Author Produced

장거리 역PCR에 의한 핫 LINE-1의 역변도 활성 감지

Cancer Research
 

Summary

이 문서는 활성 LINE-1 레트로트랜스포종의 활성을 모니터링하고 주어진 게놈에서 드 노보 역변도를 매핑하는 간단한 PCR 기반 분석방법을 간략하게 설명합니다. MCF7 세포주를 사용하여, 우리는 이 방법을 22q12.1에 위치한 LINE-1의 활성을 검출하기 위해 어떻게 적용될 수 있는지를 본원에서 입증한다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

긴 산재 핵 원소 1 (LINE-1s)는 자율적으로 이동할 수있는 인간 게놈의 모바일 유전 요소의 유일한 가족입니다. 그(것)들은 그 때 역 전사에 의해 게놈으로 그 때 삽입되는 mRNA 중간체를 형성하기 위하여 전사하는 것을 특징으로 하는 retrotransposition에게 불린 프로세스에 의해 이렇게 합니다. 정상 세포에서 침묵에도 불구하고 LINE-1s는 상피 종양에서 매우 활동적입니다. 드 노보 LINE-1 삽입은 잠재적으로 종양 발생을 유발할 수 있으므로 암에서 LINE-1 역변증을 체계적으로 연구하는 것이 중요합니다. 인간 게놈에 존재하는 ~150개의 역류 유능한 LINE-1s 중, "핫" LINE-1이라고도 불리는 소수의 LINE-1 좌위만이 다른 암 유형에서 드노보 LINE-1 삽입의 대부분을 차지합니다. 우리는 이러한 뜨거운 LINE-1s의 역변도 활성을 모니터링하는 간단한 중합효소 연쇄 반응 (PCR) 기반 방법을 개발했습니다. 장거리 역(LDI)-PCR을 기반으로 하는 이 방법은 LINE-1이 측면 비반복 영역을 동원하여 이후에 de novo LINE-1 3' transduction 이벤트를 식별하는 데 사용할 수 있는 메커니즘인 3' 변환을 활용합니다. 특정 핫 LINE-1에서 유래.

Introduction

긴 산재 핵 요소 (LINE-1s)는 독립적으로 레트로 트랜스 포지션이라는 복사 및 붙여 넣기 메커니즘을 통해 한 장소에서 다른 곳으로 이동할 수있는 retrotransposons라는 모바일 유전 요소의 가족입니다. 진화적 시간이 지남에 따라 인간 게놈은 LINE-1 반복1의500,000 개 이상의 사본을 축적했습니다. 그러나, 게놈에 존재하는 LINE-1 사본의 대부분은 돌연변이되고 그러므로 retrotransposition를 통해 이동할 수 없습니다; 만 ~ 150 사본은그들이2를 이동하는 데 필요한 DNA 서열의 그대로 사본을 가지고 . 정상 체세포에서, 이들 LINE-1s의 이동성은 상이한 숙주 인자3에의해 제한된다. 이러한 제한은 상피 종양에서 완화되어 LINE-1s가 억압되고 종양 게놈 4에 많은 de novo 삽입을 초래합니다. 이들 종양 관련 드노보 삽입중 일부는 유전자에 삽입 돌연변이발생을 유발하는 것으로 나타났으며, 따라서 종양 진행을 5,6으로유도한다. 따라서 종양 게놈에 새로운 삽입을 매핑할 수 있어야 합니다.

de novo LINE-1 삽입을 검출하는 기존 방법은 (1) 전체게놈 시퀀싱 접근 법 4,7,8,여기서 다른 계산 알고리즘이 de novo LINE-1 삽입을 찾는 데 사용됩니다. WGS 데이터에서, 또는 (2) 젊고 잠재적으로 활동적인 LINE-1s9,10,11,12,13의3' 끝을 대상으로 하는 차세대 시퀀싱. 그러나, 이 방법을 가진 수천 거의 동일 사본 중 새로운 삽입을 찾아내는 것은 사소한에서 멀리, 및 도전은 LINE-1 삽입4와 관련되었던종양 이질성 및 게놈 변경에 의해 더욱 가중됩니다.

이러한 기존 방법을 이용한 연구는 단지 몇 개의 LINE-1이 종양7,8에서관찰된 데노보 LINE-1 삽입의 대부분을 차지한다는 것을 보여주었다. 따라서, 특정 종양 샘플이 LINE-1 활성을 표시하는지 여부에 대한 대답을 하기 위해, 이러한 고활성 LINE-1 좌위소수에 의한 역변좌 이벤트를 매핑하는 것으로 충분하다. 본 기사에서는, 대장암에서 매우 활동적인 22q12.1에서 TTC28 유전자의 제1인트론에서 특정 LINE-1 궤적의 활성을 모니터링하는데 사용될 수 있는 간단한 중합효소 연쇄 반응(PCR) 기반 방법14를 설명합니다. 7명 , 8. 이 LINE-1 궤적은 기사 전반에 걸쳐 TTC28-LINE-1로 지칭됩니다. 이 분석은 특히 3' transduction15라는메커니즘에 의해 소스 LINE-1의 3' 측면 영역에서 비반복 시퀀스를 동원하는 de novo LINE-1 역류 이벤트를 식별합니다. 3' 전이는 약한 LINE-1 폴리아데닐화 신호(PAS)로 인해 발생하며, 이로 인해 전사 기계가 이를 건너뛰고 대신 더 강한 PAS 다운스트림에서 전사를 종료하여 측면 비반복 시퀀스를 캡처합니다. 이제부터는 LINE-1 시퀀스와 함께 대상 위치에 삽입되는 "고유 태그"라고 합니다. Philippe 등 16은 최근 상이한 세포 유형이 상이한 LINE-1 로시를 발현할 수 있음을 보여주었다. 이러한 발견에 비추어, 이 방법은 관심있는 암 유형에서 그들의 독특한 태그를 동원하는 가장 고도로 발현된 LINE-1의 활성을 모니터링하기 위해 적용될 수 있다.

LDI-PCR의 제1 단계는 분석되는 LINE-1을 포함하는 제한 단편을 생성하는 제한 효소를 가진 게놈 DNA의 소화(여기, TTC28-LINE-1) 및 그의 독특한 태그(도 1)이다. 소화된 DNA는 독특한 태그 내에 위치한 역 프라이머를 사용하여 자기 결찰 및 PCR 증폭에 의해 원형화됩니다. 이렇게 함으로써, 그것의 "네이티브" 위치에서 전체 길이 소스 LINE-1은 항상 증폭되고 그와 함께, 독특한 태그를 포함하는 다른 표적 좌시에 자손 LINE-1 삽입은 또한 증폭될 것입니다 (그림1),따라서 보고 LINE-1의 역변 활동.

Protocol

이 연구는 헬싱키 대학 병원의 기관 검토 위원회 및 윤리위원회에 의해 승인되었습니다. 서명된 통보된 동의는 이 프로토콜을 입증하기 위해 사용되는 혈액 샘플에 대한 피험자로부터 획득되었다.

1. 역프라이머 설계 및 제한 효소 선택(생물정보학)

  1. LINE-1 관련 고유 태그 결정
    1. L1Base17과같은 LINE-1 데이터베이스에서 FASTA 형식으로 TTC28-LINE-1 시퀀스를 다운로드합니다. TTC28-LINE-1의 L1base ID는 135입니다.
    2. LINE-1 시퀀스의 5́ 및 3́ 끝면에 5kb 시퀀스를 포함하고 워드 프로세서에 추가합니다.
      참고: 여기서 LINE-1 측면 시퀀스는 갈색 글꼴로 추가되고 LINE-1 시퀀스는 회색 글꼴(보조 파일)으로 표시됩니다.
    3. 선택한 LINE-1의 코그네이트 PAS의 1kb 시퀀스 다운스트림을 폴리아드q18 또는 드래곤 폴리아 스포터(19)와 같은 PAS 예측 도구에 입력하고 이 1kb 창에서 모든 폴리아데닐화 신호에 추가합니다.
      참고: 1kb 창에 PAS가 없는 경우 다음 1kb 창 다운스트림에서 PAS를 검색합니다. TTC28-LINE-1의 약한 PAS는 분홍색으로 강조 표시되고 1kb 창 다운스트림의다른 모든 PAS는 빨간색 (보충 파일)으로 강조 표시됩니다.
    4. LINE-1의 동축 PAS 끝과 가장 강력한 PAS 다운스트림 사이의 시퀀스를 "고유 태그"로 추가합니다.
      참고 : TTC28-LINE-1의 "고유 태그"는노란색 (추가 파일)으로 강조 표시됩니다.
  2. 역 프라이머 설계
    1. "고유한 태그" 시퀀스를 프라이머 3(http://bioinfo.ut.ee/primer3-0.4.0/) 또는 NCBI의 프라이머-BLAST(https://www.ncbi.nlm.nih.gov/tools/primer-blast/)와 같은 웹 기반 프라이머 설계 도구에 입력하여 역 PCR 프라이머를 설계합니다. 이러한 도구에 의해 설계된 프라이머 쌍은 기존의 PCR을 용이하게 서로 마주 하기 때문에, 역 PCR을 수행하기 위해 프라이머 쌍에 대한 역 보수 기능을 사용합니다.
      참고 : LINE-1 변환은 5́ 끝에서 크게 잘리고 변환 된 영역의 크기는 매우 가변적이기 때문에 NCBI 프라이머 -BLAST의 "PCR 제품 길이"매개 변수를 설정하여 두 역 프라이머 사이의 거리를 최소화하는 것을 목표로합니다. 최소. 고유 태그 내에서 여러 PAS의 경우 다른 PAS에 해당하는 여러 프라이머 쌍을 디자인합니다. LINE-1 삽입이 RNA 중간기의 3́end에서 시작되고 5́ 끝이 가변적으로 잘리기 때문에 PAS에 가까운 디자인 프라이머. 여기에 세 프라이머 쌍은 TTC28 LINE-1 (보충 파일)의 고유 태그에 세 가지 강력한 폴리 아데닐레이션 신호에 대응, 청록색과 녹색으로 강조, 설계되었다.
  3. 제한 효소 선택
    1. 제한 매퍼와 같은 웹 기반 도구를 사용하여 실리코에서 5 kb 업스트림 및 다운 스트림 측면과 함께 LINE-1 시퀀스를 소화합니다. 이것은 다른 제한 단편을 생성하는 이 지구를 소화하는 제한 효소의 포괄적인 목록을 줄 것입니다.
    2. LINE-1의 기본 궤적을 자르는 제한 효소를 선택하십시오: 5́ 말, LINE-1 의 5́end 또는 LINE-1 자체의 5́end 의 상류, 그리고 LINE-1의 고유한 태그의 다운스트림3́엔드에서.
      참고 : 선택된 제한 효소는 DNA 메틸화에 민감하지 않아야하며 열이 없어야하며 서로 보완되는 엇갈린 "끈적 끈적한"끝을 생성해야합니다. LDI-PCR을 입증하기 위해, GAGCTC 사이트에서 DNA를 절단하는 SacI 제한 효소가 연한 녹색으로 강조되어 사용된다(보충 파일).
    3. 선택한 제한 효소에 의해 만들어진 제한 조각 크기를 기록해 둡자. 이는 PCR에 의해 효율적으로 증폭되지 않을 수 있으므로 12kb를 초과해서는 안 됩니다.

2. 장거리 역 PCR을 위한 원형 DNA 템플릿 만들기

  1. DNA 추출 및 품질 평가
    1. 제조업체의 지침에 따라 LDI-PCR에 필요한 양질의 고분자량 DNA를 추출할 수 있는 시판 되는 DNA 추출 키트를 사용하여 시판되는 DNA 추출 키트를 사용하여 샘플(종양 또는 혈액)에서 게놈 DNA를 추출합니다. 양자택일로, 높은 분자량 DNA는 또한 페놀에 의해 추출될 수 있습니다: 클로로포름20.
    2. 제조업체의 지침에 따라 형광계를 사용하여 DNA 농도를 측정하고, 1x 트리스-아세테이트-EDTA(TAE) 버퍼에서 에티듐 브로마이드(0.5 μg/mL)를 함유한 아가로즈 젤을 1%(w/v)에 100ng의 DNA를 실행하여 λ-HindIII와 함께 4.5V/cm21버퍼에서 실행합니다. DNA 분자량 마커는 DNA 질 및 양을 검사합니다.
  2. 게놈 DNA 소화
    1. 0.2 mL PCR 튜브에 20 단위 SacI 제한 효소, 5 μL의 10x반응 버퍼 (재료 표), DNA 100 ng (최대 44 μL)를 얼음에 첨가하여 소화 반응 믹스 (최종 부피 50 μL)를 얼음에 (대부분의 제조업체에서 제한 효소의 1 μL) i 100 ng의 게놈 DNA를 완전히 소화하기에 충분합니다). 튜브를 가볍게 두드리고 원심 분리기를 짧게 섞는다.
    2. 열 사이클러를 사용하여 반응 혼합물을 37°C에서 1시간 동안 인큐베이션한 다음 65°C에서 5분 동안 열 불활성화를 합니다.
  3. 소화된 게놈 DNA를 자가 결찰
    1. 50 μL 소화 믹스(2.2.2단계 후)에 10x T4 DNA 리가제 완충액 8 μL, T4 DNA 리가제 1μL(5유닛), 초순수 21μL을 첨가하여 최종 반응량을 80 μL로 만듭니다. , 그리고 원심 분리기 짧게.
    2. 22°C에서 10분 동안 열 사이클러로 인큐베이션하고, 10분 동안 65°C에서 열 불활성화 단계로 종료한다.

3. 장거리 역 PCR

  1. 그라데이션 PCR에 의한 프라이머 어닐링 온도 결정
    1. (A-4) °C, (A-2)C, A,(A+2)C, (A+2)C, (A+4) °C의 어닐링 온도 구배를 설정하여 A가 상용 공급업체의 웹 기반 도구를 사용하여 계산된 프라이머 쌍의 이론적 어닐링 온도입니다.
      참고: 일부 제조업체의 열 사이클러에서는 온도 그라데이션을 수동으로 설정하지 못할 수 있습니다. 이 경우, 자동 그라데이션 설정은 (A-4) °C ~(A+4) °C의 온도 범위와 함께 사용될 수 있다.
    2. 1.5mL 마이크로원지 튜브에 다음 성분을 결합하고 혼합하여 PCR용 마스터 믹스를 준비합니다: 5x 반응 버퍼 의 4 μL, 10mM dNTP의 0.4 μL, 5 μL 의 2 μM PCR 프라이머(1.3.1단계에서 설계) , 반응당 DNA 폴리머라제의 0.2 μL (0.1 U). 그라데이션의 각 어닐링 온도에 대해 하나의 반응을 설정합니다.
    3. 각 반응에 대해, 마스터 믹스의 aliquot 19 μL을 0.2 mL PCR 튜브에 넣고 섹션 2에서 만든 원형 DNA 템플릿의 1 μL(1.25 ng)을 추가합니다.
      참고: 이 최적화 단계에 잠재적으로 귀중한 종양 DNA를 소모하지 않도록 정상적인 혈액 DNA에서 생성된 원형 자가 결찰 DNA를 템플릿으로 사용합니다.
    4. 아래에 설명된 바와 같이 열 사이클러상에서 그라데이션 PCR 프로그램을 실행: (i) 98°C에서 3분의 1 사이클(denaturation); (ii) 35 사이클 (98 °C에서 10 s [변성], [A-4]에서 [A+4] °C [Annealing] 및 1-6 분 [예상 PCR 제품의 킬로베이스 당 30 s]의 온도 구배에서 20 s [확장]; (iii) 72°C에서 10분 의 1주기(최종 연장).
    5. 4.5 V/cm에서 1x TAE 버퍼로 제조된 1% 아가로즈 겔21에서 PCR 제품의 6 μL을 실행하고 상이한 어닐링 온도에서 산출된 PCR 제품을 분석하였다.
    6. 예상 크기에 해당하는 PCR 제품을 생성하는 어닐링 온도를 선택합니다.
  2. 종양 게놈에서 드노보 LINE-1 역변조 활성 검출
    1. 종양 샘플에서 생성된 원형 DNA 템플릿에 역 PCR 프라이머 쌍을 사용하여 LDI-PCR을 수행합니다(섹션 2). 그라데이션 PCR(섹션 3.1)과 동일한 지침을 따르지만 이번에는 온도 그라데이션을 최적의 어닐링 온도로 대체합니다.
    2. 3.1.5단계에서 수행된 아가로즈 겔 전기동공에 의한 PCR 제품을 분석한다. 그것의 네이티브 궤적에서 LINE-1에 대응하는 공지된 크기 또는 "네이티브" PCR 제품의 PCR 제품은 각 반응에 대해 볼 수 있어야 한다. 드 노보 분석된 종양 샘플에서 LINE-1 3'형질전환은 아가로즈 겔의 기본 PCR 생성물과 함께 다양한 크기의 PCR 제품으로 검출될 수 있다.

4. LINE-1 3' 변환 대상 사이트의 ID를 밝히기 위해 LDI-PCR 제품을 시퀀싱

  1. 각 LDI-PCR 반응에서 생성된 모든 PCR 앰플리코의 단일 분자 긴 읽기 시퀀싱을 수행하여 이러한 LINE-1 3' 트랜스덕션 이벤트의 표적 통합 부위를 식별합니다.
    참고: LDI-PCR 제품의 복제 및 Sanger 시퀀싱도 번거롭기는 하지만 가능한 접근 방식입니다.
  2. 표준 서열 정렬 파이프라인을 사용하여 단일 분자 긴 읽기 시퀀싱 플랫폼에 의해 생성된 판독을 기준 게놈에 정렬합니다. LDI-PCR 소프트웨어14를 사용하여 정렬된 판독을 분석하여 de novo LINE-1 삽입 및 대상 사이트를 식별합니다.

Representative Results

TTC28-LINE-1의 경우, 동조 PAS의 1kb 윈도우 다운스트림 내에 하나 이상의 PAS가 존재하므로 TTC28-LINE-1PAS와 811 bp 다운스트림에서 가장 강한 PAS 사이의 영역은 TTC28-LINE-1에대한 고유 태그로 간주되었다. 3개의 역 PCR 프라이머 쌍은 현재14개의상이한 PAS에 대응하는 이 독특한 태그로 설계되었다. 우리는 세 가지 제한 효소를 선택: (i) TTC28-LINE-1의 5' 상류를 잘라 Nsi와 3 독특한 태그 외부, 그리고 (ii) SacI 및 (iii) PstI 그 잘라 5 ́ 라인-1 내에서 그것의 먼 5' 끝에, 그리고 3' 고유 태그 외부. 이들은 각각 10,288 bp, 5,699 bp 및 6,305 bp의 제한 조각을 생성합니다.

이 방법을 입증하기 위해, 우리는 MCF7 세포주에서 추출된 DNA에 대한 LDI-PCR을 수행하였다. 이러한 유방암 세포주들은 TTC28-LINE-1 활성16을표시하기 위해 이전에 보고되었다. 간단히 하기 위해, 우리는 하나의 제한 효소를 사용하여 원형 DNA 템플릿을 만든, SacI, 3 중 하나 와 TTC28에서유래 드 노보 LINE-1 삽입을 검출하기 위해 3 중 하나의 프라이머 쌍을 사용하여 LDI-PCR을 수행 (표1)- 라인 1.

MCF7 세포주로부터 추출된 DNA의 양호한 품질은 아가로즈 겔전기동동에 의해 보장되었다(그림 2). 그대로 고분자량 DNA는 게놈 DNA가 이 분석에게 최적의 품질임을 보여줍니다. 얼룩이 대신 보이는 경우에, 이것은 차례로 하류 절차를 방해할 추출한 DNA의 나쁜 질을 표시합니다.

3은 TTC28-LINE-1 역프라이머 쌍의 최적 어닐링 온도를 결정하기 위한 그라데이션 PCR 실험의 대표적인 결과를 나타낸다. SacI로 소화된 혈액 게놈 DNA를, 원형 DNA 템플릿을 형성하기 위한 자가 결찰에 이어, 이러한 반응을 위해 사용되었다. 62, 64 및 66°C에서 예상 크기(5,649 bp)의 매우 구체적인 PCR 제품은 이 프라이머 쌍에 대한 최적의 어닐링 온도가 62-66°C 범위 내에 있음을 보여줍니다.

우리는 MCF7 게놈 DNA를 SacI 제한 효소로 소화하고 자가 결찰을 이어서 원형 DNA 템플릿을 생성했습니다. 그림 4는 TTC28-LINE-13́ 트랜스덕션이 MCF7 세포주에서 발생함을 보여줍니다: de novo 삽입은 알려진 크기(5,649 bp)의 기본 PCR 제품과 함께 다양한 크기의 LDI-PCR 제품으로 검출될 수 있습니다. de novo 표적 부위의 게놈 좌표를 식별하기 위해, PCR 앰플리온은 시퀀싱될 수 있다(프로토콜 섹션 4 참조).

Figure 1
그림 1 : LINE-1 3' 트랜스덕션을 감지하는 LDI-PCR 개요. 원형 DNA 템플릿은 제1 소화(I)에 의해 생성되는 제한 효소 및 자가 결찰(II)을 가진다. 이 단계는 관심의 LINE-1의 고유 태그를 대상으로 역 PCR 프라이머와 역 PCR (III)에 이어 (LINE-1의 자신의 약한 PAS 사이의 시퀀스, 분홍색, 강한 PAS 다운스트림, 빨간색). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2 : 추출된 DNA의 품질 평가. 대조군 샘플로서 사용될 MCF7 세포주 및 혈액으로부터 추출된 DNA의 100 ng는 M으로 표기된 1 μL 및 2 μL의 λ DNA/HindIII 마커와 함께 실행되었다.

Figure 3
그림 3 : 역 PCR 프라이머에 대한 최적의 어닐링 온도를 결정하는 그라데이션 PCR (표 1). 56~66°C 범위의 어닐링 온도에서 역 프라이머 쌍을 사용하는 LDI-PCR은 62-66°C에서 뚜렷한 PCR 생성을 나타낸다. 녹색 화살표는 향후 실험에 대해 선택한 어닐링 온도를 나타냅니다. 정상 개인으로부터 혈액 게놈 DNA를 소화하여 생성된 원형 DNA 템플릿을 낭과 함께 자가 결찰을 이어서 이러한 최적화 단계에 사용했습니다. M, 마커 (1 kb 플러스 DNA 사다리). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4 : LDI-PCR을 통해 LINE-1 3' 트랜스덕션을 식별합니다. TTC28 - 라인 1. MCF7 및 혈액(정상 개인으로부터) 게놈 DNA를 낭과 함께 소화시킴으로써 생성된 원형 DNA 템플릿을 최적 어닐링 온도에서 역 프라이머에 의해 증폭시켰다. 예상 크기(5,649bp)의 별표로 표시된 "네이티브" PCR 제품은 MCF7 DNA와 정상 혈액 DNA 모두에서 검출되었으며, MCF7은 다양한 크기의 추가 PCR 제품을 생산하여 de novo LINE-1 역류를 나타냅니다. M, 마커 (1 kb DNA 사다리). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

프라이머 이름 시퀀스 (5] → 3 ́)
L1_001 (회전) TTCACTAAGCATGTGTGTGTGGAAAc
L1_002 (fwd) CCCAAATATATATATACTGGCA

표 1: 독특한 태그를 위해 설계된 역 PCR 프라이머 쌍 TTC28 -라인 1 14세 .

추가 파일. 이 파일을 다운로드하려면 여기를 클릭하십시오.

Discussion

여기서는 관심 있는 활성 LINE-1에서 비롯된 de novo LINE-1 삽입을 식별하는 데 사용할 수 있는 방법을 설명합니다. 우리는 22q12.1에 위치한 고활성 LINE-1에 대해 이 방법을 최적화했으며, 이전에 는 대장암14에서서브 클론 삽입을 검출하는 데 매우 민감하다는 것을 입증했습니다.

LDI-PCR의 성공은 게놈 DNA의 질에 달려 있습니다. 따라서, 프로토콜의 시작 시, 고분자 DNA가 존재하도록 보장하기 위한 추가적인 품질 관리 단계를 포함하였다(단계 2.1.2). 장기 보관을 위해 유전체 DNA를 -20°C에 저장하고 동결 및 해동 주기를 피하기 위해 알리쿼트(aliquots)를 준비하는 것이 좋습니다. 혈액 또는 환자 일치 정상 조직에서 게놈 DNA를 사용하여 검출 된 LINE-1 역류가 생식선 인지 체세포 이벤트인지 여부를 구별하는 것이 좋습니다. 제한 효소에 대한 절단 부위는 게놈에서 스토크되기 때문에, 특정 드노보 LINE-1 삽입 부위는 그 부근에서 사용되는 제한 효소에 대한 절단 부위를 수용하지 않을 수 있다. 따라서 종양 DNA에 있는 de novo LINE-1 삽입의 대다수를 검출의 가능성을 증가시키기 위하여는, 하나 이상의 제한 효소는 원형 DNA 템플릿의 다른 라이브러리를 생성하기 위하여 별도의 반응에서 이용되어야 합니다. 또한 관심 있는 LINE-1의 고유한 태그에 둘 이상의 PAS가 있는 경우 각 PAS에 인접한 프라이머 쌍을 사용하면 심하게 잘린 변환을 감지할 가능성이 높아진다.

de novo LINE-1 삽입의 게놈 전체 검출을 위한 우아한 방법이 존재하지만, 특정 세포 맥락에서 특정 LINE-1의 역변술 능력을 조사하는 것이 목표라면 압도적일 수 있습니다. 이를 위해 LDI-PCR은 LINE-1 역변좌 이벤트를 시각화하는 저렴하고 간단하면서도 강력한 접근 방식이 될 수 있습니다. 이 메서드에 사용되는 타겟팅 방법은 TS-ATLAS22와유사합니다. 그러나 LDI-PCR은 링커 올리고뉴클레오티드를 사용하지 않으며 5'와 3' 드노보 LINE-1 삽입의 접합부를 동시에 증폭시킬 수 있습니다. LINE-1 삽입의 5단 및 3개의 접합부, 통합, 폴리아 테일 및 표적 부위 수정의 대상 부위에 대한 정보는 모두 LINE-1 역류의 특징이며, LDI-PCR을 단일 분자와 결합하여 얻을 수 있습니다. 긴 시퀀싱 기술. 이렇게 생성된 긴 읽기에는 삽입된 LINE-1 시퀀스, 고유한 태그 및 대상 시퀀스가 하나의 읽기로 포함되며, 반복 영역에서 짧은 읽기매핑의 어려움을 우회합니다.

LINE-1 활성을 감지하기 위해 LDI-PCR을 사용하는 데는 두 가지 주요 제한 사항이 있습니다. 첫 번째는 PCR에 내재되어 있습니다: 최대 10kb 크기의 조각만 안정적으로 증폭할 수 있습니다. 이것은 네이티브 단편이 이 한계를 초과해서는 안 되기 때문에 제한 효소(들)를 선택하는 동안 고려되어야 합니다. 둘째, 이 방법은 LINE-1의 3' 측면 영역을 3' 변환으로 동원하는 역변처리 이벤트만 감지할 수 있습니다. 따라서 3' 변환을 나타내지 않는 LINE-1의 활동은 이 방법을 사용하여 감지되지 않습니다. 또한, LDI-PCR에 의해 증폭되음에도 불구하고, (a) "네이티브" 위치 또는 다른 후퇴와 유사한 크기의 PCR 표적을 생성하는 일부 LINE-1 역류 이벤트는 희귀하거나 서브클로날링, 아가로즈 겔에 의해 검출되지 않을 수 있다. 전기. 이러한 LINE-1 역변기 이벤트는 단일 분자를 사용하여 LDI-PCR 제품을 시퀀싱하여 포획할수 있다 14.

여기서 설명된 워크플로우는 적절한 제한 효소를 사용하고 이러한 LINE-1을 대상으로 하는 역 프라이머를 설계하여 다른 "핫" LINE-1의 활성을 검출하기 위해 쉽게 수정할 수 있습니다. LINE-1 매개 3' 변환의 검출 이외에, 이 방법은 덜 빈번한 LINE-1 매개 5' 환원23을검출하도록 조정될 수 있다. 유사한 방법은 세포기반 검문24및 암(25)에서 의한 프로바이러스 통합 부위에서LINE-1 리포터의 통합 부위를 식별하기 위해 사용되어 왔다. LINE-1 삽입 외에도, 이 방법은 또한 재배열되기 쉬운 영역(26)에 관한 정보가 존재하는 DNA 재배열과 같은 다른게놈 수차를 검출하는데 활용될 수 있다.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

우리는이 방법이 처음 설명 된 문서에서 우리의 모든 공동 저자에게 감사드립니다14,특히 타티아나 카주소, 김모 팔린, Outi 킬피바라와 에사 Pitkänen 방법을 개발하는 동안 가치있는 토론을 위해. L.K.는 핀란드 아카데미(교부금 번호 25996, 292789, 306026 및 314394), 시그리드 주셀리우스 재단, 핀란드 암 학회가 후원합니다. B.P.는 헬싱키 연구 재단 박사 과정 학생, 핀란드 암 학회 논문 교부금, 그리고 이다 몬틴 Säätiö의 박사 연구 보조금의 수혜자입니다. 또한 비디오 제작을 지원해 준 La.K.의 연구 그룹에서 티무 마살린(헬싱키 대학교)과 쿨 슈레스타(Kul Shrestha)에게 감사드립니다.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics