Intratorakal injeksjon for studier av Adult sebrafisk Heart

Biology
 

Summary

Denne metoden er avhengig av injeksjon av 0,5 − 3 μL av oppløsning i thorax av voksen sebrafisk. Prosedyren leverer effektivt proteiner og kjemiske forbindelser inn i nærheten av sebrafisk hjerte uten å skade orgelet. Tilnærmingen er egnet for testing effekter av eksogene faktorer på ulike vev i hjertet.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den voksne sebrafisk hjertet gir en kraftig modell i CARDIAC gjenfødelse forskning. Selv om styrken i dette systemet er basert på transgene tilnærminger, gir en rask levering av eksogene faktorer en komplementær teknikk i funksjonelle studier. Her presenterer vi en metode som er avhengig av administrasjon av noen mikroliter av løsningen i perikard hulrom uten å forårsake hjerteinfarkt skade. Intratorakal (IT) injeksjoner kan effektivt levere proteiner og kjemiske forbindelser direkte på hjertet overflaten. De injisert stoffene diffus gjennom epicardium inn i underliggende CARDIAC vev. Sammenlignet med intraperitoneal (IP) injeksjoner, den største fordelen med intratorakal injeksjoner er fokal administrasjon av testede faktorer på målet organ. Levering av molekyler direkte inn i pericardium er en egnet strategi for studier av CARDIAC preconditioning og regenerering i voksen sebrafisk.

Introduction

Blant virveldyr har sebrafisk en bemerkelsesverdig evne til å regenerere sitt hjerte1,2. Denne evnen har blitt rapportert i flere skade modeller, nemlig ventrikkel Apex reseksjon, cryoinjury (CI) og genetisk cardiomyocyte ablasjon3,4, 5,6,7. Etter invasive skader, blir den skadede veggen av ventrikkel midlertidig helbredet av antifibrotiske vev, som er gradvis erstattet av en ny myokard8,9,10,11. Tidlig såret healing respons innebærer epicardium aktivering og rekruttering av immunceller12,13,14,15. Samtidig blir cardiomyocytes nær den skadde myokard aktivert, dedifferentiate, sprer og gradvis erstatter det skadede området innen 30 − 90 dager16,17,18, 19. betydelig fremgang i å tyde den molekylære og cellulære mekanismer for CARDIAC regenerering har blitt oppnådd takket være tilgjengeligheten av genetiske verktøy, for eksempel celle-avstamning tracing analyse, induserbart gen overuttrykte, fluorescerende vev reporter linjer, og CRISPR/Cas9 genet mutagenese20,21.

Vi har nylig etablert en modell av CARDIAC preconditioning i voksen sebrafisk ved toraktomi22,23. Preconditioning øker uttrykk for Kardioprotektive gener og hever re-entry inn i cellen syklus i intakt og regenererer hjerter. Disse prosessene er forbundet med rekruttering av immunceller og Matrix remodeling22,24. Mekanismene for preconditioning er dårlig forstått, og etablering av nye teknikker er nødvendig for å fremme dette området av forskning. Spesielt optimalisert administrasjon av utskilles signalering proteiner eller andre kjemiske forbindelser er avgjørende for å ytterligere undersøke dette emnet.

Å være akvatiske dyr, sebrafisk kan naturlig absorbere ulike stoffer oppløst i vann gjennom deres gjellene og hud. Dette gir en mulighet for ikke-invasiv legemiddellevering gjennom nedsenking av fisk i løsninger med ulike kjemikalier, slik som farmakologiske hemmere, steroid hormoner, Tamoxifen, BrdU og antibiotika. Faktisk, mange studier fra ulike laboratorier, inkludert vår25,26,27, har utnyttet denne metoden, som er spesielt verdifullt innen regenererende biologi6, 28. denne tilnærmingen er imidlertid ikke hensiktsmessig for levering av PEPTIDER, DNA, RNA, morpholinos eller molekyler med begrenset vev permeabilitet. I disse tilfellene er en mer effektiv levering oppnås ved microinjection inn i kroppen, for eksempel ved å sette inn kapillær i retro-orbital venøs sinus, i intraperitoneal eller intrapericardial hulrom29,30, 31i. Her beskriver vi en prosedyre for intratorakal injeksjon av en liten mengde løsning, som en egnet metode for å studere hjertet gjenfødelse og preconditioning i voksen sebrafisk.

Protocol

Dyr omsorg og alle dyr prosedyrer beskrevet i følgende protokoll ble godkjent av kantonale veterinær kontoret i Fribourg, Sveits.

1. verktøy og løsninger for injeksjoner

  1. Trekk microinjection-tilpasset Borosilikatglass glass blodkar med en nål avtrekker i henhold til figur 1a. Store trakk blodkar i en 9 cm Petri parabolen med skinner av modellering leire eller tape.
  2. Bruk vanlig saks, klipp et stykke svamp (7 cm x 3 cm x 1 cm) og skjære en fisk-lignende silhuett i midten.
  3. Forbered små alikvoter av injeksjons løsning med de testede proteinene eller andre forbindelser. Juster konsentrasjonen sortert på analysen ved å fortynne stoffet i 1x Hanks balansert saltløsning (HBSS) supplert med 10% fenol rød.
    Merk: Her var konsentrasjonen av det testede proteinet 100 ng/mL.
  4. For å forberede en lagerløsning av bufrede tricaine anestesimidler, oppløse 4 g av tricaine i 980 mL destillert vann. Juster pH til 7.0 − 7.4 ved hjelp av 1 M Tris-HCl pH 9, og fyll opp med vann til 1 000 mL. Oppbevar oppløsningen i mørket ved 4 ° c.
  5. For å oppnå arbeids konsentrasjonen av anestesi, tilsett 1 − 2 mL tricaine lagerløsning i 50 mL fiskevann i et beger.
    Merk: Arbeids konsentrasjonen av tricaine anestesi bør tilberedes fersk før bruk.

2. utarbeidelse av injeksjons stasjonen

  1. Slå på stereomikroskopet med lyset fra toppen og Juster forstørrelsen til 16x.
  2. Sug svamp med fiskevann, Legg den på en 9 cm Petri parabolen på mikroskopet scenen og justere fokus.
  3. Under stereomikroskopet, kutt slutten av en microcapillary på ~ 7 mm fra basis ved hjelp av en iridektomi saks som vist i figur 1a. Den ideelle spissen diameter ville være ~ 20 μm.
    Merk: Skjæring spissen av kapillær på en skrå måte er optimal for innsettinger i vevet.
  4. Sett microcapillary inn i nåle holde ren på microinjector apparatet.
  5. Bruk microloader spisser, og Last en kontroll løsning (f.eks. 1x HBSS) for å sette opp trykket på injeksjonen, for å oppnå den aktuelle Strømningsmengden mellom 0,3 μL/s og 0,5 μL/s. Tøm nålen.
  6. Legg det valgte volumet av injeksjons løsningen (f.eks. ciliary nevrotropisk faktor [CNTF] fortynnet i 1x HBSS) i spissen av kapillær (figur 1B). Det bør ikke være luftboble i kapillær.
    Merk: Den maksimale mengden injeksjon løsning avhenger av fisken størrelse. For en standard lengde på 2,5 − 3 cm (avstand fra snute til caudal peduncle), var det maksimale injeksjonsvolumet som hindrer exessive bryst hevelse og blødning, fast bestemt på å være 5 μL (figur 1F). Større volumer kan injiseres til større fisk.

3. utarbeidelse av Fish for Intratorakal Injection

  1. Catch en voksen sebrafisk (Danio rerio) med et nett og overføre den til bedøvelse løsning.
  2. Etter 1 − 2 min, når fisken slutter å svømme og bevegelsen av Operculum er redusert, berører fisken med en plast skje for å sikre at den ikke reagerer på noen kontakt.
  3. Raskt og forsiktig overføre fisken med skjeen i sporet av den våte svamp, med ventrale side opp. Lederen av fisken bør peke bort fra operatørens dominerende hånd.

4. Microinjection inn i pericardium

  1. Under stereomikroskopet, nøye observere bevegelsen av bankende hjerte under huden av fisken. Visuelt bestemme injeksjonsstedet over bankende hjerte og i midten av trekanten definert av ventrale cartilaginous plater (figur 1d). Sett tuppen av kapillær ved 30 − 45 ° graders vinkel i forhold til kropps aksen (figur 1e). Trenge forsiktig inn i huden med tuppen av microcapillary i pericardium (figur 1C). En optimal inngangspunkt er nærmere magen enn til hodet.
    Merk: Ikke sett inn kapillær for dypt inn i kroppen og hjertet, da dette vil føre til skade på orgelet. I tilfelle av hjerte punktering, vil nålen vanligvis fylles med blod. Hvis dette skjer, fjerne kapillær og utelukke fisken fra eksperimentet.
  2. Når nålen er inne i pericardium, komplett injeksjon ved å trykke på pedalen på microinjector enheten.
    Merk: Pass på at du ikke injiserer inn luft i bryst hulen.
  3. Etter injeksjon, forsiktig trekke kapillær fra thorax og umiddelbart overføre fisken i en tank med system vann for utvinning.
  4. Overvåk fisken til total utvinning fra anestesi.
  5. Samle hjerte på ønsket tidspunkt og forberede den for videre analyse.
    Merk: I tilfelle fisken ikke gjenoppta bevegelsen av Operculum innen 30 s, reanimate fisken ved å klemme vann inn i gjellene med en plast pipette.

Representative Results

Etter intratorakal (IT) injeksjoner, effektene av eksogene løsning kan analyseres. For dette formålet, bør fisken være euthanized og hjertene samlet, fast og histologisk behandlet, ifølge tidligere utgitte protokoller32,33.

For å validere metoden, vi først utførte to test eksperimenter ved å injisere farger og fluorescerende fargestoffer. For det første, vi euthanized fisk og etter obduksjon injisert 3 μL av blekk i thorax. Hjertene ble samlet etter 5 min, vasket i fosfat-bufret saltvann (PBS), fast i 2% formalin, vasket i PBS og fotografert under mikroskopet. For det andre, injisert vi 3 μL av 1 μg/mL 4 ', 6-diamidino-2-phenylindole (DAPI) in vivo, og fikset hjertet etter 2 h. I begge analysene, hele-Mount analyse avdekket merking av hele hjertet inkludert ventrikkel, Atrium og bulbus arteriosus (figur 2a, B). Disse resultatene avslører effektiv spredning av injisert løsning på hjertet overflaten.

En vanlig protokoll for levering av eksogene stoffer i den voksne fisken er intraperitoneal (IP) injeksjon. For å sammenligne egnetheten av IT-kontra IP-injeksjoner for hjerte studier, injisert vi en tilsvarende mengde DAPI ved hjelp av begge metoder og fikset hjertene etter 5 min og 120 min (figur 3a). Hjertene var delt og beiset med phalloidin Alexa fluor (AF) 568 som etiketter F-utgangen i hjertemuskelen. Det ble ikke observert DAPI-positive celler i hjertene etter IP-injeksjon på begge tidspunkter (figur 3b). Til sammenligning resulterte IT-injeksjon i tilstedeværelsen av DAPI-merkede kjerner i myokard (figur 3b). Disse resultatene viser at IT-injeksjon forbedret levering av sammensatte til hjertet, sammenlignet med IP-injeksjon.

For å teste egnetheten til denne metoden for hjerte Fornyelses studier, cryoinjured vi ventriklene8, og utførte IT-injeksjoner med 3 μL av 1 μg/ml DAPI og 1 μg/ml phalloidin AF649 ved 3 og 7 dager etter cryoinjury (dpci) (figur 4a). Ved 1 h post-injeksjon, var hjerter samlet, fast, delt og beiset med phalloidin AF568 å visualisere intakt myokard. Vi fant at både myokard og den skadde vevet inneholdt tallrike DAPI positive celler, som indikerer en effektiv penetrasjon av dette fargestoffet inn i intakt hjerte og antifibrotiske vev (figur 4b). Videre ble injisert phalloidin AF649 også innlemmet ved cardiomyocytes av Peri-skade sone og noen rekruttert fibroblaster av såret området. Dette eksperimentet avslører at stoffene kan krysse epicardium og trenge inn i den underliggende myokard.

Etter å ha testet effektiviteten av IT-injeksjoner ved hjelp av fargestoffer, analyserte vi effekten av injisert proteiner på hjertet. Vi synthetized en cytokin, kalt CNTF, som er upregulated etter toraktomi24. Vi undersøkte virkningene av eksogene CNTF på ulike prosesser, nemlig cardiomyocyte spredning, ekstracellulære matrise deponering, immun celle rekruttering og Kardioprotektive genuttrykk. Vi grunnlegge det alle disse Biological aspektene var aktivert av den injeksjon av CNTF, idet sammenlignet med administrere immunglobuliner (skikkelsen 5)24. Disse resultatene viser at metoden for intratorakal injeksjon gir en passende strategi for målrettet levering av proteiner for å studere deres effekter på forskjellige hjerte vev i en rekke analyser.

Figure 1
Figur 1: Intrathorascic (IT) injeksjon i voksen sebrafisk. (A) fotografi av en trukket microinjection kapillær med filament (6 ", 1,0 mm i diameter) og verdier av nålen avtrekker programmet som brukes. (B) fotografi av en trukket microinjection kapillær med filament (6 ", 1,0 mm i diameter) fylt opp med 2,5 μL oppløsning som inneholder 10% fenol rød. Den trekkes spissen av nålen er maksimalt 7 mm lang. (C) skjematisk fremstilling av prosedyren for IT-injeksjon. (D) fotografier av prosedyren for IT-injeksjon. Dette tallet er blitt modifisert fra bise et al.24. Tall i paneler C og D tilsvarer de samme trinnene i prosedyren: (1) fisken er plassert ventrale side opp på en fuktet svamp. Punktering området (rød prikk i trekanten) ligger i midten av brystet nær gjellene. (2) inntrengning av nålen inn i pericardium. Rød prikk indikerer punktering området. (3) injeksjon overvåkes ved å observere spredningen av den røde løsningen i perikard hulrom. (E) ORDNINGEN med den injeksjon. Vinkelen mellom injeksjon kapillær og kroppen aksen bør være mellom 30 ° og 45 ° for å unngå hjerte punktering. (F) fotografier av fiske thorax på 1 time etter at IT-injeksjon av indikerte volumer. Hvite piler peker på redish vev, som kan indikere indre blødning. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: IT-injisert løsninger sprer seg nesten jevnt på hjerte overflaten. (A) stereomikroskopet bilder av hele hjerte av fisk utsatt for etter obduksjon IT-injeksjon med 2,5 μL HBSS eller 2,5 μL blekk. Ink beiset overflaten av ventrikkel (V), Atrium (A) og bulbus arteriosus (ba). Scale bar = 300 μm. (B) lyse felt-og fluorescerende stereomikroskopet bilder av hele hjerte av fisk som utsettes for IT-INJEKSJON med HBSS og 3 μL av 1 μg/ml DAPI. DAPI fluorescens oppdages på hjerte delene kort tid etter at den er injisert. Scale bar = 300 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: sammenligning av to injeksjons metoder for levering av DAPI til hjertet. (A) ordningen med eksperimentell design. Intraperitoneal (IP) og Intrathorascic (IT) injeksjoner ble utført med samme mengde 1 μg/mL DAPI (3 μL). Hjerter ble samlet ved 5 og 120 min etter injeksjon. (B) konfokalmikroskopi mikroskopi bilder av hjerte seksjoner beiset med fluorescerende phalloidin (rød) som rikelig etiketter muskelfibre. Injisert DAPI ble i den aktuelle kanalen vist i grønt. Etter IP-injeksjon, DAPI ikke oppdages i hjertet når som helst punkt. Etter at det injeksjon, DAPI positive celler er til stede i ventrikkel etter både tid poeng. Scale bar = 500 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: IT-injeksjon for å studere hjertet gjenfødelse. (A) ordningen med eksperimentell design. På 3 og 7 dager etter cryoinjury var en blanding av DAPI og phalloidin AF649 det-injisert (3 μL av 1 μg/mL). Hjerter ble samlet 1 time etter at IT-injeksjon, fast, delt og beiset med phalloidin AF568 (rød). (B) konfokalmikroskopi mikroskopi bilder av langsgående hjerte seksjoner ved 3 og 7 dpci. Injisert DAPI (grønn) og phalloidin AF649 (blå) etiketten celler av den skadde området (avgrenset av hvite stiplede linjen) og intakt myokard (rød farging). Hvite piler peker på DAPI (grønn) distribusjon gjennom intakt kompakt og trabeculated myocardia og epicardium. Scale bar = 500 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: EKSOGENE IT-INJISERT CNTF stimulerer flere biologiske prosesser i hjertet. (A) ordningen med eksperimentell design. For det første ble 2,5 av en løsning som inneholdt 250 ng av sebrafisk CNTF eller kontroll immunglobuliner (hIgG) injisert i pericardium av transgene fisk som uttrykte kjernefysiske DsRed2 i cardiomyocytes. Hjerter ble samlet på 7 og 1 dager etter injeksjon (dpi) og analysert av immunofluorescence og in situ hybridisering, henholdsvis. (B-D) Konfokalmikroskopi mikroskopi bilder av ventrikkel deler av kontroll og CNTF-injisert hjerter. (B) Immunostaining mot en celle syklus markør, minichromosome vedlikeholds kompleks komponent 5 (MCM5; grønn), avslører et høyere antall voksende cardiomyocytes som svar på eksogene CNTF. Scale bar = 500 μm. (C) Immunostaining mot kollagen XII viser økt deponering av kollagen XII i MYOKARD etter CNTF injeksjon. I kontroll hjerte er kollagen XII begrenset til epicardium34. Scale bar = 500 μm. (D) Immunostaining mot en immun celle markør, L-plastin, oppdager en forbedret rekruttering av immunceller i CNTF injisert fisk. Scale bar = 500 μm. (E) lys-felt mikroskop bilder av ventrikkel tverrsnitt etter in situ hybridisering bruke en antisens mRNA sonde mot cystatin, en Kardioprotektive faktor, viser transcriptional oppregulering av dette genet i hjertet av CNTF-injisert fisk. Scale bar = 500 μm. Dette tallet er blitt modifisert fra bise et al.24. Vennligst klikk her for å se en større versjon av dette tallet.

Discussion

Her beskriver vi en metode for å levere eksogene forbindelser og proteiner inn i perikard hulrom for å studere deres virkninger på hjertet i voksen sebrafisk. Prosedyren er basert på intratorakal injeksjon, noe som resulterer i levering av et lite volum av løsningen i nærheten av orgelet. Denne teknikken ble utviklet og beskrevet for å studere CARDIAC preconditioning og regenerering.

Det kritiske trinnet i denne prosedyren er inntrengning av glass kapillær inn i bryst hulen. Dette trinnet avhenger av tre parametre som er: stivhet og skarphet av kapillær spissen, vinkelen på penetrasjon, og punktering området. For å optimalisere inntrengning gjennom huden, bør den trakk delen av kapillær ikke å være for lang, som slike nåler er for fleksible og bøy i kontakt med huden. For å unngå dette, kan stivheten tilpasses ved å redusere spissen størrelse med iridektomi saks. Selv om vinkelen på penetrasjon kan variere mellom 30 ° og 45 °, kan det tilpasses til stivhet av spissen. Faktisk vil en tynn tupp trenge gjennom huden bedre med en smalere vinkel.

For å optimalisere nålen penetrasjon, bør innsetting området være rett over bankende hjerte. Risikoen for hjerte punktering er vanligvis lav varierer mellom 5% og 8%. Innsetting av nålen bakre til hjertet øker risikoen for hjerte punktering, sett av forbedret blødning. I slike tilfeller bør dyrene fjernes fra eksperimentene.

En annen kilde til problemer under IT-injeksjon skjer på kapillær nivå. Faktisk kapillær kan bryte når laterale krefter utøves på den. For å unngå dette, må nålen bevege seg langs aksen av injeksjon på en rett måte. Noen ganger kan kapillær blokkeres av vevs rester som hindrer væsken fra å strømme. Nålen kan oppheves ved forsiktig uttak av spissen mens sprøytebruk. Hvis dette ikke forbedrer flyten, anbefaler vi å trekke nålen fra thorax og erstatte nålen.

Lesjoner kan være forårsaket av en for dypt innsatt nål i pericardium. For å unngå lesjoner i perikard SAC, må nålen ikke settes inn for mye (1 − 2 mm) i thorax. Noen lekkasjer ble observert da injeksjonsvolumet var større enn 8 μL.

I sebrafisk er den eksakte sammensetningen av den perikard væsken ukjent. Imidlertid er volumet av perikard hulrom anslått til ~ 10 μL31. Gitt at volumet av den voksne sebrafisk ventrikkel er ca 1 − 2 mm3, antar vi at perikard hulrom Følgelig har et lite volum, som må vurderes før injeksjoner. Fra våre foreløpige studier har vi fastslått at det optimale spekteret av injisert volum er mellom 0,5 og 3 μL for fisk som måler 2,5 − 2,8 cm (avstand fra snute til caudal peduncle). Dette volumet kan tilpasses avhengig av størrelsen på fisken. Injeksjon på inntil 5 μL ikke indusere noen lesjon i fisken av denne størrelsen. Imidlertid var volumer fra 8 μL tilstrekkelige til å forårsake svulmende og indre blødninger som vist i figur 1F. Basert på disse dataene anslår vi at en mengde løsning som er større enn 3 μL kan forårsake fysisk og fysiologisk stress på orgelet. Denne begrensningen angir behovet for å velge en høyere konsentrasjon av molekyler i stedet for å øke mengden av injisert oppløsning.

En annen viktig faktor er den osmotisk eiendommen til injisert løsning, som bør være i det fysiologiske området. For å unngå risiko for osmotisk stress, anbefaler vi faktisk HBSS som injeksjons medium.

I sebrafisk, de vanligste metodene som brukes til å levere narkotika er gjennom vannbehandling og intraperitoneal injeksjon30,35. Selv om begge disse teknikkene er egnet for mange programmer, IT-injeksjoner gir eksperimentelle og økonomiske fordeler, ved å redusere risikoen for uønskede systemiske bivirkninger og redusere bruken av kostbare molekyler, henholdsvis. Denne metoden kan være egnet for levering av Tamoxifen for å aktivere grobunn-ERT2 transgene-systemet som brukes for celle avstamning tracing analyse, og guide modifisert RNAs for funksjonelle studier i regenerering forskning.

IT-injeksjon metoden i sebrafisk har tidligere blitt beskrevet31,36. I disse rapportene ble intratorakal injeksjoner utført med insulin nål, punktering fra fremre side. I kontrast presenterer vår protokoll en alternativ strategi med den trakk glass kapillær satt inn fra bakre retning. Spesielt vår tilnærming tar hensyn til anatomi av fisken pericardium å optimalisere injeksjon med en redusert risiko for hjerte punktering. Videre under prosedyren, er fisken ikke holdt av metallisk tang, men av en fuktig og myk svamp, som er en mer egnet metode for å unngå eventuelle ytre skader på fisken. Dermed presenteres metoden kan være bedre egnet for studier av hjerte homeostase, preconditioning og regenerering i voksen sebrafisk.

IT-injeksjoner har allerede blitt etablert i pattedyr modell organismer. Faktisk har denne metoden også blitt brukt i eksperimenter med griser og kliniske studier hos mennesker37,38. Hos mus har transthoracic intramyocardial injeksjoner styrt av ultrasounds blitt brukt til å utfordre deres hjerte39. I denne artikkelen foreslår vi en detaljert protokoll for å lette bruken av IT-injeksjon for sebrafisk. Dette vil være spesielt verdifullt for feltet, for å utfylle genetiske tilnærminger i hjertets homeostase, preconditioning og regenerering forskning.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker V. Zimmermann for utmerket teknisk assistanse og for fiske omsorg, D. König (Universitetet i Fribourg) for kritisk lesning av manuskriptet, D. Kressler (Universitetet i Fribourg) for hjelp med zCNTF proteinsyntese, F. Ruggiero (Institut de Génomique Fonctionnelle de Lyon) for å gi ColXII antistoff, og P. Martin (University of Bristol) for L-plastin antistoff. Vi takker Imaging Core anlegget og Proteomikk plattformen ved Universitetet i Fribourg. Dette arbeidet ble støttet av den sveitsiske National Science Foundation, gi nummer 310030_179213, og av schweizerische Herzstiftung (Swiss Heart Foundation).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics