Farklılaşmış HepaRG hücrelerinde veziküler steatozu indükleyen ve karakterize etme

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu çalışmada, farklılaştırılmış HepaRG hücrelerinde yağ asidi tuz sodyum oleat ile karaciğer veziküler steatozis inducing için ayrıntılı bir protokol tarif ve tutarlı Anti-Stokes dahil lipid birikiminin tespiti ve ölçülmesi için yöntemler istihdam Raman saçılma (CARS) mikroskobu, sitofluorimetrik analiz, yağ kırmızı O boyama, ve qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hepatik steatozis, hepatositlerde trigliserid içeren lipid damlacıkları birikiminden oluşan bir metabolik fonksiyon bozukluğu temsil eder. Aşırı yağ birikimi, alkollü olmayan yağlı karaciğer hastalığına (NAFLD) yol açar, bu da potansiyel olarak geri dönüşümlüdür ve alkol içermeyen steatohepatite (NASH) ve sonunda siroz ve hepatosellüler karsinoma (HCC) içine gelişebilir. Hepatositlerde lipid birikimini NASH 'e ilerlemesiyle bağlayan moleküler mekanizmalar, geri dönüşümsüz karaciğer hasarı, fibrozis, siroz ve hatta HCC hala belirsiz kalır. Bu amaçla, NAFLD 'ye neden olan patolojik süreçleri hafifletmek için birkaç in vitro ve in vivo model geliştirilmiştir. Bu çalışmada, biz yağ asidi tuz sodyum oleat ile tedavi DMSO-diferensiyel hepatik heparg hücrelerinden oluşan karaciğer veziküler yağlanma indüksiyonu için bir hücresel model açıklanmaktadır. Nitekim, sodyum oleat tedavi HepaRG hücreleri sitoplazmada lipid damlacıkları birikir ve steatosis tipik özelliklerini gösterir. Bu in vitro insan modeli, in vivo fareler modellerinin yanı sıra primer insan hepatositlerine değerli bir alternatif oluşturmaktadır. Ayrıca, HepaRG hücrelerinde yağ birikiminin ölçülmesi ve değerlendirilmesi için çeşitli yöntemlerin bir karşılaştırmasını sunuyoruz, yağlı kırmızı O boyama, sitoflorimetrik Bodipy ölçümü, qPCR tarafından metabolik gen ifade analizi ve tutarlı Anti-Stokes Raman saçılma (CARS) mikroskopisi. CARS görüntüleme, Raman spektroskopisinin kimyasal özgüllüğünü, malzeme bilimi uygulamalarında iyi bilinen bir kimyasal analiz tekniğinin, yüksek hızlı, yüksek çözünürlüklü doğrusal olmayan optik mikroskopların avantajlarını, hassas lipid birikimi ve lipid damlacık dinamiklerinin ölçülmesi. Veziküler steatozun indüksiyonu için verimli bir in vitro modelin kurulması, lipid birikiminin ölçülmesi ve karakterize edilmesi için doğru bir yöntemin yanı sıra, NAFLD 'nin erken aşama tanısının gelişimine yol açabilir Moleküler Belirteçlerin tanımlanması ve yeni tedavi stratejilerinin oluşturulması.

Introduction

Hepatik steatozis, trigliserid içeren lipid damlacıkları içinde, karaciğer ağırlığının en az% 5 ' inde intrahepatik yağ birikimi olarak tanımlanır. Uzun süreli hepatik lipid depolama potansiyel olarak geri dönüşümlü bir süreçtir, ancak, karaciğer metabolik disfonksiyon, inflamasyon ve alkol olmayan yağlı karaciğer hastalığı ileri formları yol açabilir (NAFLD), birçok yerinde kronik karaciğer hastalığının baskın nedeni Dünya1,2. NAFLD daha agresif olmayan alkollü steatohepatite (Nash), hangi sırayla siroz ve, hastaların küçük bir yüzdesi, hepatosellüler karsinoma (HCC)1,3için ilerleme olabilir evrimleşebilir multifokal bir hastalıktır. Hiçbir onaylı tedavi Şu anda NAFLD için belirli bir tedavi olarak kullanılabilir ve diyet ve yaşam tarzı modifikasyonları kombinasyonu NAFLD ve Nash yönetim sütun kalır4,5,6.

NAFLD patogenezinde hepatik steatozun gelişimine yol açan moleküler mekanizmalar hala7' ye kadar kalır. Bu bağlamda, fare modelleri insan yağlanma hastalığı ilerlemesini incelemek için geliştirilmiştir. Farklı modellerin sayısız var ve her biri, farklı yaklaşımlar birleştiren genetik, besin ve kimyasal kaynaklı modeller de dahil olmak üzere avantajları ve dezavantajları vardır. Genetiği değiştirilmiş (transgenik veya nakavt) fareler kendiliğinden karaciğer hastalığı gelişir. Ancak, bu mutasyonların insanlar ve silme veya tek bir geni (örn., ob/ob fare) üzerinde aşırı ifade çok nadir olduğu unutulmamalıdır molekül seviyesinde multifaktöriyel insan hastalığının etiyolojisi taklit olmayabilir8,9. Aynı şekilde, diyet veya farmakolojik manipülasyon sonrası fareler tarafından elde edilen hastalık, Erkek8' de NAFLD gelişimi ile ilişkili insan diyetleri etkilerini taklit edemez. Ancak hayvan modelleri NAFLD anlayışında gelişmeleri kolaylaştırmış ve bu yaklaşım şu anda laboratuar araştırmalarında en sık kullanılan stratejidir. Yine de, hayvan modellerinde elde edilen sonuçlar insanlarda çoğaltma sürekli başarısız oldu, klinik10içine kötü çeviri neden.

Bu nedenle, NAFLD 'nin in vitro modellerinde NAFLD ilerlemesinin moleküler mekanizmalarını genişleterek temel bir rol oynayabilir ve çok sayıda bileşiği ekrana getiren değerli bir aracı temsil ederler. Primer Hücre kültürleri, ölümsüzleştirilmiş hücre hatları ve karaciğer biyopsileri araştırma amaçlı olarak yaygın olarak kullanılmıştır11. Primer insan hepatositler insan klinik koşullarını yakından andıran, ancak sınırlı sayıda bağış vardır ve primer hücre kültürleri hücrelerin değişkenliği nedeniyle zayıf yeniden Üretilebilirlik gösterir. Bu gözlemler, etik ve lojistik konularla birlikte, insan primer hepatositlerin12' nin kullanımı ile sonuçlanmıştı. Böylece, hepatik hücre hatları uygun bir alternatif temsil, primer kültür üzerinde birkaç temel avantajları olan, hepatik hücre hatları sürekli büyümek gibi, neredeyse sınırsız yaşam süresi var, ve istikrarlı bir fenotipi var. Dahası, hücre hatları kolaylıkla erişilebilir ve hepatik hücre hatlarının kültür koşulları primer hepatositlerden daha basittir ve farklı laboratuvarlar arasında standarttır.

Burada, yağ asidi sodyum oleat ile tedavi edilen hepatik farklılaşmış HepaRG hücreleri tarafından temsil edilen, karaciğer veziküler steatozis bir in vitro hücre tabanlı modeli ayrıntılı olarak açıklanmaktadır. HepaRG hücre hattı Hepatit C enfeksiyonu ve bir Edmondson sınıf ben iyi farklılaşmış karaciğer tümörü etkilenen bir kadın hasta kuruldu14. Heparg hücre hattı, iki farklı hücre phenotypes doğru 2% dimetil sulfoxid (DMSO) maruz kalma üzerine ayrım yeteneğine sahip bir insan bipotent progenitör hücre hattı: biliyer benzeri ve hepatosit benzeri hücreler. Farklılaşmış HepaRG hücreleri (dHepaRG) Yetişkin hepatositlerle bazı özellikleri ve özellikleri paylaşır ve albumin, AldolaseB, sitokrom P450 2E1 (CYP2E1) ve sitokrom P450 3A4 (CYP3A4) 13 gibi karaciğer spesifik genleri stabil bir şekilde ifade etme yeteneğine sahiptir (adım 3). Dheparg hücrelerinin yağ asidi tuz sodyum oleat (250 μM) ile tedavisi 5 gün boyunca sitoplazmik lipid damlacıkları üretmeye yol açar, yağ karaciğerinin etkilerini taklit eder14,15,17,18 ( Adım 4). Lipid damlacıkları birikimi yağ kırmızı O boyama ile kolayca tespit edilebilir (adım 5), nötr trigliseritler ve lipidler kırmızı-turuncu lekeleri bir lysochrome yağ çözünür boya. Yağ dHepaRG içinde lipidleri verimli bir şekilde ölçmek için, burada 4, 4-difluoro-1, 3, 5, 7-tetrametil-4-bora-3A, 4A-Diaza-s-indacene (Bodipy 505/515) (adım 6), lokalleştiren bir lipophilik floresan prob ile boyama sonrası sitofluorimetrik analiz göstermektedir hücre içi lipid organları ve lipid damlacıkları etiket için kullanılan19. Dahası, burada, dheparg hücrelerinde çeşitli metabolik genlerin niceliksel polimeraz zincir reaksiyonu (qPCR) (adım 7) gen ifadesi deregülasyon ile yağlanma nasıl değerlendirileceği gösterilir. Sodyum oleat tedavisinden sonra lipid damlacıkları birikimi daha fazla karakterize etmek ve ölçmek için, biz tutarlı Anti-Stokes Raman saçılma (CARS) mikroskopisi (adım 8), görselleştirme ve ölçülmesi sağlayan yenilikçi bir teknik yapıldı etiketleme olmaksızın lipid damlacıkları20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Kültür Medya ve Reaktiflerin hazırlanması

  1. Proliferating Orta: GlutaMAX, 10% fetal sığır serumu (FBS), 1% penisilin/streptomisin, 5 μg/mL insülin ve 0,5 μM hidrokortizon hemisuccinat ile William 'ın E orta ek.
  2. Farklılaşma ortamı: glutamax, 10% FBS, 1% penisilin/streptomisin, 5 μg/ml insülin, 50 μM hidrokortizon hemisüksinat ve% 2 DMSO ile ek William 'ın E orta.
  3. Dondurma Orta:% 10 DMSO ile Proliferasyona orta takviyesi.
  4. Sodyum oleat: 100 mM konsantrasyonda% 99 metanol içinde çözülür, O/N 'i karıştırın ve-20 °C ' de saklayın.
  5. Yağ kırmızı O: bir stok çözüm hazırlamak. Yağ kırmızı O 0,35 g tartım ve 100 mL isopropanol içinde çözülür. O/N, filtre (0,2 μm) ve RT 'de saklayın. çalışma çözümü hazırlayın: 4 mL ddH2O Ile 6 ml Oil Red O Stock çözümünü karıştırın. Oda sıcaklığına (RT) 20 dakika oturalım ve 0,2 μm filtre ile filtreleyin. Uygun filtrasyon son derece başarılı boyama için arka plan önlemek için tavsiye edilir.
  6. Bodipy (505/515): DMSO 'da bir 100 μM stok konsantrasyonunda Bodipy (505/515) boyayı çözülür, karanlıkta-20 °C ' de saklayın ve son 100 nM konsantrasyonunda kullanın.
  7. CARS deneyleri için şeffaf cam dipli yemekler kazanın.

2. HepaRG hücrelerinin çözülme, amplifikasyon ve Cryopreserve

  1. Çözünmüş nitrojen HepaRG hücreleri, 37 °C ' lik bir banyoda bir toplu işleme daldırarak çözüler. Düşük geçiş toplu işlemini seçin (< 20). HepaRG hücreleri ticari olarak mevcuttur.
  2. Hücreleri, 10 mL proliferasyon orta ve santrifüjle 5 dk (200 x g, 4 °c) Içeren 15 ml 'lik bir tüpün içine hızla aktarın.
  3. Süpernatant atın ve Proliferasyona orta 5 ml ile hücreleri pelletini.
  4. Hücreleri saymak ve plaka 2,5 x 104 hücreler/cm2için seyreltmeli.
  5. Her 2 veya 3 günde bir ortamı yenileyin. Hücreler yaklaşık 24 saat ikiye katlama süresi ile çoğalırlar.
  6. HepaRG hücrelerini Detach zaman 80%% confluency ile 3-5 min inkübasyon tripsin çözeltisi ile 0,05%. Hücreleri Proliferasyona orta ve santrifüjler toplamak 5 dakika (200 x g, 4 °c).
  7. Süpernatant atın ve Proliferasyona orta 5 ml ile hücreleri pelletini.
  8. Hücreleri saymak ve plaka 2,5 x 104 hücreler/cm2için seyreltmeli.
  9. Bu aşamada, 2.5-2.8 adımlarını yineleyerek, denemeleri başlatmak için uygun sayıda hücreye ulaşabilmek için hücreleri arttırın veya 2,10 adımda olduğu gibi asopreserve yapın.
  10. HepaRG hücreleri cryopreserve için, hücreleri ayırın 24 h tarafından kaplama sonra 3-5 min kuluçla tripsin çözeltisi ile 0,05%. Hücreleri Proliferasyona orta ve santrifüjler toplamak 5 dakika (200 x g, 4 °c). Supernatant atın, hücreleri yeniden pelletini 1 ml/toplu donma orta, 1,5 x 106 hücreler/toplu ve sıvı nitrojen toplu cryopreserve.

3. HepaRG hücrelerinin farklılaşma (gün 0 – 21) (Şekil 1A)

  1. 0. gün. Düşük yoğunluklu tohum HepaRG hücreleri (2,5 x 104 hücreler/cm2) kültüre uygun hacim proliferasyon ortamı ile tedavi edilen yemekler içine (Şekil 1B). İki yemek her tahlil için kaplama gerekir (yağ kırmızı O boyama, FACS analizi, qPCR): bir kontrol hücreleri için ve bir oleate-tedavi hücreler için. OTOMOBIL ölçümleri (adım 8) gerçekleştiriyorsanız, hücreleri saydam cam dipli yemeklere paralel olarak tohum. Bir kontrol olarak, bir tedavi edilmemiş çanak hasat (proliferating hücreler gün 0) farklılaşma Marker genler gen ifade analizi gerçekleştirmek için (bkz. Adım 3,6).
  2. 2. gün ve 4. Yayılma ortamının uygun hacmine sahip ortamı değiştirin ve hücrelerin konfluence kadar büyümesine izin verin.
  3. 7. gün. Hücreler% 100 olmalıdır (Şekil 1C). Bir kez 1x fosfat-tamponlu tuz (PBS) ile hücreleri yıkayın. 1x PBS çıkarın ve uygun bir diferif ortam hacmi ekleyin.
  4. 8. gün, 9, 12, 15, 18.  Hücreleri bir kez 1x PBS ile yıkayın. 1x PBS çıkarın ve uygun bir diferif ortam hacmi ekleyin.
  5. 21. gün. HepaRG hücrelerini mikroskop altında gözlemleyin ve hücrelerin konfluent farklılaşmış kültürler olduğundan emin olun (Şekil 1D).
  6. Bir kontrol olarak, bir kontrol çanak hasat (ayrım hücreleri gün 21) gen ifade analizi gerçekleştirmek için (adım 7) farklılaşma Marker genler (Şekil 1E).
  7. 21. günde, farklılaşmış heparg hücreleri sıvı-nitrojen içinde kriokonservirovannogo olabilir.

4. veziküler steatozis İndüksiyon (gün 21 – 26)

  1. 21. gün. Sodyum oleat seyreltme (100 mM) tam farklılaşma orta bir son konsantrasyon 250 μM (1:400) için uygun bir hacim ile. Ekle 99% metanol 1:400 (sodyum oleat aynı hacim) farklı bir farklılaşma ortamı içine araç kontrol tedavisi yapmak için. (Örneğin: 10 mL orta ve paralel olarak 25 μL,% 99 metanol $10 mL orta) ekleyin. Hücreleri bir kez 1x PBS ile yıkayın ve araç veya sodyum oleat orta ekleyin.
  2. 23. gün ve 25. Adım 4,1 gibi taze hazırlanmış orta uygun hacim ile orta değiştirin.
  3. 26. gün. Lipid damlacıkları sodyum oleat işlenmiş hücrelerde biriken optik mikroskop ile gözlemlemek ve Şekil 2Agibi sitoplazmada yarı saydam damlacıklar olarak kolayca görülebilir.

5. lipid aşırı yükleme ve steatosis Indüksiyon değerlendirilmesi: yağ kırmızı O boyama

  1. O hücreleri bir kez 1x PBS ile yıkayın ve 1x PBS 'ı tamamen kaldırın.
  2. % 4 civarında formaldehite ekleyin (1x PBS 'de seyreltilmiş) ve RT 'de 15 dakika boyunca inküye yapın.
    Dikkat: Paraformaldehyde zehirlidir, bu nedenle bu adım eldiven, laboratuvar ceket ve maske gibi koruyucu ekipmanlarla birlikte bir duman kaputu içinde yapılmalıdır.
  3. Civarında formaldehite kaldırın ve 1x PBS ile iki kez hücreleri yıkayın. Hücreler boyama öncesinde birkaç gün boyunca 4 °C ' de 1x PBS 'de tutulabilir. Parafilm ile Wrap ve alüminyum folyo ile kapak kurutma hücreleri önlemek için.
  4. 1x PBS kaldırın. RT 'de 5 dakika süreyle% 60 izopropanol ile hücreleri inküat.
  5. İzopropanol çıkarın ve hücreler RT tamamen kuru izin.
  6. Oil Red O çalışma çözümünü ekleyin ve 30 dakika boyunca RT 'de inküye yapın. Her örnek için gerekli çalışma çözeltisi hacmi hücrelerin kültürü için kullanılan ortam hacmine karşılık gelir.
  7. Yağ kırmızı O solüsyonu çıkarın ve hemen ddH2o. DDH2o Ile hücreleri 4 kez yıkayın.
  8. Analiz için mikroskop altında görüntüler elde (Şekil 2B).
  9. Yağ kırmızı O boya elute için: tüm su kaldırmak ve kuru izin; 1 ml 100% izopropanol ekleyin ve RT 'de nazik sallayarak 10 dakika boyunca inkübe.
  10. Tüm yağ kırmızısı o 'nun çözümde olduğundan emin olmak için, birkaç kez yukarı ve aşağı eltilmiş yağlı kırmızı o boya ile izopropanol pipet. Çözümü bir küvete aktarın. Ölçüm od500 spektrofotometri ile Nm ve% 100 izopropanol boş olarak kullanın (Şekil 2C).

6. lipid aşırı yükleme ve steatosis Indüksiyonunun değerlendirilmesi: Bodipy boyama ve Sitflorimetrik analiz

  1. Hücreleri bir kez 1x PBS ile yıkayın. 37 °C ' de 40 dk için karanlıkta 1x PBS 'de seyreltilmiş 100 nM Bodipy ile inküye yapın. Akış sitometri ölçümlerine lekelenmiş bir kontrol dahil edilmelidir. Bu noktadan itibaren, örnekleri ışığa kadar olabildiğince koruyun.
    Not: Her örnek için gereken boyama çözeltisi hacmi, kültür hücreleri için kullanılan medyanın hacmine karşılık gelir.
  2. Boyama çözümünü çıkarın ve hücreleri 1x PBS ile bir kez yıkayın. 6.3-6.6 arasındaki adımlara geçin. FACS (floresan-aktif hücre sıralama) analizi veya mikroskop görüntüleme için 6,7 adım için.
  3. 1x PBS ile hücreleri hafifçe kazımak ve 15 mL 'Lik bir tüpe aktarın. 10 dakika Santrifüjü (200 x g, 4 °c).
  4. Pelayları rahatsız etmeden süper natantları yavaşça çıkarın ve 3 mL 1x PBS ile yıkayın. Santrifüjü 5 dak (200 x g, 4 °c).
  5. 300 μL 1x PBS içinde süpernatanlarında ve pelletini çıkarın, sonra bir FACS tüpüne aktarın.
  6. 505/515 Nm (Şekil 3A, B) uyarma/emisyon dalga boyları ile Sitflorimetrik analiz ile bodipy floresans yoğunluğunu hemen ölçün.
  7. Hücreleri bir kez 1x PBS ile yıkayın ve PBS 'i tamamen kaldırın.
  8. % 4 civarında formaldehite ekleyin (1x PBS 'de seyreltilmiş) ve RT 'de 15 dakika boyunca inküye yapın.
    Dikkat: Paraformaldehyde zehirlidir, bu nedenle bu adım eldiven, laboratuvar ceket ve maske gibi koruyucu ekipmanlarla birlikte bir duman kaputu içinde yapılmalıdır.
  9. Civarında formaldehite kaldırın ve PBS 5 dakika için örnekleri 3x yıkayın. Hücreler 4 °C ' de 1x PBS 'de tutulabilir veya hemen görüntülenmiş olabilir (Şekil 3C). Depolama için, Parafilm ile Wrap ve alüminyum folyo ile kapak kurutma hücreleri önlemek için.

7. lipid aşırı yükleme ve steatozis Indüksiyon değerlendirilmesi: qPCR

  1. Hücreleri bir kez 1x PBS ile yıkayın. 1x PBS ile hücreleri scrape, 200 x gSantrifüjü, ve supernatant atın. Bu adımda, hücreler-80 °C ' de hasat edilebilir veya 7,2 adımda olarak işlenir.
  2. Üreticinin talimatlarını takiben ticari reaktifleri kullanarak standart yöntemlerle toplam RNA yalıtımı gerçekleştirin.
  3. RNA konsantrasyonunun UV spektrofotometrik ölçümüyle değerlendirilmesi, A260/A280 okuma temelinde RNA saflığının yüksek (2,0 ' e yakın) olmasını sağlar.
  4. Standart bir cDNA sentezi kiti ile 1 μg toplam RNA 'dan cDNA sentezi.
  5. H2O ile son 50 μL hacmi için seyreltik cDNA.
  6. QPCR tarafından triplicate her cDNA örnek analiz: bir qPCR Master Mix hazırlamak (Tablo 1) her astar için gerekli reaksiyonlar için yeterli olan, kontrol olarak üç temizlik genler için özel astar dahil: gliceraldeid-3-Fosfato deidrogenasi (gapdh), actinb ve ribozomal 18s (bkz. Primer diziler için malzeme tablosu ):
  7. PCR Multiwall plakasında iyi başına 18 μL ana karışımı dağıtın.
  8. Her kuyunda 2 μL cDNA örneği ekleyin. Plakayı mühürle.
  9. Örnekleri termal cycler talimatlarına göre çalıştırın.

8. lipid aşırı yükleme ve steatosis Indüksiyon değerlendirilmesi: CARS

  1. 5.1-5.3 adımlarında açıklandığı gibi, cam dipli yemeklerle önceden hazırlanan hücreleri düzeltin.
  2. Bir ticari ayarlanabilir Pikosaniye darbeli Lazer sistemi üzerinde geçiş, farklı dalga boyu iki çıkış elde etmek için tuning. Çıkışlar arasındaki frekans farkı 2.840 cm-1 olmalıdır, metilen simetrik esnemeye karşılık gelen yoğun Cars ışık sinyalini oluşturmak için; 1.064 nm 'de sabit dalga boyu çıkış için ("Stokes" ışık), diğer dalga boyu 817 Nm ("pompa" ışık) için ayarlanması gerekir.
  3. 817 nm çıkışının dağınık ve geçici olarak 1.064 nm çıkışıyla örtüşmesini sağlayın: kirişleri dağınık bir şekilde birleştirmek ve lazerin temporal çakışmayı elde etmek için bir optik gecikme hattı kullanmak için uygun bir dikroik Mirror (örneğin, 817 ile 1.064 Nm arasında bir kesim ile) kullanın Bakliyat.
  4. İki copropagating kiriş hem harmanlanmış ve onların çapları örnek üzerine odaklanacaktır mikroskop içinde optik sistem için uygun olan benzer değerlere sahip olduğundan emin olun; gerekirse, onları birleştiren Dikroik ayna önce kirişleri ayrı olarak harmanlayan.
  5. Kızılötesi lazer tarama ünitesi ve çift kanallı kırmızı/yeşil epi algılama ünitesi içermelidir ve kopropagating lazer ışınlarını tarama birimine hizalamak için ticari ters çevrilmiş bir mikroskop sistemi açın.
  6. Çift kanallı epi algılama ünitesini açarak, filtre küpünü çıkarın ve kırmızı dalga boyu algılama filtresini, 817/1064 nm pompa/Stokes uyarma için 663 nm 'de ortalanmış 2.840 cm-1 otomobil sinyalini seçebileceğiniz bir bant geçiren filtresiyle değiştirin Düzeni. Yüksek düzeyde floresan arka plan sinyallerinin toplanması önlemek için dar-bant genişliği (20 Nm) filtre tercih edilir.
  7. Ters CARS mikroskop aşamasında bir çanak yerleştirin ve 100x yağ daldırma amacı kullanarak, hücrelere odaklanmak için hedefin dikey konumunu vardiya.
  8. % 127 μm x 127 μm ' lik bir görünüm alanı üzerinde yüksek çözünürlüklü (1024 x 1024 piksel) görüntüler toplamak için mikroskop yazılımını ayarlayın.
  9. 127 μm x 127 μm görüş alanının görüntülerini sürekli olarak elde etmek ve görüntülemek için mikroskop yazılımını ayarlayın ve görüntü toplama parametrelerini optimize ederken görüntülenen görüntüleri kontrol edin. Lazer güçlerin hızlı görüntü toplama ve minimal hasar için dengeli olduğundan emin olun, gerekli olan kiriş yollarına uygun nötr yoğunluklu filtreler ekleme ve iyi bir sinyal-gürültüye sahip görüntülerin toplanması için izin veren bir piksel bekleme süresi seçin Seçilen lazer güç koşullarında oranı.
  10. Elde etmek ve optimum koşullar altında çanak içinde görüş birkaç farklı alanların görüntüleri kaydedin. İsteğe bağlı olarak, yeşil dalga boyu emisyonu tarafından oluşturulan multifoton floresan görüntüleri (çoğunlukla 817 nm 'de iki foton uyarılma), diğer epi dedektörü ile aynı anda toplanabilir. Her çanak için 8.7-8.10 arasındaki adımları yineleyin.
  11. CARS görüntü analizi için ımagej 'nin FIJI uygulamasını kullanarak işlem görüntüleri. Detay kaybı olmadan sinyal-gürültü oranlarını iyileştirmek için daha fazla analiz yapmadan önce her görüntüde Despeckle fonksiyonunu (veya benzer bir denoising aracı) çalıştırın.
  12. Tüm hücreler için ve her bir tabak için tüm görüntü veri kümesi için lipid damlacık alanları ve numaraları istatistikleri üretmek için otomatik olarak bölümlenmiş bireysel hücreler içinde lipid damlacıkları saymak, hücreleri el ile seçmek için FIJI kullanın.

9. MTT hücre viability tahlil

  1. Plakalı HepaRG hücrelerini, 1 x 105 hücreli bir yoğunluğa sahip 96-iyi bir plakaya ayırır/iyi bir son 100 μL hacim farklılaşma kültürü ortamıdır.
  2. tohumdan sonra 24 saat, hücreleri 99% metanol (araç) ile ve 100 μM, 250 μM ve 500 μM sodyum oleat ve sodyum palmitat, 100 μL farklılaşma kültürü orta/iyi triplicate içinde seyreltilmiş olarak tedavi edin.
  3. % 99 metanol ile orta ve 100 μM, 250 μM ve 500 μM sodyum oleat ve sodyum palmitat ile değiştirmek, her 24 saatte bir, 100 μL 'de farklılaşma kültürü orta/iyi olarak seyreltilir.
  4. 96 h metanol/sodyum oleat/sodyum palmitat tedavisi sonrasında, 2 μM doxorubisin, 100 μL 'de diferansiyel kültürü orta/iyi bir kontrol olarak triplicate içinde seyreltilmiş hücreleri tedavi edin.
  5. 18 saat sonra doxorubucin tedavi, orta değiştirme 100 μL farklılaşma kültürü orta.
  6. Pipet 20 μL 3-(4, 5-dimethylthiazol-2-yl)-5-(3-karboksilmethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reaktif MTT (malzeme tablosu) her iyi içine 96-iyi assay plaka içinde hücreleri Içeren 100 μL farklılaşma kültürü orta . 20 μL reakajın pipetleme yaparak bir arka plan denetimini, 100 μL 'de hücreler olmadan, triplicate içinde diferansiyel kültür ortamını kontrol altına alarak da ekleyin.
  7. % 5 CO2 atmosferinde, 37 °c ' de plakayı kulyur.
  8. MTT tetrazolyum reaktif ile 30, 60 ve 90 dk için inküreme sonra, bir 96-Well plaka okuyucu kullanarak 490 nm emici kaydedin. Diğer örnekler için emici değerlerden hücre yok kontrol kuyuları arka plan absorbans çıkarın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bu protokol, DMSO-farklılaşmış HepaRG hücrelerinde veziküler steatozis 'i sodyum oleat tedavisinde (Şekil 1A) teşvik etmek ve karakterize etmek için etkili bir yöntem açıklanmaktadır.

HepaRG hücrelerinin farklılaşması.
Farklılaşmaya etkili bir şekilde sebep olmak için proliferasyon hücreleri düşük yoğunlukta (2,5 x 104 hücreler/cm2) çoğalması ortamında tohumlama yapılmalıdır. Düşük yoğunluğa sahip olduğunda, hücreler aktif olarak bölünür ve farklılaşılmış bir morfoloji elde ederler (Şekil 1B). Hücreler 7 gün boyunca proliferasyon ortamında büyümek için bırakılmalı,% 100 ' e kadar konfluens ulaşılana kadar (Şekil 1C). % 2 DMSO 'ya maruz kaldıktan sonra hücreler, biliyer epitelyal benzeri hücrelerle çevrili tipik hepatosit benzeri koloniler oluşturacak ve ayırt etmeye başlar (Şekil 1D). Farklılaşmış HepaRG hücreleri, albumin, Cyp3A4 ve Aldolase B gibi Hepato spesifik işaretçileri ifade ederler. Farklılaşma hücrelerinde (21. gün) ve proliferasyon hücrelerinde (0. gün) bu hepatik Marker genlerinin ifade seviyeleri qPCR (Şekil 1E) tarafından incelenmiştir. Albumin, Cyp3A4 ve aldolase B genler Proliferasyona heparg hücrelerine kıyasla farklılaşan heparg hücrelerinde updüzenlenmiş olmalıdır, ve biz bu eğilim gözlenen, bizim farklılaşma protokolünün etkinliğini teyit.

Heparg hücrelerinde veziküler yağlanma indüksiyonu sodyum oleat tedavisi ile.
DHepaRG hücrelerinin sodyum oleat tedavisi, sitoplazmlarda lipid damlacıkları olarak optik mikroskop altında görünür yağ birikimi indükler (Şekil 2A). Steatozis etkili indüksiyon doğrulamak için, oleate-tedavi ve kontrol HepaRG hücreleri yağ kırmızı O boya ile lekelenmiş. Lekeleydikten sonra, lipid damlacıkları kırmızı damlacıklar olarak kolayca görülebilir (Şekil 2B) ve izopropanol (Şekil 2C) ile erilmiş yağ kırmızı O boya spektrofotometrik ölçümü ile nicelleşmiş olabilir. Hücrelerden eltilmiş yağ kırmızı O emici, sitoplazmik lipid damlacık birikimi ile doğrudan orantılı.

Sodyum oleat konsantrasyonu ve pozlama süresi MTT renkmetrik hücre canlılığı tahlil tarafından belirlendi (adım 9). Sodyum oleat tedavisi sodyum palmitat tedavisine kıyasla ve apoptotik ilaç doxorubucin (2 μM) kontrol olarak kullanıldı (Şekil 2D). Bileşiklerin cyzehirlenmesi MTT tarafından değerlendirildi, ticari bir bileşik yararlanarak (malzeme tablosu), bu MTT tetrazolium içerir. Su çözünür sarı MTT tetrazolyum bileşik mor su çözünmez formazan ürün içine metabolik aktif hücreler tarafından bioreduced olduğunu. Formazan ürün 490 nm de emici tarafından nicelik ve miktarı kültürdeki yaşam hücrelerinin sayısı ile doğrudan orantılı (Şekil 2D).

Sodyum oleat tedavi HepaRG hücrelerinde veziküler steatozun ölçülmesini
Sodyum oleat tedavisinden sonra hücresel lipid içeriğinin artmasını ölçmek için, lipid damlacıkları etiketlendiren bir prob olan Bodipy boya ile boyama gerçekleştirdik. Sitflorimetrik analizini kullanarak, trigliserid içeriği Bodipy ortalama floresan yoğunluğu ile ölçmek mümkündür, hangi kontrol hücrelerine kıyasla oleate işlenmiş hücrelerde daha yüksektir (Şekil 3A, B), etkili yağ gösteren tedavisinden sonra birikmesine neden olur. Nitekim, Bodipy-lekelenmiş hücrelerin görüntüleri kontrol hücrelerinde görünmez oleate-tedavi hücrelerde parlak yeşil floresan lipid damlacıkları göstermek (Şekil 3C).

DHepaRG hücrelerinin sodyum oleat tedavisi lipid metabolizmasını ve inflamatuar gen ifadesini yok eder. Veziküler steatozun verimli indüksiyonunun değerlendirilmesi için, qPCR tarafından, sodyum oleat işlenmiş hücrelerdeki seçilen genlerin ifade seviyeleri kontrol hücrelerinin ile karşılaştırıldığında incelenmiştir (Şekil 4). Asetil-COA karboksilaz Beta (acacb), gliserol-3-fosfat asiltransferaz mitokondrial (GPAM), perilipins (PLIN2, PLIN4), apolipoprotein B (ApoB), piruvat dehidrogenaz kinaz ısozyme 4 (PDK4), karnitin palmitoyltransferaz 1a (CPT1A) ve Interleukin 6 (IL6) oleate tedavi dheparg hücrelerinde, çözünen taşıyıcı aile 2 üye 1 (SLC2A1), apolipoprotein C-III (APOC3), ve stearoyl-COA desaturase (SCD) downdüzenlenmiş idi (Şekil 4). Farklı HepaRG hücrelerine sodyum oleat ilavesi üzerine damlacıklar içinde lipid depolamayı daha fazla karakterize etmek ve ölçmek için, yenilikçi bir mikroskopi tekniği, tutarlı Anti-Stokes Raman saçılma (CARS) mikroskopisi kullanılmıştır. sınıflandırılması ve lipid damlacıkları etiketlemeden ölçülmesi (Şekil 5A). Lipid damlacıkları, CARS görüntüleri kullanılarak tek hücreli seviyede sayılar, dağılım ve morfoloji açısından istatistiksel olarak ölçülebilir. Sodyum oleat ile tedavi (250 μM) lipid damlacıkları sayısında önemli bir artış (Şekil 5B), hücre başına daha yüksek bir toplam damlacık alanına yol açtı (Şekil 5C) ve hücre başına daha yüksek bir yüzde damlacık alanı ( Şekil 5D), kontrol hücrelerine kıyasla, dheparg hücrelerinin verimli bir şekilde sodyum oleat tedavisi sonrası yağ birikmiş olduğunu belirten.

Figure 1
Şekil 1 : HepaRG hücrelerinin farklılaşması. (A) 3 ve 4 adımda açıklandığı gibi HepaRG hücre farklılaşma/tedavi protokolünü gösteren temsili diyagram. (B-D) Tohumlama (B) sonra 0 gün içinde lekelenmiş proliferasyon heparg hücreleri gösteren görüntüler, (C) tohumlama sonra 7 gün, ve (D) tohumlama sonra 21 gün içinde ayırt heparg (dheparg). (E) total RNA Proliferasyona ve dheparg hücrelerinden çıkarılan cDNA, belirtilen genler (malzeme tablosu) için spesifik astar kullanarak qPCR tarafından sentezlenmiş ve analiz edilmiştir. Örnekleri gapdh ortalama normalleştirilmiş, actinb ve ribozomal 18s temizlik genler. Histogramlar, proliferasyon (gün 0) ile farklılaşan hücrelerde (gün 21) Fold indüksiyon gösterir (Bar SD gösterir; p-değerleri öğrenci t-testleri tarafından hesaplanır). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2 : DHepaRG hücrelerinde sodyum oleat tedavisi lipid damlacık birikimi indüklenen. (A) araç (kontrol) (sol görüntü) veya 250 μM sodyum oleat (sağ görüntü) ile 5 gün boyunca tedavi edilen lekelenmiş farklılaşmış Heparg (dheparg) hücrelerinin görüntüleri. (B) tedavi sonrası, hücreler yağ kırmızı O boya ile lekelenmiş; lipid damlacıkları kırmızı görünür. (C) yağ kırmızısı O boya YAPıLDı ve od 570 nm 'de ölçüldü. Sonuçlar üç bağımsız deney (Bar, öğrenci t testi tarafından SD; p-değeri gösterir) olarak ifade edilir. (D) dheparg hücre araç (99% metanol) tedavi (Ctrl) veya sodyum oleat ve sodyum palmitat (100 μm, 250 μm, veya 500 μm) ile 5 gün boyunca tedavi hücre canlılığı değerlendirme veya tedavi 18 h doxorubucin (2 μM) ile.  Sitotoksisite değerlendirilmesi, üreticinin talimatına göre 490 nm 'de bir MTT tahlil kiti (malzeme tablosu), kayıt emici kullanılarak yapılmıştır. Sonuçlar üç bağımsız deney olarak ifade edilir (barlar SD gösterir; p-değerleri öğrenci t-testi kullanılarak belirlenmiştir: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 3
Şekil 3 : Bodipy boyama tarafından sodyum oleat tedavisinden sonra yağ birikiminin ölçülmesi. Farklılaşmış HepaRG (dHepaRG) hücreler 5 gün boyunca araç (kontrol) veya 250-μM sodyum oleat ile tedavi edildi. Tedaviden sonra, dHepaRG hücreleri Bodipy boya ile lekelenmiş ve akış sitometri tarafından analiz edildi. (A) temsilci kaplama profilleri (maks.%: maksimum boyama yoğunluğunun yüzdesi). (B) histogramlar, üç bağımsız deneyden kontrol üzerine tedavi edilen hücrelerin yüzdesi olarak ortalama floresan yoğunluğu (MFI) gösterir (barlar SD 'ye işaret ediyor; p-değerleri öğrencinin t-testi kullanılarak belirlendi: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). (C) hücreler% 4 paraformaldehit ile düzeltildi. Görüntüler Bodipy-lekeli lipid damlacıkları yeşil gösterir. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 4
Şekil 4 : DHepaRG hücrelerinin sodyum oleat tedavisi lipid metabolizması ve inflamatuar Gen ifadesinin deregülasyon indükler. Farklılaşmış HepaRG (dHepaRG) hücreler 5 gün boyunca araç (kontrol) veya 250-μM sodyum oleat ile tedavi edildi. cdnas, qPCR tarafından belirtilen genler için spesifik astar ile incelendi ve sonuçlar gapdh, aktinb ve ribozomal 18s temizlik genler ortalamalarına normale döndü; astarlar malzeme tablosundaverilir. Histogram, kontrol üzerine tedavi edilen hücrelerin Fold indüksiyonları olarak belirtilen genlerin ifade düzeylerini gösterir (çubuklar SD 'ye işaret ediyor; p-değerleri öğrencinin t-testi tarafından hesaplanır). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 5
Şekil 5 : Cars mikroskopisi ile sodyum oleat tedavisinden sonra lipid damlacık birikiminin karakterizasyonu. Farklılaşmış HepaRG (dHepaRG) hücreler 5 gün boyunca araç (kontrol) veya 250 μM sodyum oleat ile tedavi edildi ve otomobıl mikroskobu ile analiz edildi. (A) kırmızı lipid damlacık otomobil kontrast gösteren temsili görüntüler. (B) hücre başına lipid damlacıkları numaralarını gösteren histogram. (C) hücre başına damlacıklar ile kaplı toplam görüntü alanı gösteren histograları. (D) hücre başına damlacıklar tarafından kapsanan% damlacık alanı gösteren histogram. Tüm sonuçlar üç bağımsız deney (Bar, Güneydoğu gösterir; p-değerleri öğrenci t-testi tarafından belirlenir: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Reaktif Tek bir reaksiyon için hacim (μL)
2x SYBR yeşil floresan boya 10
PCR sınıfı H2O 6
İleri astar (μM) 1
Ters astar (μM) 1

Tablo 1: qPCR ana karışımı.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu protokol, heparg hücrelerinin nasıl ayırt edileceği ve sodyum oleat tedavisi ile veziküler yağlanma nasıl uyaracağını açıklar (Şekil 1A). Nitekim, diğer insan hepatosellüler Karsinomu (HCC) hücre hatları ile karşılaştırıldığında, heparg hücre hattı yetişkin insan hepatositlerin özellikleri sergiler, ex vivo yetiştirilmiş primer insan hepatositlere değerli bir alternatif temsil13,14 ,15. Heparg hücre hattı yaygın karaciğer sitotoksisite çalışmaları için kullanılan, ilaç metabolizması, ve Viroloji çalışmaları15,16,22.

Heparg hücreleriyle karşılaştırıldığında, HepG2, HUH7, HUH6 ve Hep3B gibi diğer HCC hücre hatları, karaciğer spesifik fonksiyonları23,24önemli bir dizi eksik ve daha yüksek bazal seviyesini sergileme, düşük metabolik kapasiteleri görüntülemek lipid damlacıkları içinde saklanan sitosolik yağ birikimi. Böylece, bu HCC hücre hatları, heparg hücre hattına göre lipid aşırı yüklemesi sonrasında veziküler yağlanma indüksiyonu için modeller olarak daha az yararlıdır.

Protokol içindeki kritik adımlar
Düşük yoğunlukta (2,5 x 104 hücre/cm2) seribaşı, heparg hücreleri, aktif bölme, uzamış bir farklılaşılmış morfoloji elde; % 100 ' e ulaştıktan sonra,% 2 DMSO 'ya maruz kaldıktan sonra farklılaşabilen ve biliyer epitelyal benzeri hücrelerle çevrili tipik hepatosit benzeri koloniler oluştururlar (Şekil 1D). Bu karışık biliyer/hepatosit hücre kültürü, diğer karaciğer hücresi türlerine (sinüs veya Kupffer) rağmen, fizyolojik bir duruma benzeyen karaciğer dokusunun özelliklerini reapittir.

Farklılaşma sürecinde kritik bir adım hücrelerin konfluency olduğunu. Hücreler düşük yoğunluklu (2,5 x 104 hücreler/cm2) (Şekil 1B) ve en az 1 hafta (gün 0-7) proliferasyon ortamında aktif olarak büyümeye izin verildi. 7. günde, farklılaşma sürecini başlatmak için% 2 DMSO eklemeden önce, hücreler% 100 konfluence olmalıdır (Şekil 1C). 7. günde (adım 2,2) tam konfluiye ulaşılamadı ise, hücrelerin% 100 ' e kadar konfluence elde edilinceye kadar, bazı ek günler için proliferasyon ortamında büyümeye devam etmesine izin verilmekte şiddetle tavsiye edilir.

Protokol sınırlamaları
Bu farklılaşma orta ekledikten sonra, bazı hücreler muzdarip ve genellikle hücrelerin% 10 sonraki 2-3 gün içinde ölmek gözlenmiştir. Bu aşamada, günlük yıkama ve orta değişen (adım 2,4) yüzen ölü hücreleri atmak için devam edilmelidir. Farklılaşma ve proliferasyon medyasını tamamlamak için belirli bir FBS (malzeme tablosu) kullanımı, gün 7-21 (adım 2,4) sırasında farklılaşma verimliliğini ve alt hücre ölümünü artırmalıdır. Hücreleri ayırmak için 20 ' ye kadar hücre bakımını yapmak ve hücreleri ayırt etmek için daha düşük pasajlar (< 20) seçmek için tavsiye edilir: en genç HepaRG hücreleri için daha az hücre ölümü oluşur. Dahası, HepaRG farklılaşma 35 mm ve 60 mm yemeklerle daha etkili görünmektedir, ancak hücreler, 100 mm ve 150 mm 'lik yemeklerle daha fazla acı çekebilir.

Değişiklikler ve sorun giderme
Hem palmitik hem de oleik yağ asitlerinin farklı oranlarına maruz kalma, intrakitoasmatik lipid damlacıkları oluşumuna neden olduğu gösterilmiştir25,26. Ancak, farklılaşmış HepaRG hücrelerinde sodyum oleat tedavisinin, lipid birikiminin ve hücre akmanın verimli indüksiyonu açısından, palmitik asit maruz kaldıktan daha iyi sonuçlar sergilediği görülmüştür (Şekil 2D). Nitekim, palmitik asit tedavisi, farklılaşmış HepaRG hücreleri için toksik olduğunu kanıtladı (Şekil 2D), hepatoma hücre hatları ve insan ve sıçan hepatosit primer kültürlerde literatür verileri ile anlaşma olarak palmitik asit açıklayan bir önemli ölçüde sitotoksisik Ajan25,26,27,28,29. Dahası, hücre bazlı asdında palmitat kullanımı düşük çözünürlüğe bağlı olarak zordur. Yine de, hücre çizgilerinin içsel değişkenliği nedeniyle, bir hücre canlılığı tahlil ile bir zaman kursu deney farklı konsantrasyonları test, konsantrasyon ve tedavi zaman uzunluğu çalışma sodyum oleat doğrulamak için tavsiye edilir.

Lipid algılama tekniklerinin önemi ve karşılaştırılması
Bu çalışmada, hücrelerde lipid tutarlarının doğru bir şekilde belirlenmesi, bir dizi farklı yaklaşım ile kurulmuştur. Yağ kırmızı O boyama, Bodipy boyama ve CARS görüntüleme yoluyla elde edilen sonuçlar arasında nitel ve aynı zamanda yaklaşık nicel anlaşma gözlenmiştir. Hücre nüfuslarında lipid miktarlarının hızlı bir şekilde tahmin edilmesi için, Bodipy-Flow sitometri veya Oil Red O gibi bir lekenin kullanımı idealdir. Hücrelerin lipid damlacık içeriğinin daha ayrıntılı incelenmesi için bir görüntüleme modalitesi tercih edilir. Ayrıca, yağ kırmızı O20,30gibi lipid lekeleri için özgüllük sorunları bildirilmiştir, ve biz bazı durumlarda, bodipy leke sadece diğer hücre arasında lipid damlacıkları etiket araba daha düşük kapasiteye sahip olduğunu gözlemledik (veri gösterilmez). Bu nedenle, CARS gibi etiketsiz bir mikroskobik görüntüleme tekniğinin kullanımı, steatozis ölçümleme ve karakterizasyonu için önemli avantajlar sağlar. Büyük bir floresan etiketin kullanımından kaçınılmaları, tipik fluoropoorlara kıyasla küçük lipid moleküllerinin boyutu nedeniyle CARS görüntülemenin olumlu olmasını sağlar; Bu nedenle, lipidlerin tespiti için, etiket içermeyen yöntemler büyük protein moleküllerini gözlemlemek için daha çok arzu edilir. Lipid CARS sinyali, örnekteki doğrusal olmayan bir etkileşim oluştuğunda oluşturulan bir optik emisyondan kaynaklanır. Bu etkileşim sadece örnek üzerine odaklanan iki uyarma lazerin frekansları arasındaki fark metilen (CH2) germe titreşim frekansı ile eşleştiğinde tespit edilebilir. Lipidlerde metilen grupların bolluğu, yüksek sinyal-gürültü oranlarına sahip çok yoğun sinyallerle sonuçlanır ve optik etkileşimin doğrusallık da CARS mikroskobu yüksek uzamsal çözünürlük mümkün anlamına gelir. Genel olarak CARS görüntülerin mükemmel kalitesi bu çalışmada gösterildiği gibi, lipid damlacıkları boyutları ve sayılar üzerinde istatistik koleksiyonu sağlar. Buna ek olarak, diğer çalışmalar farklı hücre altı lokalikasyonları ve lipid damlacıkları boyutları farklı tedaviler ile ilişkilendirmek için Cars microkopi kullanımını göstermiştir18, ve farklı dalga boylarında ek otomobil ölçümleri kullanarak, veya bir geniş bant araba veya benzer uyarılmış Raman yaklaşımı, araştırmacılar lipid damlacıkları içinde yağ asitleri farklı türde karakterize etmek mümkün olduğunu göstermiştir31,32. Ayrıca, CARS görüntü koleksiyonunun hız lipid damlacık büyüme ve toplama33temporal evrim incelemek için canlı hücrelerin in-situ görüntüleme sağladı.

Gelecekteki uygulamalar
Son yıllarda, hücre biyolojisinde lipid damlacıkları rolleri ve fonksiyonları hakkında görüşler gelişti. Daha önce temelde depolama veziküller inert olduğu düşünülmektedir, şimdi son derece dinamik hücresel organelles olarak anlaşılmaktadır, ve hastalığın rolü giderek tanınıyor34,35,36. Karaciğer hastalığı durumunda, lipid birikiminin (steatozis) uzun süre kritik bir yönü olduğu bilinse de, lipid damlacıkları hastalık progresyonunda tutulumun kesin mekanizması tamamen açık değildir. Bu nedenle, lipid damlacıkları dinamik davranışını karakterize eden CARS gibi yöntemler NAFLD dahil olmak üzere hastalıkların moleküler anlayışının geliştirilmesi için kritik öneme sahiptir. QPCR tarafından metabolik gen ifade analizi, önceki çalışmalarda17,18' de gösterildiği gibi, araçlar üzerinden lipidlerin moleküler görüntülemesinde son derece tamamlayıcı olup, hastalık mekanizmalarına daha derin öngörüler sağlar. Bu çalışmada, erken hastalık tanısı için biyo-belirteçlerin bir panelinin inşası için katkı sağlayabilen lipid metabolizması ve inflamatuar Gen ifadesinin deregülasyon ile yağ asidi birikimini gözlemliyoruz.

Sodyum oleat-tedavi dHepaRG hücre tabanlı modeli moleküler mekanizmalar Sadece başlangıçlarda değil, aynı zamanda NAFLD ilerlemesini dahil olmak üzere, hastalığın daha iyi terapötik yaklaşımlar gelişimi için bir temel sağlayan bilgi artırabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar, rakip finansal çıkarların olmadığını beyan ederler.

Acknowledgments

Biz Prof Christian Trepo (ıNEKM U871, Lyon, Fransa), hangi nazik HepaRG hücreleri sağladı teşekkür ederiz. Biz idari yardım için Rita Appodia için minnettarız. Bu çalışma MıUR-Ministero Dell 'istruzione, Dell 'università e della ricerca (FIRB 2011 – 2016 RBAP10XKNC) ve Roma Sapienza Üniversitesi (Prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics