Nedbrytning for å oppnå spesifikk og effektiv protein tømming

Immunology and Infection
 

Summary

Her presenterer vi en protokoll for å effektivt og spesifikt bryter ut et protein av interesse i gjær Saccharomyces cerevisiae ved hjelp av β-EST Aid system.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Anlegget auxin bindende reseptor, TIR1, gjenkjenner proteiner som inneholder en bestemt auxin-induserbart degron (AID) motiv i nærvær av auxin, rettet mot dem for fornedrelse. Dette systemet er utnyttet i mange ikke-plante Landplantenes, slik at et mål protein, merket med AID motivet, er degradert ved auxin tillegg. Nivået av TIR1-uttrykk er kritisk. overdreven uttrykk fører til nedbrytning av AID-Tagged protein selv i fravær av auxin, mens lave uttrykk fører til langsom tømming. En β-østradiol-induserbart AID system ble opprettet, med uttrykk for TIR1 under kontroll av en β-østradiol induserbart promoter. Nivået på TIR1 er tunable ved å endre tidspunktet for inkubasjons med β-østradiol før auxin tillegg. Denne protokollen beskriver hvordan du raskt tømmer et mål protein ved hjelp av AID-systemet. Den aktuelle β-østradiol inkubasjonstid avhenger av overflod av målet protein. Derfor avhenger effektiv tømming av optimal timing som også minimerer auxin-uavhengig tømming.

Introduction

Betingede mutasjoner, som temperaturfølsomme mutanter, er et kraftig verktøy for studiet av essensielle proteiner, slik at cellevekst under ettergivende tilstand, men forårsaker tap av funksjon under ikke-ettergivende forhold. Imidlertid kan celle metabolisme være alvorlig perturbed av endringen i vekstforhold som kreves for å indusere feilen og kan også skape off-Target effekter. Flere metoder er utviklet, der protein av interesse er betinget sequestered1 eller dets uttrykk styres2,3 ved tilsetning av et lite molekyl. Denne protokollen bruker auxin og auxin-induserbart degron (AID) system for effektivt å tømme et mål protein.

The AID systemet har sin opprinnelse i planter, der en auxin (i denne protokollen indol-3-eddiksyre (IAA) brukes), stimulerer samspillet av Aux/IAA protein med TIR1, et medlem av SCF U3 ubiquitin ligase kompleks4. SCF kompleks interaksjon årsaker polyubiquitination av Aux/IAA familie proteiner, som resulterer i deres degradering av proteasomet5,6.

Dette systemet ble tidligere tilpasset for bruk i gjær Saccharomyces cerevisiae ved å uttrykke TIR1 protein fra Oriza sativa (osTIR) i gjærceller, der det er i stand til å samhandle med den endogene gjær SCF-komplekset. Proteinet av interesse ble merket med et motiv fra Aux/IAA protein IAA17 å målrette den for degradering. Funksjonell truncations av IAA17 ble utviklet senere, for eksempel hjelp *8,9,10, som inneholder 43 amino acid auxin-sensitive motiv fra Arabidopsis thaliana IAA17, sammen med en epitope kode for å aktivere Oppdagelsen.

Systemet i utgangspunktet tilpasset for bruk i spirende gjær7,8 uttrykt osTIR1 protein fra en gjær gal promoter. Expression krever skifte til vekstmedium med galaktose som eneste karbon kilde, som, dessverre, resulterer i en diauxic Skift med omfattende endringer i celle metabolisme11. På den annen side har det blitt rapportert at konstituerende uttrykk for TIR1 kan føre til degradering av mål proteinet i fravær av auxin/IAA12 hvis uttrykks nivået er høyt, mens lavt TIR1-uttrykk fører til ineffektiv tømming. En forbedret AID system kalt β-EST AID ble utviklet der osTIR er under kontroll av en induserbart promoter som er tunable for å passe målet protein, med minimal effekt på celle metabolisme. For å oppnå dette, en kunstig transkripsjon faktor (ATF) ble bygget der VP16 viral transkripsjon aktivator er smeltet til en østrogen reseptor og en fire ZN fingre DNA bindende domene (dbd). Når β-østradiol (en østrogen) er til stede, kan ATF gå inn i kjernen og indusere osTIR transkripsjon ved binding til sin promoter (Z4EVpr)13,12.

osTIR uttrykket er vanligvis oppdages ca 20 min etter tilsetning av β-østradiol12. Den optimale varigheten av osTIR-uttrykket for å oppnå effektiv tømming av det kodede proteinet med auxin, og samtidig unngå forringelse før auxin tillegg, må imidlertid empirisk bestemmes for hvert mål protein. En omtrentlig tid for denne pre-inkubasjons kan anslås fra overflod verdier i Saccharomyces Genova database (SGD https://www.yeastgenome.org/). Som kan sees i figur 1, det rike proteinet, Dcp1 (2880 til 4189 molekyler/celle), krever 40 min av pre-inkubasjons med β-østradiol, uten auxin-uavhengig forringelse observert. Den mye mindre rikelig protein, Prp2 (172 til 211 molekyler/celle), er sterkt utarmet etter bare 20 min av pre-inkubasjons. Det er tilrådelig å teste to ekstra inkubasjons ganger, 10 til 20 min før eller etter denne første estimerte tiden (20 min er den minste tiden som anbefales). Den optimale pre-inkubasjonstid er tiden der målet protein har ikke utarmet før du legger auxin og når auxin er lagt til tømming er akseptabelt eller proteinnivåer nærmer minimum mulig. Så, fra figur 1B, for Prp22 med 30 min av pre-inkubasjons, har nivåene ikke falt mye 10 min etter auxin tillegg. Sammenligning av dette med 40 min av pre-inkubasjons og 15 minutter med IAA, der det er lite ekstra forbruk, er det ingen fordel i incubating med auxin lenger enn 10 min eller pre-incubating i mer enn 30 min, særlig ettersom det er bevis for ikke-auxin forringelse ved 40 min. For Dcp1 med 40 min av pre-inkubasjons (det siste punktet hvor protein nivået er ca 100% før auxin tillegg), er 15 til 20 min av tømming med auxin akseptabelt. Det anbefales å holde nedbryting tid så kort som mulig for å redusere sekundære effekter på celle metabolisme14.

Denne artikkelen viser hvordan du bruker β-EST AID system ved å optimalisere tidspunktet for β-østradiol inkubasjons for osTIR uttrykk for å oppnå rask mål protein tømming på IAA tillegg uten slitasje før du legger auxin.

Protocol

Merk: Se figur 2 for et grafisk sammendrag.

1. strekk tilberedning

  1. Ved hjelp av en ura3-stamme, innføre β-EST Aid system (dvs. gener koding β-østradiol forståelsesfull transkripsjon FAKTOR (ATF) og osTIR) og Aid * tag målet protein (se Figur 3 og tabell 1 for en oppsummering av prosedyren).
    1. Transform15 enten PZTRK (G418 motstand markør) eller PZTRL (LEU2 markør) plasmider (tilgjengelig fra gjær genetisk Resource Centre) i ura3- gjær belastning eller bruke plasmider som en mal for å produsere PCR produktet for genomisk Integrering.
    2. PCR forsterke ATF (merket Z4EVATF på plasmider kartet) og osTIR bruker en High Fidelity polymerase fra en av plasmider pZTRK eller pZTRL. Bruk primere med 50 til 60 base 3 ' extensions med homologi til genomisk regionen, til direkte integrasjon med homologe rekombinasjon16. For genomisk integrering av de to komponentene enten separat eller sammen, se tabell 1 for primere og betingelser.
      Merk: Belastningen pZ4EV-NTR1 har komponenter som allerede er integrert i Genova (tilgjengelig fra gjær genetiske Resource Centre, Japan).
    3. Kontroller at mål proteinet er AID * merket med longtine prosedyren17 (se figur 3b og tabell 1).
    4. Utføre en vekst analyse på belastningen uten β-østradiol og IAA stede for å avgjøre om AID * tag påvirker vekst og å forutsi vekstrate for bruk på trinn 1,5.

2. generell prosedyre for tømming

  1. Beregn hvor mye kultur er nødvendig for alle prøvene som skal samles inn; for eksempel, 10 mL kultur på OD600 av 0,8 er tilstrekkelig for PROTEIN, RNA og DNA-ekstraksjon for en enkelt prøve, så for 6 prøver, minst 60 ml kultur er nødvendig.
  2. Fra en overnatting kultur, sette opp nok ny kultur på OD600 0,1 til 0,2 og la til å vokse ved 30 ° c. Et rikt medium som YPDA anbefales, selv om andre vekstforhold kan brukes:
    Gjærekstrakt 10 g
    Peptone 20 g
    Glukose 20 g
    Adenine sulfat 40 mg
    H2O for å 1 den andre

    Merk: Autoklav eller filter sterilisere; filter sterilisering foretrekkes som peptid/sukker komplekser produsert av autoklavering utfelling i metanol som brukes i prøvetaking samling.
  3. Forbered deg på å motta prøvene.
    1. Sett 30 til 50% av det tiltenkte prøvevolumet av metanol i et rør. Hvis for eksempel et 10 mL-utvalg skal tas, må du sette 5 mL metanol i en 15 mL Falk tube og lukke røret tett. Når lukket, etiketten røret og satt på tørr is eller på-80 ° c til chill.
      Forsiktig: Dispensere metanol i en avtrekksvifte.
    2. Label 1,5 mL rør for langtidslagring av prøvene og plass i isen for å avkjøle.
    3. Cool nok H2O (minst 1 ml per prøve) på is.
  4. Forutse kulturen vekst. Målet OD for å samle prøvene er ca 0,7 til 0,8, men pre-inkubasjons trinn (den inkubasjons med β-østradiol for å indusere osTIR), må startes tidligere, slik at kulturen vil nå omtrent rett OD av den tiden prøvene er Samlet.
    Merk: Det er tilrådelig å utføre en vekst kurve i forhold som skal brukes i eksperimentet, slik at denne starter OD kan anslås.
  5. Når målet OD for starten av pre-inkubasjons er nådd, ta en prøve (vanligvis 10 mL), inn i pre-forberedt rør som inneholder kaldt metanol. Inverter kort for å blande og plassere tilbake i tørr is.
    Merk: Prøven kan flyttes til vann isen etter ca 5 min, hvis praktisk å gjøre det.
  6. Umiddelbart tilsett β-østradiol, 1 μL/mL av kultur (siste konsentrasjon på 10 μM); har β-østradiol pre-målt i en pipette klar til bruk for å redusere tiden det tar mellom å samle prøven og legge til β-østradiol. Bland raskt ved å virvlende kraftig.
  7. Fortsett å dyrke kulturen som før (trinn 2,2), ruge (dette er "pre-inkubasjons" trinn) med β-østradiol for optimal tid (for bestemmelse av optimal pre-inkubasjonstid se figur 1).
  8. Forbered å legge til IAA (auxin). Ta opp volumet av IAA nødvendig for trinn 2,10 (dvs. 0,5 μL av IAA per mL kultur). Dette gjør trinn 2,20 raskere.
  9. Samle en prøve som trinn 2,5.
  10. Umiddelbart legge IAA 0,5 μL/mL av kulturen til en endelig konsentrasjon av 750 μM som utarbeidet i trinn 2,8. Bland raskt ved å virvlende kraftig.
  11. Samle prøver, som trinn 2,5, i henhold til din eksperimentelle design. Enten en enkelt prøve, i en tid da det er forventet at proteinet vil bli pålitelig utarmet, eller flere prøver i en tid løpet av nedbryting. For eksempel, 5 min intervaller er praktisk for timing og gi en rekke proteinnivåer. Optimaliseringsstrategien, som vist i figur 1, vil gi en indikasjon på egnede tidspunkter.
  12. Behandle prøvene.
    1. Plasser prøvene på isen, hvis det ikke gjøres allerede. Kontroller at ingen av prøvene har frosset; Hvis de har, forsiktig varme i hånden, invertere konstant slik at temperaturen ikke stiger lokalt.
      Merk: Dette gjøres best i hånden som prøven temperatur kan vurderes, bør det alltid føles kaldt. Plasser på isen. Dette er ikke et pause punkt-når alle prøvene er flytende, går du videre til neste trinn.
    2. Når alle prøvene er samlet inn og ikke lenger er frosset, snurr på 3 500 x g i 2 min (ved 4 ° c hvis mulig).
    3. Hell av metanol/medium mix og plasser tilbake på isen; ikke bekymre deg om ikke all væsken er fjernet.
    4. Resuspend celle pellet i 1 mL iskald H2O (fra trinn 2.3.3) og Overfør til et merket 1,5 ml rør (fremstilt i trinn 2.3.2) på is.
    5. Spin kort (f. eks 10 s total tid) ved > 15000 x g til re-pellet cellene, Legg tilbake på isen og fjerne væsken.
    6. Fjern H2O ved aspirasjon. Celle pellets kan oppbevares ved-20 ° c, eller-80 ° c for langtidslagring.
  13. Kontroller nivået som proteinet er tømt for, ved Western Blot-analyse18.
    Merk: Tilstrekkelig protein19 og/eller nukleinsyre syre kan utvinnes fra en enkelt celle pellet for de fleste formål, selv om sjeldne RNA arter kan kreve mer sample volum.

Representative Results

Representative eksempler på tømming vises i figur 1. De tre eksperimentene som ble presentert i dette tallet var optimaliserings eksperimenter for tømming av proteinene Prp2, Prp22 og Dcp1. Den lave overflod, Spliceosomal Prp2 og Prp22 proteiner både utarmet til mindre enn 20% etter 40 min pre-inkubasjons med β-østradiol etterfulgt av 15 min med auxin. Lengre inkubasjons ganger fører til raskere tømming, men viser også uønsket protein forringelse før auxin tillegg. Til sammenligning ble de mer tallrike Dcp1 bare utarmet til ca. 30% med samme behandling, men 60 min av pre-inkubasjons resulterte i forringelse til 13% med samme auxin behandling, på bekostning av slitasje før auxin tilsettes. Det er mulig at 50 min av pre-inkubasjons med β-østradiol og 15 min med auxin ville ha oppnådd lignende resultater på et kortere tidspunkt, og det ville ha vært mer optimal.

Figure 1
Figur 1: reduksjonen rate kan stilles inn ved modulerende varigheten av β-østradiol pre-inkubasjons. Western Blot18 av målet proteiner: (a og b) Prp22-6FLAG, (c og d) Prp2-Aid *-6FLAG, og (e og f) Dcp1-Aid *-6HA, fra kulturer pre-inkubert med β-østradiol (β-EST) for 20, 30, 40, eller 60 minutter før auxin tillegg12. Like mengder av totalt protein ble lastet i hvert felt. Pgk1 er oppdaget som en visuell lasting kontroll, bortsett fra panel e, der Pgk1 og Dcp1 co-migrere. Kvantifisering av protein bånd i paneler a, c og e er vist i henholdsvis paneler b, dog f . Som et mål på tømming, ble stigningstallet (m) beregnet for den lineære delen (fra 100% til 30% av de opprinnelige verdiene) for hver kurve. Den optimale pre-inkubasjonstid er tiden hvor protein nivåene er fortsatt nær de un-indusert nivåer (100%) og den påfølgende reduksjonen er rask. For Dcp1 (f), 60 min av pre-inkubasjons er for lang, da proteinet har begynt å forringe i fravær av auxin, mens 20 min er for kort, da proteinet ikke merkbart tømmes i denne tiden kurset. Etter 40 min pre-inkubasjons, 15 min med auxin kan brukes som proteinet er ca 70% utarmet og, selv om 20 min ville føre til ytterligere nedbryting, kan det også føre til sekundære effekter. Feilfelt representerer standardavvik for to biologiske replikeres. For hvert eksperiment vises en representativ blott. Dette tallet er avledet fra forrige utgivelse9. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: grafisk sammendrag. Legg β-østradiol til tilstrekkelig kultur vokser i rikt medium og ved ønsket temperatur for å starte pre-inkubasjons. Fortsett veksten for den nødvendige pre-inkubasjonstid før du legger IAA (auxin) for å starte tømming. Tiden for inkubasjons og-tømming er avhengig av at proteinet er utarmet, men inkubasjons er ofte i størrelsesorden 20-60 min, og det er typisk at tiden for tømming er 10 til 20 min. 10 mL prøver skal tas ved starten og slutten av pre-inkubasjons og Durin g tømming. Disse prøvene er raskt fast i kaldt metanol før pelleting og lagring. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: strekk generering for B-EST-systemet. (a) for å generere en gjær STAMME med Aid * systemet, enten PZTRL (LEU2) eller PZTRK (kanamycin (G418) motstand), plasmider bør innføres i belastningen eller, alternativt, ATF og osTIR kan settes inn i Genova ved homologe rekombinasjon av et fragment generert av PCR fra 3 ' end-grunning (se figur 3b og tabell 1). (b) C-terminal merking av mål proteinet oppnås ved PCR forsterkning av den aktuelle regionen i plasmider PURA3-Aid *-6FLAG (pURA3_AID *-6HA skiller seg bare i koden og kan behandles på nøyaktig samme måte), ved hjelp av longtine primere S3-F og S2-R med 3 ' extensions homologe til 3 ' slutten av målet protein. Den fremre primer forlengelse bør inkludere den siste aminosyren Codon i rammen med starten av AID * koden og må ikke inkludere stopp Codon. Den omvendte primer forlengelse bør være til en region nedstrøms av kodingen regionen. Når satt inn i Genova, celler som har mistet URA3 markør (ved homologe rekombinasjon mellom de identiske regionene finnes i begge ender av markøren) kan velges ved vekst med 5-Foa, som teller-velger URA3 celler. Vennligst klikk her for å se en større versjon av dette tallet.

a. primer sekvenser
Målet Plasseringen Primer navn Sekvens TM (° c)
pZTRL 516 F pZTRL_F <-regionen i homologi-> GCGACAGCATCACCGACTTCG 61,23
7897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-regionen homologi (RC)-> 61,30
pZTRK 9154 F pZTRK_F <-regionen i homologi-> ACGTTGAGCCATTAGTATCAATTTGCTTACC 59,40
5897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-regionen homologi (RC)-> 61,30
pURA3-AID *-6FLAG eller pURA3_AID *-6HA F S3-F <-regionen i homologi-> CGTACGCTGCAGGTCGAC 59,21
R S2-R ATCGATGAATTCGAGCTCG <-regionen homologi (RC)-> 52,76
pZRTL/K er å forsterke β-EST AID system
pURA3-AID *-6FLAG/6HA å forsterke hjelp * og epitope tag å merke målet protein (Lontine prosedyre)
<-regionen i homologi-> Region homologe til de flankerer regionene der systemet skal settes inn. Jo lenger denne regionen er mer sannsynlig at endringen er å være vellykket; 50-100 baser anbefales.
<-region av homologi (RC)-> Region homologe til de flankerer regionene hvor systemet skal settes inn, husk å bruke det omvendte komplement. Som ovenfor, jo lenger denne regionen er det bedre.
TM (° c) TM ved hjelp av% GC-metoden med 50 mM NaCl
b. PCR Mix
Komponent Volum (μL)
Mal < 10
NEB Phusion HF buffer (5x) * 100
Forward primer 100 μM 2,5
Omvendt primer 100 μM 2,5
dNTPs 10 mM hver 10
H2O til 500
* NEB Phusion GC buffer (5x) kan også brukes, men er ikke foretrukket
Gjør denne blandingen, delt inn i 10 rør med 50 μL Mix hver og utføre PCR som tabell 1 c.
Sjekk PCR har fungert ved å kjøre på en agarose gel
Kombiner alle vellykkede reaksjoner i ett rør og etanol utløse
Forvandle gjær med alt materialet som produseres av PCR
c. PCR-forhold
Trinn Temp (° c) Tid
Første denaturering 98 30 s
25-35 sykluser Denaturere 98 10 s
Anneal 45 – 60 20 s
Forlengelsen 72 30 s/KB
Endelig utvidelse 72 10 min
Holde 8
Anneal ved 45 ° c for Lontine primer sett (S3-F og S2-R) og 60 ° c for pZTRL/K-primere
Utvid i 3 minutter for Lontine PCR og 3 minutter for pZTRL/K

Tabell 1: primer sekvenser, PCR-mix og PCR-forhold.

Discussion

En godt optimalisert protokoll kan gi rask og effektiv tømming av mål proteinet. Fastsettelse av omtrentlig pre-inkubasjonstid med β-østradiol er viktig, da dette øker reproduserbarhet av tømming, men små variasjoner i pre-inkubasjonstid kan tolereres. På den annen side, må forsiktighet tas med timing etter auxin tillegg, som protein nivået avtar svært raskt.

En fordel med denne tilnærmingen er at innstilt tømming kan oppnås ved varierende kombinasjoner av pre-inkubasjonstid med β-østradiol og IAA inkubasjonstid. For eksempel, hvis ønskelig, kan mål proteinet bli langsommere utladet ved å redusere den inkubasjonstiden.

Β-EST AID systemet tilbyr visse fordeler fremfor systemer der OsTIR er constitutively uttrykt. Hvis for eksempel mål proteinet er avgjørende for levedyktighet, kan regulert uttrykk for osTIR unngå for tidlig tømming av mål proteinet. Videre kan uttrykk for osTIR være innstilt for å passe overflod av målet protein og dens mottakelighet for fornedrelse, og nedbryting kan være enten rask eller langsom. De to små molekylet effekt Orer, β-østradiol og auxin, ikke forurolige gjær metabolismen under de forholdene som brukes her, i motsetning Rapamycin, som brukes i ankeret-Away system1.

Det bør bemerkes at merking noen proteiner forstyrrer deres funksjon, som er et problem med noen målrettede nedbryting system. I dette tilfellet kan en N-Terminal kode fungere når en C-terminal-kode ikke. Dessuten vil ikke alle proteiner bli utarmet effektivt; for eksempel kan AID-tag på målet protein være utilgjengelig for osTIR protein. Derfor, etter AID-merking, bør hvert mål protein testes for enhver effekt av koden på vekst, og for å avgjøre om reduksjonen er effektiv, før tidsberegningen av β-østradiol pre-inkubasjons og auxin behandling er optimalisert.

Dette AID * systemet er svært enkel og er kompatibel med eventuelle etterfølgende eksperimentell prosedyre som ikke involverer videre vekst, slik som protein, DNA eller RNA analyse eller mikroskopi. I tillegg fungerer systemet godt når det kombineres med thiolabelling for å rense begynnende RNA20.

Dette systemet gir en rask, spesifikk og reproduserbar måte å tappe et protein uten å påvirke metabolismen av gjær cellen.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Takk til Jane Reid for initiering av dette programmet, Barbara Terlouw for utvikling, Vahid Aslanzadeh for "ura looper" konstruerer og Susana de Lucas for mange nyttige diskusjoner. Dette arbeidet ble støttet av et stipend til GIMO fra Consejo Nacional de Ciencia y Tecnología, Mexico (CONACYT) og University of Edinburgh School of Biological Sciences, en Wellcome PhD studentship til IEM [105256] og ved Wellcome finansiering [104648] til JD Beggs . Arbeid i Wellcome senter for Cell Biology er støttet av Wellcome kjerne finansiering [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics