunder vores25,26,27, benyttet sig af denne metode, som er særlig værdifuld inden for regenerativ biologi6, 28. denne fremgangsmåde er dog ikke egnet til levering af PEPTIDER, DNA, RNA, morpholinoer eller molekyler med begrænset vævs gennemtrængelighed. I disse tilfælde opnås en mere effektiv levering ved mikroindsprøjtning i kroppen, for eksempel ved at indsætte kapillar i den retroorbitale venøs sinus, ind i intraperitoneal eller intraperikardiel hulrum29,30, af 31. Her beskriver vi en procedure for intrathoraciske injektion af en lille mængde opløsning, som en passende metode til at studere hjerte regenerering og forkonditionering i voksne zebrafisk.

Protocol

Dyrepasning og alle dyreforsøg, der er beskrevet i følgende protokol, blev godkendt af det kantonale Veterinærkontor i Fribourg, Schweiz.

1. værktøj og løsninger til injektioner

  1. Tag mikroinjekteret borosilicat glas kapillærer ved hjælp af en nål-aftrækker i henhold til figur 1a. Store trukket kapillærer i en 9 cm Petri skål med skinner af modellering ler eller tape.
  2. Brug almindelige sakse, skær et stykke svamp (7 cm x 3 cm x 1 cm) og skære en fisk-lignende silhuet i midten.
  3. Forbered små aliquoter af injektionsvæske med de testede proteiner eller andre forbindelser. Koncentrationen justeres afhængigt af analysen ved fortynding af stoffet i 1x Hanks afbalanceret saltopløsning (HBSS) suppleret med 10% phenol rødt.
    Bemærk: Her var koncentrationen af det testede protein 100 ng/mL.
  4. For at forberede en stamopløsning af buffer-tricain anæstetika, opløses 4 g tricain i 980 mL destilleret vand. PH justeres til 7,0 − 7.4 med 1 M Tris-HCl pH 9, og der fyldes op med vand til 1.000 mL. Opløsningen opbevares i mørke ved 4 °C.
  5. For at opnå en koncentration af anæstetika i arbejde tilsættes 1 − 2 mL tricain stamopløsning i 50 mL fiskevand i et bægerglas.
    Bemærk: Den arbejdende koncentration af tricain anæstetika skal tilberedes frisk før brug.

2. klargøring af injektions stationen

  1. Tænd for stereomikroskopet med lyset fra toppen, og Juster forstørrelsen til 16x.
  2. Sug svampen med fiskevand, Anbring den på en 9 cm Petri skål på mikroskopet og justér fokus.
  3. Under stereomikroskopet, skæres enden af en mikrokapillar på ~ 7 mm fra basis ved hjælp af en iridectomi saks som vist i figur 1a. Den ideelle spids diameter ville være ~ 20 μm.
    Bemærk: Skæring spidsen af kapillar i en skrå måde er optimal for indsættelser i vævet.
  4. Mikrokapillar skal indsættes i kanyle holderen på mikroinjektor apparatet.
  5. Ved hjælp af Micro loader tips, indlæse en kontrol løsning (f. eks 1x HBSS) at indstille trykket af injektion, for at opnå den passende flow mellem 0,3 μL/s og 0,5 μL/s. Tøm nålen.
  6. Det valgte volumen af injektionsopløsningen (f. eks. den ciliære neurotrofiske faktor [CNTF] fortyndet i 1x HBSS) indlæses i spidsen af kapillar (figur 1b). Der bør ikke være nogen luftboble i kapillar.
    Bemærk: Den maksimale mængde injektionsvæske afhænger af fiskens størrelse. For en standard længde på 2,5 − 3 cm (afstand fra snuden til hale pedonren) bestemmes den maksimale Injektionsvolumen, der forhindrer exessiv thorax hævelse og blødning, at være 5 μL (figur 1f). Større mængder kan injiceres til større fisk.

3. tilberedning af fisk til Intrathoracic injektion

  1. Fang en voksen zebrafisk (Danio rerio) med et net, og overfør det til den anæstetiske opløsning.
  2. Efter 1 − 2 min., når fiskene stopper svømning og bevægelsen af laag er reduceret, røre fiskene med en plastik ske for at sikre, at det ikke reagerer på nogen kontakt.
  3. Hurtigt og forsigtigt overføre fiskene med skeen i rillen af den våde svamp, med ventrale side op. Lederen af fisken bør pege væk fra operatørens dominerende hånd.

4. mikroindsprøjtning i pericardium

  1. Under stereomikroskopet, nøje observere bevægelsen af bankende hjerte under huden af fisken. Visuelt bestemme Indsprøjtnings punktet over bankende hjerte og i midten af trekanten defineret af de ventrale brusk plader (figur 1d). Sæt spidsen af kapillar ved 30 − 45 ° graders vinkel i forhold til krops aksen (figur 1E). Trænger forsigtigt ind i huden med spidsen af mikrokapillar ind i hjertesækken (figur 1c). Et optimalt indgangspunkt er tættere på maven end på hovedet.
    Bemærk: Kapillar må ikke indsættes for dybt i kroppen og hjertet, da dette vil forårsage skade på orglet. I tilfælde af hjerte punktering fyldes nålen normalt med blod. Hvis dette sker, skal du fjerne kapillar og udelukke fiskene fra eksperimentet.
  2. Når nålen er inde i pericardium, komplet injektion ved at trykke på pedalen af mikroinjektor enhed.
    Bemærk: Vær omhyggelig med ikke at injicere luft ind i brysthulen.
  3. Efter injektion, forsigtigt trække kapillar fra brystkassen og straks overføre fiskene til en tank med system vand til nyttiggørelse.
  4. Overvåg fiskene indtil total restitution fra anæstesi.
  5. Saml hjertet på det ønskede tidspunkt og Forbered det til yderligere analyse.
    Bemærk: Hvis fiskene ikke genoptager driften af laag inden for 30 s, skal du genoplive fiskene ved at klemme vand ind i gællerne med en plastik pipette.

Representative Results

Efter intrathoraciske (IT) injektioner, kan virkningerne af eksogene opløsning analyseres. Til dette formål, fiskene skal aflives og hjerter indsamlet, faste og histologisk behandlet, ifølge tidligere offentliggjorte protokoller32,33.

For at validere metoden udførte vi først to test eksperimenter ved at injicere farve og fluorescerende farver. For det første har vi euthaniserede fisk og post mortem injiceret 3 μL blæk ind i brystkassen. Hjerterne blev indsamlet efter 5 min, vasket i fosfat-Buffered saltvand (PBS), fast i 2% formalin, vasket i PBS og fotograferet under mikroskop. For det andet injicerede vi 3 μL 1 μg/mL 4 ′, 6-diamidino-2-phenylindol (DAPI) in vivo og Fiksede hjertet efter 2 timer. I begge assays, hele-Mount analyse afslørede mærkning af hele hjertet, herunder ventrikel, atrium og bulbus arteriosus (figur 2a, B). Disse resultater afslører effektiv spredning af den injicerede opløsning på hjerte overfladen.

En fælles protokol for levering af eksogene stoffer til voksne fisk er intraperitoneal (IP) injektion. For at sammenligne egnetheden af IT versus IP injektioner for hjerteundersøgelser, injicerede vi en lignende mængde DAPI ved hjælp af begge metoder og faste hjerter efter 5 min og 120 min (figur 3a). Hjerterne blev sekeret og farves med phalloidin Alexa fluor (AF) 568, der mærker F-actin i hjertemusklen. Der blev ikke observeret DAPI-positive celler i hjerterne efter IP-injektion på begge tidspunkter (figur 3b). Derimod resulterede IT-injektion i tilstedeværelsen af DAPI-mærkede kerner i myokardiet (figur 3b). Disse resultater viser, at IT-injektion forbedret levering af stoffet til hjertet, sammenlignet med IP injektion.

For at teste egnetheden af denne metode til hjerte regenerering undersøgelser, vi kryoskadede ventrikler8, og udførte it injektioner af 3 μl af 1 μg/ml dapi og 1 μg/ml phalloidin AF649 ved 3 og 7 dage efter kryoskade (dpci) (figur 4a). Ved 1 h efter injektion blev hjerterne samlet, fikseret, sekeret og farves med phalloidin AF568 for at visualisere det intakte myokardiet. Vi konstaterede, at både myokardiet og det skadede væv indeholdt talrige DAPI-positive celler, hvilket indikerer en effektiv penetration af dette farvestof i intakt hjerte og fibrotisk væv (figur 4b). Desuden blev injiceret phalloidin AF649 også indarbejdet ved kardiomyocytter af den peri-skade zone og nogle rekrutterede fibroblaster af det sårede område. Dette eksperiment afslører, at stofferne kan krydse epikardiet og trænge ind i det underliggende myokardiet.

Efter at have testet effektiviteten af IT-injektioner ved hjælp af farvestoffer, vi analyserede virkningerne af injicerede proteiner på hjertet. Vi syntetiserede en Cytokine, kaldet CNTF, som er upreguleret efter torakotomi24. Vi undersøgte virkningerne af den eksogene CNTF på forskellige processer, nemlig kardiomyocyte proliferation, ekstracellulære matrix deposition, immuncelle rekruttering og cardioprotective genekspression. Vi konstaterede, at alle disse biologiske aspekter blev aktiveret ved IT-injektion af CNTF, sammenlignet med kontrol af immunglobuliner (figur 5)24. Disse resultater viser, at metoden til intrathoraciske injektion giver en passende strategi for målrettet levering af proteiner til at studere deres virkninger på særskilt hjerte væv i en række assays.

Figure 1
Figur 1: Intrathorascic (IT) injektion i voksne zebrafisk. A) fotografi af et trukket mikroinjektionskapillar med glødetråd (6 ", 1,0 mm i diameter) og værdier af det anvendte nåle pullerprogram. B) fotografi af et trukket mikroinjektionskapillar med glødetråd (6 ", 1,0 mm i diameter) fyldt op med 2,5 μl opløsning indeholdende 10% phenol rødt. Den trak spidsen af nålen er maksimalt 7 mm lang. C) skematisk gengivelse af it-Injektionsproceduren. D) fotografier af it-Injektionsproceduren. Dette tal er blevet ændret fra Bise et al.24. Tallene i panelerne C og D svarer til de samme trin i proceduren: (1) fiskene anbringes ventrale side op på en furet svamp. Punkterings stedet (rød prik i trekanten) er placeret i midten af brystet nær gællerne. (2) indtrængen af nålen ind i pericardium. Rød prik indikerer punkterings sted. (3) injektionen overvåges ved at observere spredningen af den røde opløsning i perikardiel hulen. (E) ordning af det injektion. Vinklen mellem injektions kapillar og krops aksen skal være mellem 30 ° og 45 ° for at undgå hjerte punktering. F) fotografier af fiske thorax 1 time efter injektion af indikerede volumener. Hvide pile peger på redish-vævet, hvilket kan indikere indre blødning. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: IT-indsprøjtede opløsninger spredes næsten ensartet på hjerte overfladen. (A) stereomicroskop-billeder af hele hjerter af fisk, der er underkastet post mortem-it-injektion med 2,5 ΜL hbss eller 2,5 μl blæk. Blækket farvede overfladen af ventrikel (V), atrium (a) og bulbus arteriosus (BA). Skaleringsbar = 300 μm. (B) lyse felter og fluorescerende stereomikroskop billeder af hele hjerter af fisk, der udsættes for it-injektion med HBSS og 3 μl 1 μg/ml dapi. DAPI-fluorescens påvises på hjerte delene kort efter injektion. Skaleringsbar = 300 μm. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: sammenligning af to injektions metoder til levering af DAPI til hjertet. A) forsøgs ordningens udformning. Intraperitoneal (IP) og Intrathorascic (IT) injektioner blev udført med samme mængde 1 μg/mL DAPI (3 μL). Hjerter blev indsamlet ved 5 og 120 min. efter injektion. (B) konfokale mikroskopi billeder af hjerte sektioner bejdset med fluorescerende phalloidin (rød), der rigeligt etiketter muskelfibre. Injiceret DAPI blev visualiseret i den relevante kanal vist med grønt. Efter IP injektion, DAPI er ikke påvist i hjertet på noget tidspunkt. Efter injektion er DAPI positive celler til stede i ventriklen efter begge tidspunkter. Skaleringsbar = 500 μm. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: IT-injektion til at studere hjerte regenerering. A) forsøgs ordningens udformning. Ved 3 og 7 dage efter kryoskade blev der indsprøjtet en blanding af DAPI og phalloidin AF649 (3 μL 1 μg/mL). Hjerter blev indsamlet 1 time efter IT injektion, fast, sekeret og farves med phalloidin AF568 (rød). (B) konfokale mikroskopi billeder af langsgående hjerte sektioner ved 3 og 7 dpci. Injicerede DAPI (grøn) og phalloidin AF649 (blå) etiket celler i det skadede område (afgrænset af hvid stiplet linje) og det intakte myokardium (rødt farvning). Hvide pile peger på DAPI (grøn) distribution gennem intakt kompakt og trabeculated myokardi og epicardium. Skaleringsbar = 500 μm. Klik her for at se en større version af dette tal.

Figure 5
Figur 5: eksogene it-injiceret CNTF stimulerer flere biologiske processer i hjertet. A) forsøgs ordningens udformning. For det første blev 2,5 μl af en opløsning indeholdende 250 ng af: zebrafisk CNTF eller kontrol immunglobuliner (Higg) injiceret i hjertesækken af transgene fisk, der udtrykte nuklear DsRed2 i kardiomyocytter. Hjerter blev indsamlet på 7 og 1 dage efter injektion (dpi) og analyseret ved immunofluorescens og in situ hybridisering, hhv. (B-D) Konfokale mikroskopi billeder af ventrikulære sektioner af kontrol og CNTF-injicerede hjerter. (B) immunofarvning mod en celle cyklus markør, minichromosome vedligeholdelses kompleks komponent 5 (MCM5; grøn), afslører et højere antal prolifererende kardiomyocytter som respons på eksogene CNTF. Skaleringsbar = 500 μm. (C) immun farvning mod kollagen XII viser øget aflejring af kollagen XII i myokardiet efter injektion af CNTF. I kontrol hjerte, kollagen XII er begrænset til epicardium34. Skaleringsbar = 500 μm. (D) immun farvning mod en immuncelle markør, L-plastin, registrerer en øget rekruttering af immunceller i den injicerede CNTF-fisk. Skaleringsbar = 500 μm. (E) Bright-felt mikroskop billeder af ventrikulære tværsnit efter in situ-hybridisering ved hjælp af en antisense mRNA-sonde mod cystatin, en cardioprotective faktor, viser transkriptional opregulering af dette gen i hjertet af CNTF-injicerede fisk. Skaleringsbar = 500 μm. Dette tal er blevet ændret fra Bise et al.24. Klik her for at se en større version af dette tal.

Discussion

Her beskriver vi en metode til at levere eksogene forbindelser og proteiner ind i perikardiel hulen for at studere deres virkninger på hjertet hos voksne zebrafisk. Proceduren er baseret på intrathoraciske injektion, hvilket resulterer i leveringen af en lille mængde opløsning i nærheden af orgel. Denne teknik blev udviklet og beskrevet for at studere hjerte forkonditionering og regenerering.

Det kritiske trin i denne procedure er indtrængning af glas kapillar i brysthulen. Dette trin afhænger af tre parametre, som er: stivhed og skarphed af kapillar spidsen, vinklen af penetration, og punktering stedet. For at optimere penetration gennem huden, den trak del af kapillar bør ikke være for lang, da sådanne nåle er for fleksible og bøje i kontakt med huden. For at undgå dette kan stivheden tilpasses ved at reducere spids størrelsen med iridectomi-Scissor. Selv om vinklen af penetration kan variere mellem 30 ° og 45 °, kan det tilpasses til stivheden af spidsen. Faktisk vil en tynd spids trænge ind i huden bedre med en smallere vinkel.

For at optimere nålen penetration, bør indsættelsen stedet være umiddelbart over bankende hjerte. Risikoen for hjerte punktering er sædvanligvis lav, nemlig mellem 5% og 8%. Indsættelse af nålen posterior til hjertet øger risikoen for hjerte punktering, som ses af øget blødning. I sådanne tilfælde bør dyrene fjernes fra forsøgene.

En anden kilde til problemer under IT-injektion sker på kapillar niveau. Faktisk kapillar kan bryde, når laterale kræfter er udøvet på det. For at undgå dette skal nålen bevæge sig langs Indsprøjtnings aksen på en lige måde. Lejlighedsvis kan kapillar blokeres af vævs rester, der forhindrer væsken i at flyde. Nålen kan ikke blokeres ved forsigtigt at trække spidsen af, mens du injicerer. Hvis dette ikke forbedrer flowet, anbefaler vi, at nålen trækkes helt ud af brystkassen, og nålen udskiftes.

Læsioner kan forårsages af en for dybt indsat nål i pericardium. For at undgå læsioner i perikardiale sækken må nålen ikke indsættes for meget (1 − 2 mm) i brystkassen. Der blev observeret visse lækager, når injektionsvolumenet var større end 8 μL.

I zebrafish er den nøjagtige sammensætning af perikardievæsken ukendt. Mængden af perikardiel hulen anslås dog til ~ 10 μL31. I betragtning af, at mængden af den voksne zebrafiskventrikel er ca. 1 − 2 mm3, antager vi, at perikardiel hulrummet i overensstemmelse hermed har en lille volumen, som skal overvejes før injektioner. Fra vores indledende undersøgelser, vi fastslået, at den optimale rækkevidde af den injicerede volumen er mellem 0,5 og 3 μL for fisk måler 2,5 − 2,8 cm (afstand fra snuden til hale pedonkel). Dette volumen kan tilpasses afhængigt af størrelsen af fisken. Injektion af op til 5 μL inducerede ingen læsion i fisk af denne størrelse. Mængder fra 8 μL var imidlertid tilstrækkelige til at forårsage svulmende og indre blødninger som vist i figur 1f. Baseret på disse data anslår vi, at en mængde opløsning, der er større end 3 μL, kan forårsage fysisk og fysiologisk stress på orglet. Denne begrænsning udleder behovet for at vælge en højere koncentration af molekyler i stedet for at øge mængden af den injicerede opløsning.

En anden vigtig faktor er den osmotiske egenskab af den injicerede opløsning, som bør være i det fysiologiske område. For at undgå en risiko for osmotisk stress, anbefaler vi HBSS som injektions medium.

I zebrafish, de fælles metoder, der anvendes til at levere narkotika er gennem vandbehandling og intraperitoneal injektion30,35. Selv om begge disse teknikker er egnet til mange applikationer, IT-injektioner giver eksperimentelle og økonomiske fordele, ved at mindske risikoen for uønskede systemiske bivirkninger og reducere brugen af dyre molekyler, hhv. Denne metode kan være egnet til levering af tamoxifen til at aktivere CRE-ERT2 transgene system, der anvendes til celle Lineage sporing analyse, og guide modificerede RNAs for funktionelle undersøgelser i regenerering forskning.

IT-injektion metode i: zebrafisk er tidligere blevet beskrevet31,36. I disse rapporter, intrathoraciske injektioner blev udført med insulin nål, punktering fra den forreste side. I modsætning hertil præsenterer vores protokol en alternativ strategi med den trukket glas kapillar indsat fra den bageste retning. Specifikt, vores tilgang tager hensyn til anatomien af fiskene hjertesækken at optimere injektion med en reduceret risiko for hjerte punktering. Under proceduren holdes fisken desuden ikke af metalliske pincet, men af en fugtig og blød svamp, som er en mere velegnet metode til at undgå ydre skader på fiskene. Således kan den præsenterede metode være bedre egnet til studier af kardiel homøostase, forkonditionering og regenerering i voksne zebrafisk.

Der er allerede etableret IT-injektioner i pattedyrs modelorganismer. Faktisk er denne metode også blevet anvendt i eksperimenter med svin og kliniske undersøgelser hos mennesker37,38. I mus, transthoracic intramyokardielle injektioner guidet af ultralyd er blevet brugt til at udfordre deres hjerte39. I denne artikel foreslår vi en detaljeret protokol til at lette brugen af IT-injektion for zebrafish. Dette vil være særlig værdifuldt for området, for at supplere genetiske tilgange i hjerte homøostase, forkonditionering og regenerering forskning.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi takker V. Zimmermann for fremragende teknisk assistance og for fiskepleje, D. König (universitetet i Fribourg) for kritisk læsning af manuskriptet, D. Kressler (universitetet i Fribourg) for hjælp med zCNTF proteinsyntese, F. Ruggiero (Institut de Génomique Fonctionnelle de Lyon) for at give ColXII antistof, og P. Martin (University of Bristol) for L-plastin antistof. Vi takker billedbehandlings kerneanlægget og proteomics platformen ved universitetet i Fribourg. Dette arbejde blev støttet af Swiss National Science Foundation, Grant nummer 310030_179213, og af Schweizerische Herzstiftung (Swiss Heart Foundation).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics