Author Produced

Erkennung der Retrotranspositionsaktivität von Hot LINE-1s durch inverse Langstrecken-PCR

Cancer Research
 

Summary

Dieser Artikel beschreibt einen einfachen PCR-basierten Assay, um die Aktivität eines aktiven LINE-1-Retrotransposons zu überwachen und de novo Retrotranspositionen in einem bestimmten Genom abzubilden. Anhand der MCF7-Zelllinie zeigen wir hierin, wie diese Methode angewendet werden kann, um die Aktivität einer LINE-1 zu erkennen, die sich bei 22q12.1 befindet.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lange durchsetzte Kernelemente 1 (LINE-1s) sind die einzige Familie mobiler genetischer Elemente im menschlichen Genom, die sich autonom bewegen können. Sie tun dies durch einen Prozess namens Retrotransposition, bei dem sie zu einem mRNA-Zwischenprodukt transkribieren, das dann durch umgekehrte Transkription in das Genom eingeführt wird. Obwohl LINE-1in normalen Zellen still ist, sind sie bei verschiedenen Epitheltumoren sehr aktiv. De novo LINE-1-Einfügungen können potenziell die Tumorgenese antreiben, und daher ist es wichtig, die LINE-1-Retrotranstion bei Krebs systematisch zu untersuchen. Von den 150 retrotranspositionskompetenten LINE-1, die im menschlichen Genom vorhanden sind, ist nur eine Handvoll LINE-1-Loci, auch als "heiße" LINE-1s bezeichnet, für den Großteil der de novo LINE-1-Einfügung in verschiedene Krebsarten verantwortlich. Wir haben eine einfache, auf Polymerase-Kettenreaktion (PCR) basierende Methode entwickelt, um die Retrotranspositionsaktivität dieser heißen LINE-1zuüberwachen. Diese Methode, basierend auf der Invers-PCR (LDI)-PCR, nutzt die 3-"Transduktion", einen Mechanismus, mit dem eine LINE-1 ihren flankierenden, nicht repetitiven Bereich mobilisiert, der anschließend zur Identifizierung von de novo LINE-1 3-Transduktionsereignissen verwendet werden kann. aus einer bestimmten heißen LINE-1.

Introduction

Long interspersed nuclear elements (LINE-1s) sind eine Familie mobiler genetischer Elemente, die Retrotransposons genannt werden und sich unabhängig von einem Ort zum anderen bewegen können, über einen Kopier- und Pastenmechanismus namens Retrotransposition. Im Laufe der Evolutionszeit hat das menschliche Genom mehr als 500.000 Kopien von LINE-1-Wiederholungen1angesammelt. Die meisten der im Genom vorhandenen LINE-1-Kopien sind jedoch mutiert und können sich daher nicht über retrotransposition bewegen; nur 150 Kopien haben intakte Kopie der DNA-Sequenz notwendig, damit sie2bewegen. In normalen somatischen Zellen wird die Beweglichkeit dieser LINE-1 durch verschiedene Wirtsfaktoren eingeschränkt3. Diese Einschränkungen werden bei verschiedenen Epitheltumoren gelindert, was dazu führt, dass LINE-1sausgegrenzt werden und viele De-Novo-Einfügungen in das Tumorgenom 4 führen. Einige dieser tumorassoziiertenDe-Novo-Einfügungen haben gezeigt, dass insertionale Mutagenese in Dengenen verursacht wird, was die Tumorprogression 5,6antreibt. Daher ist es wichtig, neuartige Einfügungen im Tumorgenom abbilden zu können.

Vorhandene Methoden zum Erkennen von de novo LINE-1-Einfügungen verwenden (1) Ganzgenom-Sequenzierungsansatz4,7,8, wo verschiedene Rechenalgorithmen verwendet werden, um de novo LINE-1-Einfügungen zu finden aus WGS-Daten oder (2) Sequenzierung der nächsten Generation, die auf das 3-Ende der jungen, potenziell aktiven LINE-1s9,10,11,12,13abzielt. Die Suche nach neuartigen Einfügungen unter mehreren tausend nahezu identischen Kopien mit diesen Methoden ist jedoch alles andere als trivial, und die Herausforderung wird durch Tumorheterogenität und genomische Veränderungen im Zusammenhang mit LINE-1-Einfügung4noch verschärft.

Studien mit diesen bestehenden Methoden zeigten, dass nur wenige LINE-1s die Mehrheit der de novo LINE-1-Einfügungen ausmachen, die bei Tumoren 7,8beobachtet wurden. Um zu beantworten, ob eine bestimmte Tumorprobe die LINE-1-Aktivität anzeigt, genügt es daher, Retrotranspositionsereignisse zu kartieren, die durch diese Handvoll hochaktiver LINE-1-Loci verursacht werden. In diesem Artikel beschreiben wir eine einfache Polymerase-Kettenreaktion (PCR)-basierte Methode14, die verwendet werden kann, um die Aktivität eines bestimmten LINE-1-Lokus im ersten Intron des TTC28-Gens bei 22q12.1 zu überwachen, das bei Dickdarm- und Enddarmkrebs hochaktiv ist. 7 , 8. Dieser LINE-1-Ort wird im gesamten Artikel als TTC28-LINE-1 bezeichnet. Dieser Test identifiziert speziell de novo LINE-1 Retrotranspositionsereignisse, die nicht repetitive Sequenzen auf dem 3-A-Flankenbereich der Quelle LINE-1 durch einen Mechanismus namens 3 'transduction15' mobilisieren. 3 - Transduktion erfolgt aufgrund des schwachen LINE-1-Polyadenylierungssignals (PAS), das bewirkt, dass die Transkriptionsmaschinerie sie überspringt und stattdessen die Transkription am stärkeren PAS nachgeschaltet beendet, wodurch die flankierende nicht repetitive Sequenz erfasst wird ( von nun an als "einzigartiges Tag" bezeichnet), das dann neben der LINE-1-Sequenz in die Zielposition eingefügt wird. Philippe et al.16 haben kürzlich gezeigt, dass verschiedene Zelltypen unterschiedliche LINE-1-Loci ausdrücken können. Angesichts dieser Feststellung kann diese Methode angewendet werden, um die Aktivität der am stärksten ausgedrückten LINE-1 zu überwachen, die ihr einzigartiges Tag in der Krebsart des Interesses mobilisieren.

Der erste Schritt bei LDI-PCR ist die Verdauung genomischer DNA mit einem Restriktionsenzym, das ein Restriktionsfragment erzeugt, das die LINE-1 enthält, die untersucht wird (hier TTC28-LINE-1) und ihr einzigartiges Tag (Abbildung 1). Die verdaute DNA wird dann durch Selbstligation zirkuliert und PCR mit inversen Primern verstärkt, die sich innerhalb des einzigartigen Tags befinden. Auf diese Weise wird die full-length source LINE-1 an ihrer "nativen" Position immer verstärkt und daneben werden auch nachfolgende LINE-1-Einfügungen an verschiedenen Ziel-Loci, die das eindeutige Tag enthalten, verstärkt (Abbildung 1), Rücktranspositionsaktivität der betreffenden LINE-1.

Protocol

Diese Forschung wurde vom Institutional Review Board und der Ethikkommission des Universitätskrankenhauses Helsinki genehmigt. Vom Antragsteller wurde eine unterschriebene Einwilligung für die Blutprobe eingeholt, die zum Nachweis dieses Protokolls verwendet wurde.

1. Entwerfen von inversen Primern und Auswahl von Restriktionsenzymen (Bioinformatik)

  1. Bestimmen eines LINE-1-verknüpften eindeutigen Tags
    1. Laden Sie die Sequenz TTC28-LINE-1 im FASTA-Format aus einer LINE-1-Datenbank wie L1Base17herunter. Die L1base ID für TTC28-LINE-1 ist 135.
    2. Fügen Sie 5 kb Sequenz flankieren sowohl 5 - und 3 ' Enden der LINE-1-Sequenz und kommentieren Sie es in einem Textverarbeitungsprogramm.
      HINWEIS: Hier wird die LINE-1 Flankensequenz in brauner Schrift mit Anmerkungen und die LINE-1-Sequenz in grauer Schrift (Supplemental File) angezeigt.
    3. Geben Sie 1 kb Sequenz nach dem ausgewählten LINE-1 cognate PAS in ein PAS-Vorhersagewerkzeug wie polyadq18 oder Dragon PolyA Spotter19 ein und kommentieren Sie das gesamte Polyadenylierungssignal in diesem 1 kb-Fenster.
      HINWEIS: Wenn im 1 kb-Fenster kein PAS vorhanden ist, suchen Sie im nächsten 1 kb-Fenster nach unten nach PAS. TTC28-LINE-1s eigene schwache PAS ist rosa hervorgehoben und alle anderen PAS in 1 kb Fenster nachgeschaltet ist rot hervorgehoben (Supplemental File).
    4. Kommentieren Sie die Sequenz zwischen dem Ende von LINE-1 es cognate PAS und dem stärksten PAS nachgeschaltet als "unique tag".
      HINWEIS: Das "einzigartige Tag" von TTC28-LINE-1 ist gelb hervorgehoben (Zusatzdatei).
  2. Entwerfen von inversen Primern
    1. Entwerfen Sie inverse PCR-Primer, indem Sie die Sequenz "unique tag" in ein webbasiertes Primer-Design-Tool wie Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) oder NCBi es Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) eingeben. Da Primerpaare, die von diesen Werkzeugen entworfen wurden, einander zur Verfügung stehen und herkömmliche PCR erleichtern, verwenden Sie die Reverse-Complement-Funktion für das Primer-Paar, um inverse PCR auszuführen.
      ANMERKUNG: Da LINE-1-Transduktionen am 5-A-Ende stark abgeschnitten sind und die Größe des transduced Bereichs sehr variabel ist, soll der Abstand zwischen den beiden inversen Primern minimal bleiben, indem der Parameter "PCR-Produktlänge" in NCBI Primer-BLAST auf die minimum. Im Falle mehrerer PAS innerhalb des eindeutigen Tags, entwerfen Sie mehrere Primerpaare, die verschiedenen PAS entsprechen. Design-Primer in der Nähe des PAS, da LINE-1-Einfügungen aus dem 3-End der RNA-Zwischenstufe und dem 5-En-Ende variabel abgeschnitten werden. Hier wurden drei Primerpaare entworfen, hervorgehoben in Petrol und Grün, entsprechend drei starken Polyadenylierungssignalen im einzigartigen Tag von TTC28 LINE-1 (Supplemental File).
  3. Auswahl von Restriktionsenzymen
    1. Digest die LINE-1-Sequenz zusammen mit seinen 5 kb vor- und nachgelagerten Flanken in silico mit webbasiertem Tool wie RestrictionMapper. Dies wird eine umfassende Liste von Restriktionsenzymen geben, die diese Region verdauen und verschiedene Restriktionsfragmente erzeugen.
    2. Wählen Sie Restriktionsenzyme aus, die den nativen Ort von LINE-1 wie folgt schneiden: am 5-Endes entweder vor dem LINE-1-Ende 5 -End oder weit 5 'End der LINE-1 selbst, und am 3'-Ende, flussabwärts vom einzigartigen Tag der LINE-1.
      HINWEIS: Das ausgewählte Restriktionsenzym sollte unempfindlich gegen DNA-Methylierung sein, hitzeinaktivierbar sein und gestaffelte "klebrige" Enden erzeugen, die sich gegenseitig ergänzen. Um LDI-PCR zu demonstrieren, wird SacI Restriktionsenzym verwendet, das DNA an GAGCTC-Standorten schneidet, hier in hellgrün hervorgehoben, wird verwendet (Supplemental File).
    3. Beachten Sie die Beschränkungsfragmentgröße, die von ausgewählten Restriktionsenzymen gemacht wird. Dies sollte nicht länger als 12 kb sein, da es möglicherweise nicht effizient durch PCR verstärkt werden kann.

2. Erstellen von kreisförmigen DNA-Vorlagen für inverse PCR über weite Entfernungen

  1. DNA-Extraktion und Qualitätsbewertung
    1. Extrahieren Sie genomische DNA aus Proben (Tumor oder Blut) mit handelsüblichen DNA-Extraktionskits, die qualitativ hochwertige, hochmolekulare DNA extrahieren können, die für LDI-PCR gemäß den Anweisungen des Herstellers erforderlich ist. Alternativ kann auch hochmolekulare DNA durch Phenol extrahiert werden:chloroform20.
    2. Messen Sie die DNA-Konzentration mit einem Fluorometer gemäß den Anweisungen des Herstellers und führen Sie 100 ng DNA auf 1% (w/v) Agarose-Gel, das Ethidiumbromid (0,5 g/ml) im 1x Tris-Acetat-EDTA (TAE)-Puffer bei 4,5 V/cm21 neben DemIII enthält. DNA-Molekulargewichtsmarker zur Überprüfung der DNA-Qualität und -Menge.
  2. Verdauung genomischer DNA
    1. Machen Sie einen Verdauungsreaktionsmix (Endvolumen von 50 l) durch Zugabe von 20 Einheiten SacI Restriktionsenzym, 5 l 10x Reaktionspuffer(Materialtabelle), 100 ng DNA (bis zu 44 l) in einer 0,2 ml PCR-Röhre auf Eis (1 l Restriktionsenzym der meisten Hersteller i s ausreichend, um 100 ng genomische DNA vollständig zu verdauen). Mischen Sie die Lösung, indem Sie das Rohr streichen, und Zentrifuge kurz.
    2. Verwenden Sie einen thermischen Cycler, um den Reaktionsmix bei 37 °C für 1 h zu inkubieren, gefolgt von einer Wärmeinaktivierung bei 65 °C für 5 min.
  3. Selbstligatumung der verdauten genomischen DNA
    1. Zum 50-L-Verdauungsmix (nach Schritt 2.2.2) fügen Sie 8 L 10x T4-DNA-Ligase-Puffer, 1 l (5 Einheiten) T4-DNA-Ligase und 21 l Reinstwasser hinzu, um ein endletztes Reaktionsvolumen von 80 l zu erreichen. und Zentrifuge kurz.
    2. Inkubieren Sie in einem thermischen Cycler bei 22 °C für 10 min, und beenden sie mit einem Wärmeinaktivierungsschritt bei 65 °C für 10 min.

3. Langstrecken-inverse PCR

  1. Bestimmung der Glühtemperatur der Grundierung durch GradientPCR
    1. Stellen Sie einen Glühtemperaturgradienten von (A-4) °C, (A-2)°C, A, (A+2)°C, (A+4) °C ein, wobei A die theoretische Glühtemperatur des Primerpaares ist, die mit dem webbasierten Werkzeug des kommerziellen Herstellers berechnet wird.
      HINWEIS: Thermische Cycler einiger Hersteller erlauben es möglicherweise nicht, den Temperaturgradienten manuell einzustellen. In diesem Fall kann die automatische Gradienteneinstellung mit einem Temperaturbereich von (A-4) °C bis (A+4) °C verwendet werden.
    2. Bereiten Sie einen Master-Mix für die PCR vor, indem Sie die folgenden Komponenten in einem 1,5 ml Mikrozentrifugenrohr kombinieren und mischen: 4 l 5x Reaktionspuffer, 0,4 l mit 10 mM dNTP, 5 l von 2 'M PCR-Primer (vorwärts und rückwärts, in Schritt 1.3.1) , 0,2 l (0,1 U) DNA-Polymerase pro Reaktion. Richten Sie eine Reaktion für jede Glühtemperatur im Gradienten ein.
    3. Für jede Reaktion werden in 0,2 ml PCR-Röhren 19 l des Master-Mixes einfließen und 1 l (1,25 ng) kreisförmige DNA-Schablone aus Abschnitt 2 hinzugefügt.
      HINWEIS: Verwenden Sie kreisförmige selbstligierte DNA, die aus normaler Blut-DNA als Vorlage generiert wird, um den Verzehr potenziell wertvoller Tumor-DNA für diesen Optimierungsschritt zu vermeiden.
    4. Ausführen des Gradienten-PCR-Programms auf einem thermischen Cycler wie unten beschrieben: (i) ein Zyklus von 3 min bei 98 °C (Denaturierung); ii) 35 Zyklen von (10 s bei 98 °C [Denaturierung], 20 s bei dem Temperaturgradienten von [A-4] bis [A+4] °C [Annealing] und 1 x 6 min [30 s pro Kilobasis des erwarteten PCR-Produkts] bei 72 °C [Verlängerung]); iii) einen Zyklus von 10 min bei 72 °C (Endverlängerung).
    5. Führen Sie 6 l des PCR-Produkts in 1% Agarose-Gel21 in 1x TAE-Puffer bei 4,5 V/cm herauf und analysieren Sie die PCR-Produkte, die bei unterschiedlichen Glühtemperaturen erzielt wurden.
    6. Wählen Sie die Glühtemperatur aus, die ein PCR-Produkt ergibt, das der erwarteten Größe entspricht.
  2. Detektion der retrotranspositionsbasierten Retrotranspositionsaktivität de novo LINE-1 im Tumorgenom
    1. Führen Sie LDI-PCR mit dem inversen PCR-Primer-Paar auf kreisförmigen DNA-Vorlagen aus Tumorproben aus (Abschnitt 2). Befolgen Sie die gleichen Anweisungen wie bei DergradientEN-PCR (Abschnitt 3.1), aber dieses Mal ersetzen Sie den Temperaturgradienten durch die optimale Glühtemperatur.
    2. Analysieren Sie die PCR-Produkte durch Agarose-Gel-Elektrophorese wie in Schritt 3.1.5. PCR-Produkt von bekannter Größe oder das "native" PCR-Produkt, das der LINE-1 an seinem nativen Ort entspricht, sollten für jede Reaktion sichtbar sein. De novo LINE-1 3 -Transduktion in der Tumorprobe assayed ist nachweisbar als PCR-Produkte unterschiedlicher Größe, zusammen mit dem nativen PCR-Produkt im Agarose-Gel.

4. Sequenzierung von LDI-PCR-Produkten zur Aufschlussung der Identität von Zielstandorten für LINE-1 3-Transduktion

  1. Führen Sie eine einmolekulare Langlesesequenzierung aller in jeder LDI-PCR-Reaktion erzeugten PCR-Amplicons durch, um die Zielintegrationsstellen dieser LINE-1 3-Transduktionsereignisse zu identifizieren.
    HINWEIS: Das Klonen und Sanger-Sequenzieren der LDI-PCR-Produkte ist ebenfalls ein möglicher, wenn auch umständlicher Ansatz.
  2. Richten Sie die von Einmolekül-Langlesesequenzierungsplattformen erzeugten Lesevorgänge mithilfe von Standard-Sequenzausrichtungspipelines auf das Referenzgenom aus. Analysieren Sie die ausgerichteten Lesevorgänge mit der LDI-PCR-Software14, um de novo LINE-1-Einfügungen und deren Zielstandorte zu identifizieren.

Representative Results

Im Falle von TTC28-LINE-1 gibt es mehr als ein PAS innerhalb eines 1 kb Fensters flussabwärts seines cognate PAS, daher wurde die Region zwischen dem TTC28-LINE-1 PAS und dem stärksten PAS mit 811 bp downstream als das einzigartige Tag für TTC28-LINE-1 betrachtet. Drei inverse PCR-Primer-Paare wurden an diesem einzigartigen Tag entworfen, die verschiedenen PAS entsprechen,die 14vorhanden sind. Wir wählten drei Restriktionsenzyme aus: (i) NsiI, die 5 , vor DEM TTC28-LINE-1 und 3 , außerhalb des eindeutigen Tags schneidet, und (ii) SacI und (iii) PstI, die 5 ' innerhalb der LINE-1 in ihrem entfernten 5- End- und 3' außerhalb des eindeutigen Tags schneiden. Diese erzeugen Restriktionsfragmente von 10.288 bp, 5.699 bp bzw. 6.305 bp.

Um diese Methode zu demonstrieren, führten wir LDI-PCR auf DNA aus MCF7-Zelllinie extrahiert. Diese Brustkrebs-Zelllinie wurde bereits berichtet, um TTC28-LINE-1 Aktivität16anzuzeigen. Der Einfachheit halber haben wir eine kreisförmige DNA-Vorlage mit einem Restriktionsenzym, SacI, aus drei enden und eine LDI-PCR mit einem Von-drei-Primer-Paar (Tabelle1) durchgeführt, um de novo LINE-1-Einfügungen aus TTC28- ZEILE-1.

Eine gute Qualität der aus der MCF7-Zelllinie extrahierten DNA wurde durch die Agarose-Gelelektrophorese sichergestellt (Abbildung 2). Intakte dna mit hohem Molekulargewicht zeigt, dass die genomische DNA für diesen Test von optimaler Qualität ist. Wenn stattdessen ein Abstrich sichtbar ist, deutet dies auf eine schlechte Qualität der extrahierten DNA hin, was wiederum nachgelagerte Verfahren behindern wird.

Abbildung 3 zeigt ein repräsentatives Ergebnis eines Gradienten-PCR-Experiments, das auf die Bestimmung der optimalen Glühtemperatur des inversen Primerpaares TTC28-LINE-1 abzielt. Blutgenom-DNA mit SacI verdaut, gefolgt von Selbst-Ligation, um eine kreisförmige DNA-Vorlage zu bilden, wurde für diese Reaktion verwendet. Ein hochspezifisches PCR-Produkt von erwarteter Größe (5.649 bp) bei 62, 64 und 66 °C zeigt, dass die optimale Glühtemperatur für dieses Primerpaar im Bereich von 62 bis 66 °C liegt.

Wir haben eine kreisförmige DNA-Vorlage erzeugt, indem wir die genomische DNA von MCF7 mit dem Sac-I-Restriktionsenzym verdaut haben, gefolgt von einer Selbstligation. Abbildung 4 zeigt, dass die TRANSduktion von TTC28-LINE-1 3 in MCF7-Zelllinien erfolgt: De-Novo-Einfügungen können als LDI-PCR-Produkte unterschiedlicher Größe zusammen mit einem nativen PCR-Produkt bekannter Größe (5.649 bp) nachgewiesen werden. Um genomische Koordinaten der de novo-Zielstandorte zu identifizieren, können PCR-Amplicons sequenziert werden (siehe Protokollabschnitt 4).

Figure 1
Abbildung 1 : Übersicht über LDI-PCR zur Erkennung der LINE-1 3-Transduktion. Eine kreisförmige DNA-Vorlage wird durch erstverdauliche Verdauung (I) mit einem Restriktionsenzym und selbstligatierenden (II) erzeugt. Diesem Schritt folgt die inverse PCR (III) mit inversen PCR-Primern, die auf das einzigartige Tag der LINE-1 von Interesse ausgerichtet sind (Sequenz zwischen LINE-1s eigenem schwächeren PAS, in rosa, und stärkerem PAS nachgelagert, in rot). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2 : Qualitätsbewertung der extrahierten DNA. 100 ng DNA, die aus der MCF7-Zelllinie extrahiert wurde, und Blut von einer normalen Person, die als Kontrollprobe verwendet wird, wurden zusammen mit 1 l und 2 L des als M gekennzeichneten DNA/HindIII-Markers durchgeführt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3 : Gradient PCR zur Bestimmung der optimalen Glühtemperatur für inverse PCR-Primer (Tabelle 1). LDI-PCR mit inversen Primerpaaren bei Glühtemperatur von 56 bis 66 °C zeigt ein deutliches PCR-Produkt bei 62 bis 66 °C. Grüner Pfeil zeigt die ausgewählte Glühtemperatur für zukünftige Experimente an. Für diesen Optimierungsschritt wurde eine kreisförmige DNA-Vorlage verwendet, die durch die Verdauung der genomischen DNA des Blutes eines normalen Individuums mit SacI und gefolgt von selbstligation erzeugt wurde. M, Marker (1 kb plus DNA-Leiter). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4 : LDI-PCR zur Identifizierung der LINE-1 3-Transduktion, die TTC28 -ZEILE-1. Zirkuläre DNA-Vorlagen, die durch die Verdauung von MCF7 und Blut (aus normaler individueller) genomischer DNA mit SacI und anschließender Selbstligation erzeugt wurden, wurden durch inverse Primer bei optimaler Glühtemperatur verstärkt. Das mit Sternchen markierte "Native" PCR-Produkt von erwarteter Größe (5.649 bp) wurde sowohl in der MCF7-DNA als auch in der normalen Blut-DNA nachgewiesen, während MCF7 auch zusätzliche PCR-Produkte unterschiedlicher Größe produzierte, was auf eine Retrotransposition von de novo LINE-1 hindeutet. M, Marker (1 kb DNA-Leiter). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Primername Sequenz (5 x 3)
L1_001 (Drehzahl) TTCACTAAGCATGTATGTGGAAAAC
L1_002 (fwd) CCCAAAATATACCCAATTACTGGCA

Tabelle 1: Inverses PCR-Primer-Paar für das einzigartige Tag TTC28 -LINIE-1 14 .

Ergänzende Datei. Bitte klicken Sie hier, um diese Datei herunterzuladen.

Discussion

Hier beschreiben wir eine Methode, die verwendet werden kann, um de novo LINE-1 Einfügungen zu identifizieren, die von jeder aktiven LINE-1 von Interesse herrühren. Wir haben diese Methode für eine hochaktive LINE-1 optimiert, die sich bei 22q12.1 befindet, und zuvor gezeigt, dass sie bei der Erkennung subklonaler Insertionen bei Dickdarmkrebs hochsensibel ist14.

Der Erfolg von LDI-PCR hängt von der Qualität der genomischen DNA ab. Daher haben wir einen zusätzlichen Qualitätskontrollschritt aufgenommen, um sicherzustellen, dass zu Beginn des Protokolls hochmolekulare DNA vorhanden ist (Schritt 2.1.2). Wir empfehlen, genomische DNA bei -20 °C für die Langzeitlagerung zu speichern und Aliquots vorzubereiten, um Zyklen des Einfrierens und Auftauens zu vermeiden. Die Verwendung genomischer DNA aus Blut oder patientengerechtem normalem Gewebe wird dringend empfohlen, um zu unterscheiden, ob es sich bei der nachgewiesenen LINE-1-Retrotransposition um eine Keimbahn oder ein somatisches Ereignis handelt. Da Schnittstellen für Restriktionsenzyme im Genom stochastisch sind, ist es möglich, dass eine bestimmte de novo LINE-1-Einsteckstelle keine Schnittstellen für das in seiner Nähe verwendete Restriktionsenzym enthält. Daher sollte mehr als ein Restriktionsenzym in separaten Reaktionen verwendet werden, um die Mehrheit der de novo LINE-1-Einfügungen in tumor-DNA zu erkennen, um verschiedene Bibliotheken kreisförmiger DNA-Vorlagen zu erzeugen. Wenn das einzigartige Tag der LINE-1 von Interesse mehr als einen PAS hat, verbessert die Verwendung von Primerpaaren neben jedem PAS die Wahrscheinlichkeit, stark abgeschnittene Transduktionen zu erkennen.

Obwohl es elegante Methoden zur genomweiten Detektion von de novo LINE-1-Einfügungen gibt, können sie überwältigend sein, wenn das Ziel darin besteht, die Retrotranspositionskompetenz einer bestimmten LINE-1 in einem bestimmten zellulären Kontext zu untersuchen. Zu diesem Zweck kann LDI-PCR ein kostengünstiger und einfacher und dennoch robuster Ansatz zur Visualisierung von LINE-1-Retrotranspositionsereignissen sein. Der in dieser Methode verwendete Targeting-Ansatz ähnelt TS-ATLAS22; LDI-PCR vermeidet jedoch die Verwendung von Linker-Oligonukleotiden und kann sowohl 5- als auch 3-Zoll-Knoten der de novo LINE-1-Einfügung gleichzeitig verstärken. Informationen zu den 5- und 3-Knoten der LINE-1-Einfügung, dem Zielort der Integration, PolyA-Schwanz- und Zielstandortmodifikationen, die alle Kennzeichen der LINE-1-Retrotransposition sind, können durch Kopplung von LDI-PCR mit Einmolekül- lang gelesene Sequenzierungstechnologien. Die so erzeugten langen Lesevorgänge enthalten die eingefügte LINE-1-Sequenz, ihr eindeutiges Tag und die Zielsequenzen in einem einzigen Lesegerät, wodurch Schwierigkeiten bei der Zuordnung von Kurzlesevorgängen im sich wiederholenden Bereich umgangen werden.

Es gibt zwei wesentliche Einschränkungen bei der Verwendung von LDI-PCR zur Erkennung von LINE-1-Aktivitäten. Die erste ist PCR inhärent: Sie kann nur Fragmente mit einer Größe von bis zu 10 kb zuverlässig verstärken. Dies sollte bei der Auswahl von Restriktionsenzymen berücksichtigt werden, da das native Fragment diesen Grenzwert nicht überschreiten sollte. Zweitens kann diese Methode Retrotranspositionsereignisse nur erkennen, die den flankierenden Bereich 3 der LINE-1 durch 3-Transduktionen mobilisieren. Daher wird die Aktivität der LINE-1, die keine 3-Transduktion aufweisen, mit dieser Methode nicht erkannt. Trotz der Verstärkung durch LDI-PCR können einige LINE-1-Retrotranspositionsereignisse, die (a) ein PCR-Ziel ähnlicher Größe wie der "native" Standort oder andere Retrotranspositionen erzeugen oder (b) selten oder subklonal sind, nicht von Agarose-Gel Elektrophorese. Solche LINE-1-Retrotranspositionsereignisse können erfasst werden, indem das LDI-PCR-Produkt mit Einzelnenmolekül-Langlese-Sequenzierungstechnologien14sequenziert wird.

Der hier beschriebene Workflow kann leicht geändert werden, um die Aktivität anderer "heißer" LINE-1s mithilfe eines geeigneten Restriktionsenzyms und durch Das Entwerfen von inversen Primern, die auf diese LINE-1 abzielen, zu erkennen. Neben der Detektion der LINE-1-vermittelten 3--Transduktion kann diese Methode angepasst werden, um weniger häufige LINE-1-vermittelte 5-Transduktionen23zu erkennen. Ähnliche Methode wurden verwendet, um die Integrationsstelle von LINE-1-Reportern in zellbasierten Assays24 und proviralen Integrationsstellen bei Krebs25zu identifizieren. Neben LINE-1-Einfügungen kann diese Methode auch zum Nachweis anderer genomischer Aberrationen eingesetzt werden, wie z. B. DNA-Umlagerungen, bei denen Informationen über die umlagerungsgefährdete Region vor bestehen26.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Wir möchten uns bei allen unseren Co-Autoren in dem Artikel bedanken, in dem diese Methode zuerst beschrieben wurde14, insbesondere Tatiana Cajuso, Kimmo Palin, Outi Kilpivaara und Esa Pitkänen für wertvolle Diskussionen während der Entwicklung der Methode. L.K. wird von der Akademie Finnlands (Grant-Nummern 25996, 292789, 306026 und 314394), der Sigrid Juselius Foundation und der Finnischen Krebsgesellschaft finanziert. B.P. ist Stipendiat der University of Helsinki Research Foundation PhD Studentship, ein Doktoratsstipendium der Finnischen Krebsgesellschaft und ein Stipendium für Doktoranden von Ida Montinin Säätiö. Wir danken auch Teemu Masalin (Universität Helsinki) und Kul Shrestha von der Forschungsgruppe von L.K. für die Unterstützung bei der Videoproduktion.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics