التمايز المستحث للخلايا الشبيهة بالخلايا M في الطبقات الأحادية المعوية اللفائفية المشتقة من الخلايا الجذعية البشرية

Immunology and Infection
 

Summary

يصف هذا البروتوكول كيفية الحث على التمييز بين الخلايا M في الطبقات الأحادية اللفائفية المشتقة من الخلايا الجذعية البشرية وطرق تقييم تطورها.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وظائف الخلايا M (microfold) من الأمعاء لنقل مستضد من التجويف apical إلى بقع باير الكامنة والبروبريا لامينا حيث توجد الخلايا المناعية، وبالتالي تسهم في المناعة المخاطية في الأمعاء. وهناك فهم كامل لكيفية تمييز الخلايا M في الأمعاء وكذلك الآليات الجزيئية للمتفهم من قبل الخلايا M. ويرجع ذلك إلى أن الخلايا M هي مجموعة نادرة من الخلايا في الأمعاء ولأن النماذج في المختبر للخلايا M ليست قوية. وقد وفر اكتشاف نظام زراعة الخلايا الجذعية المتجددة ذاتيا من الأمعاء، وتسمى enteroids، إمكانيات جديدة لزراعة الخلايا M. المعوّل مفيد على خطوط الخلايا المستزرعة القياسية لأنه يمكن تمييزها إلى عدة أنواع خلايا رئيسية موجودة في الأمعاء، بما في ذلك خلايا البُلب وخلايا البانيث وخلايا الغدد الصماء المعوية والخلايا المعوية. السيتوكين رانكل ضروري في تطوير الخلايا M، وإضافة RANKL و TNF-α إلى وسائل الإعلام الثقافة يعزز مجموعة فرعية من الخلايا من enteroids اللفائفي للتمييز في الخلايا M. يصف البروتوكول التالي طريقة للتمايز بين الخلايا M في نظام أحادي الطبقة المستقطبة الظهارية عبر البئر من الأمعاء باستخدام المعتطفل اللفائفي البشري. يمكن تطبيق هذه الطريقة على دراسة تطوير الخلية M والوظيفة.

Introduction

الخلايا M (microfold) هي خلايا ظهارية معوية متخصصة وجدت في المقام الأول في ظهارة الجريب المرتبطة(FAE) من الأمعاء فوق المناطق اللمفاوية الصغيرة تسمى بقع باير 1. تحتوي الخلايا M على ميكروفيلي قصير غير منتظم وعميقة في المهبل على جانبها البضي، مما يسمح للخلايا المناعية بالإقامة عن كثب في جسم الخلية2. هذا المورفولوجيا الفريدة تمكن الخلايا M من عينة مستضد من التجويف apical من الأمعاء وتسليمها مباشرة إلى الخلايا المناعية الكامنة2. وبهذه الطريقة، خلايا M مهمة للمراقبة المناعية في الأمعاء ولكن يمكن أيضا أن تستغلمن قبل مسببات الأمراض للدخول في بروبريا لامينا 1، 6,7.

وقد أعاقت دراسة الخلايا M من قبل عدة عوامل. أولا، يتم العثور على خلايا M على تردد منخفض في الماوس والأمعاء البشرية8. في أنظمة الخلايا المستزرعة، تم حث الخلايا الشبيهة بالخلايا M للتمييز من خلال المشاركة في زراعة خط خلية سرطان الغدة الاستقطابي، Caco-2، مع إما الخلايا الليمفاوية B من بقع الماوس باير أو خط الخلايا الليمفاوية الخلية B، راجي B9،10 . وهذا يؤدي إلى مجموعة فرعية من خلايا كاكو-2 التي تعبر عن علامات الخلية M سياليل لويس مستضد وUEA-1 في ظهارة الاستقطاب9،10. (يتم التعبير عن هذه العلامات أيضا على خلايا الكمب في الأنسجة المعوية، لذلك في الوقت الحاضر يتم استخدامها في كثير من الأحيان كما علامات الخلية M النهائي11،12.) وقد استخدم هذا النظام الخلية Caco-2-M لدراسة الجسيمات والبكتيريا نقل13،14. ومع ذلك، خلايا Caco-2 هي خط خلية راسخة من سرطان الغدة الدرقية المعوية الكبيرة مع عامل الخلط أن مصادر مختلفة من خلايا كاكو-2 عرض الأنماط الظاهرية المختلفة بين مختبرات15. وعلاوة على ذلك، فإنها قد لا تلخص تماما مستويات النسخ من الخلايا M الحقيقية، كما أنها تفتقر إلى التعبير عن علامات الخلية M المعروفة حاليا GP2 وSpiB16. ولذلك، هناك حاجة إلى نماذج ثقافية إضافية وأكثر أهمية من الناحية الفسيولوجية لتكون قادرة على دراسة تطوير الخلايا M والوظائف.

في غضون السنوات العشر الماضية، كان مجال النظم النموذجية المشتقة من الأمعاء المعوية يتقدم بسرعة إلى الأمام من الاكتشاف الأولي أن الخلايا الجذعية المعوية المستمدة من خزعة الأمعاء البشرية يمكن أن تنتشر ذاتيا وتجديد الذات في الثقافة 17 سنة , 18.الأهم من ذلك، إزالة الخلايا الجذعية تعزيز العوامل من وسائل الإعلام النمو يسمح هذه الثقافات الخلايا الجذعية للتمييز في العديد من أنواع الخلايا الموجودة في الأمعاء18. وعلاوة على ذلك، فإن العمل الأخير يشير إلى أهمية إشارات RANK-RANK في تطوير الخلايا M في الأمعاء19،20. مستقبلات RANK هو عضو في عائلة TNF من المستقبلات التي يتم التعبير عنها على الخلايا السلائف الظهارية في الأمعاء19 في حين يتم تحرير RANKL (الرباط مستقبلات RANK) من قبل الخلايا سترومال من بقع باير20. منذ أنواع الخلايا الظهارية الموجودة في enteroids اللفائفي لا تنتج RANKL، M خلية التمايز في الثقافات المعوية اللفائفية يمكن أن يسببها إضافة RANKL إلى وسائل الإعلام الثقافية21،22. إدراج TNFα في وسائل الإعلام الثقافة يساعد على دعم تطوير الخلية M في enteroids اللفائفي23. هنا، ونحن نصف أساليب تحفيز التمايز من الخلايا M في أحادية الأمعاء المستمدة من enteroids اللفائفي البشري. وتستند أساليبنا جزئيا على التعديلات من البروتوكولات التالية21،22،23.

Protocol

تمت الموافقة على جميع الطرق الموضحة هنا من قبل جامعة تافتس IBC وIRB.

1. تحفيز التمايز الخلية M في الطبقات الأحادية المستمدة من اللفائفي البشري

ملاحظة: يستخدم هذا البروتوكول المعتَدِّدات اللفائفية المشتقة من خزعة الأنسجة البشرية. يرجى الرجوع إلى البروتوكولات المنشورة للحصول على أساليب حول كيفية نمو ومرور هذه الخلايا18،24. تم تكييف الطرق التالية لتطوير الطبقات الأحادية من Zou et al.24. تم تكييف طرق تحفيز الخلايا M في الثقافات المشتقة من التمعوي اللفائفي من التقارير السابقة21،22،23. يتم تنفيذ جميع الأعمال في غطاء محرك السيارة ثقافة الأنسجة المعقمة والحضانة هي في غطاء محرك السيارة أو حاضنة زراعة الأنسجة كما هو مبين. انظر جدول المواد اللازمة لإعداد الطبقات الأحادية المعوية اللفائفية ووسائل الإعلام المختلفة.

  1. تنمو enteroids اللفائفي لمدة 4-10 أيام في مصفوفة خارج الخلية (ECM) (انظر جدولالمواد) (الشكل1)، اعتمادا على معدلات نموها الجوهرية، قبل البذر على transwells.
  2. طلاء الأغشية العابرة
    1. وضع العدد المطلوب من transwells في لوحة 24 جيدا خلق نظام من غرفتين.
    2. تمييع ECM 25 أضعاف في الباردة معقمة الفوسفات المخزنة المالحة (PBS) وإضافة 100 درجة مئوية من محلول مخفف الباردة في كل غرفة علوية على الغشاء.
      ملاحظة: يجب الحفاظ على ECM ومحلول ECM المخفف على الجليد حتى قبل الإضافة مباشرة.
    3. تغطية لوحة 24 جيدا مع غطاء ووضع لوحة في حاضنة زراعة الأنسجة في 37 درجة مئوية لمدة 2 ساعة للسماح ECM التصلب على الغشاء.
    4. بعد 2 ح، وإزالة لوحة من الحاضنة ومكان في غطاء محرك السيارة ثقافة الأنسجة. باستخدام ملاقط معقمة، عكس كل transwell لإزالة بلطف الحل المتبقية. السماح للأغشية لairdry في غطاء محرك السيارة مع غطاء مفتوح في حين يتم جمع الخلايا (الخطوات 1.3.1- 1.3.11).
  3. فصل المعتضد اللفائفي إلى خلايا واحدة
    1. إزالة لوحة من enteroids اللفائفي من الحاضنة وإزالة بلطف وسائل الإعلام الثقافة من كل بئر عن طريق الشفط فراغ أو مع ماصة.
      ملاحظة: واحدة من الأولإدخاليات اللفائفية التي تحتوي على ما يقرب من 100 الخراجات صحية كافية لبذور 1.5-2 الآبار.
    2. إضافة 500 ميكرولتر من الجليد البارد 0.5 م إيثيلينديامينيتراسيتيك حمض (EDTA) إلى كل بئر تحتوي على enteroids اللفائفي علقت في ECM لتفريق ECM. ماصة صعودا وهبوطا بقوة مع P1000 pipettor تعيين في 500 درجة مئوية لتفريق ECM وبالتالي الإفراج عن enteroids اللفائفي في الحل. لتحسين حل ECM، بعد الأنابيب، يهز لوحة بقوة في 4 درجة مئوية لمدة 30 دقيقة.
    3. جمع الحل من كل بئر في أنابيب مخروطية 15 مل.
      ملاحظة: جمع ما يصل إلى 10 آبار لكل أنبوب مخروطي 15 مل لجمع خلية واحدة الأمثل.
    4. بيليه الخلايا في جهاز طرد مركزي في 140 × ز و 4 درجة مئوية لمدة 5 دقائق بيليه ينبغي أن تكون مرئية ولكن يمكن بسهولة أن تخلع، حتى إزالة ببطء supernatant عن طريق الشفط فراغ أو مع ماصة.
      ملاحظة: إذا كنت تشعر بالقلق إزاء فقدان بيليه والخلايا، واستخدام ماصة وحفظ supernatant في أنبوب منفصل.
    5. لهضم الروابط تقاطع ضيق وتفكك enteroids اللفائفي في خلايا واحدة، وإعادة تعليق بيليه في 500 درجة مئوية من التربسين درجة حرارة الغرفة لكل 5 آبار التي تم جمعها في الخطوة 1.3.3. باستخدام P1000، ماصة صعودا وهبوطا لتصنيف كتل وحضانة الأنابيب في حمام مائي 37 درجة مئوية لمدة 5 دقائق أو أقل.
      ملاحظة: هناك حاجة إلى التحسين لتحديد مقدار الوقت المناسب اللازم لاحتضان الأنابيب بحيث يتم تقسيم الخلايا ولكن ليس الإفراط في trypsinized لدرجة أنها تموت. استخدم التريبان الأزرق في الخطوة 1.3.9 للتأكد من أن الخلايا قابلة للحياة بعد علاج التربسين.
    6. إضافة 1 مل من DMEM المتقدمة / F12 مع 10٪ مصل البقر الجنيني (FBS) لكل 500 ميكرولتر من التربسين لتعطيل التربسين.
    7. ماصة صعودا وهبوطا مع تعيين P1000 في 500 درجة مئوية على الأقل 50 مرة ضد جانب الأنبوب المخروطي إلى مزيد من تصنيف كتل المتبقية في خلايا واحدة.
    8. وضع مصفاة خلية 40 ميكرومتر أكثر من مخروطي 50 مل وإضافة 1 مل من DMEM المتقدمة / F12 مع FBS 10٪ لترطيب مصفاة الخلية. ماصة تعليق خلية واحدة من مخروطي 15 مل على مصفاة. غسل مصفاة مع 1 مل من DMEM المتقدمة / F12 مع FBS 10٪.
    9. نقل الخلايا التي ذهبت من خلال مصفاة الخلية من مخروطية 50 مل إلى أنبوب مخروطي جديد 15 مل. خلال خطوة الطرد المركزي 1.3.10، سوف ينظر إلى بيليه الخلوية بسهولة أكبر في أنبوب مخروطي 15 مل. عد الخلايا باستخدام مقياس الهيموكيتومات. استخدم Trypan blue للتحقق من أن الخلايا لا تزال على قيد الحياة. عادة، > لوحظ تاهل ية 95%.
    10. أثناء عد الخلايا، الطرد المركزي الخلايا في أنبوب 15 مل جديدة في 400 × ز ودرجة حرارة الغرفة لمدة 5 دقائق. إزالة بعناية supernatant مع ماصة، مرة أخرى إنقاذ supernatant في حالة بيليه يصبح خلعها.
    11. إعداد تعديل وسائل الإعلام النمو الكامل25 (MCMGF + وسائل الإعلام) تستكمل مع 10 μM Y-27632. إعادة تعليق الخلايا الكريات في 2.5 × 105 خلايا / 200 درجة مئوية في MCMGF +. راجع الملاحظات في المناقشة حول تحسين رقم بذر الخلايا.
      ملاحظة: MCMGF + وسائل الإعلام المتقدمة DMEM / F12 مع 75٪ L-Wnt3a وسائل الإعلام مشروطة، 10٪ R-spondin وسائل الإعلام مكيفة، 5٪ نوجين وسائل الإعلام مكيفة، 1X B27 الملحق، 1X N2 الملحق، 1 M M N-أسيتيل، 50 نانوغرام / مل الماوس المؤتلف EGF، 500 نانومتر A-8301، 10 نانومتر [Leu15]-المعدة I، 10 M HEPES، 2 M الجلوتاماكس، و 1X البنسلين / العقدية (اختياري).
    12. تأكد من أن الأغشية المغلفة بـ ECM التي تم إعدادها في الخطوة 1.2 قد جفت بالكامل، كما تم تقييمها بالعين. غسل الغرفة العليا مع 200 درجة مئوية من MCMGF +. إضافة 200 درجة مئوية من محلول الخلية في كل غرفة علوية.
    13. إضافة 700 درجة مئوية من MCMGF + مع 10 ميكرومتر Y-27632 إلى كل غرفة سفلية. وضع لوحة في حاضنة 37 درجة مئويةزراعة الأنسجة مع 5٪ CO 2.
    14. بعد يوم واحد من النمو، وإزالة وسائل الإعلام من الغرفة العليا واستبدالها مع 200 درجة مئوية من MCMGF الطازجة +، لمنع نمو طبقات الخلايا المتعددة.
  4. استبدال المتوسطة
    1. مرة واحدة الطبقات الأحادية هي ~ 80٪ confluent، وعادة ما بين أيام 1-3 ما بعد البذر، واستبدال وسائل الإعلام basolateral مع وسائل الإعلام التمايز (DM) للحصول على آبار التحكم (انظر الخطوة 1.4.2 لمزيد من التفاصيل) أو مع وسائط الخلية M لآبار الحث الخلية M (انظر الخطوة 1.4.3 لمزيد من التفاصيل). استبدال وسائل الإعلام في الغرفة العليا مع DM لكلا الشرطين.
      ملاحظة: DM هو DMEM المتقدمة / F12 مع وسائل الإعلام 5٪ Noggin مكيفة، 1X B27 الملحق، 1X N2 الملحق، 1 mM N-أسيتيل، 50 نانوغرام / مل الماوس المؤتلف EGF، 500 نانومتر A-8301، 10 نانومتر [Leu15]-المعدة I، 10 mM HEPES العازلة، 2 mM GlutaMAX، و 1X البنسلين / العقدية (اختياري ). M الخلية وسائل الإعلام هو DM تستكمل مع 200 نانوغرام / مل رانكل و 50 نانوغرام / مل TNFα.
    2. لآبار التحكم التي لا ينبغي أن تحتوي على خلايا M، إضافة 200 درجة مئوية من DM إلى الغرفة العليا و 700 درجة مئوية DM إلى الغرفة السفلية.
    3. للحث على الخلايا M، إضافة 200 درجة مئوية من DM إلى الغرفة العليا و 700 درجة مئوية من وسائط الخلية M إلى الغرفة السفلية.
    4. استبدال وسائل الإعلام كل يومين. لآبار التحكم، استبدل DM في الغرف العليا والسفلية. لآبار الخلية M، استبدال DM في الغرفة العليا ووسائط الخلية M في الغرفة السفلى.
      ملاحظة: بحلول اليوم 7 بعد زرع الخلايا، يتم حث الخلايا M بالكامل في الطبقات الأحادية.

2. التحقق من تمايز الخلية M بواسطة qRT-PCR

ملاحظة: قم بتنفيذ العمل التالي في مساحة مقاعد البدلاء الخالية من RNAse المعقمة. انظر جدول المواد للاطلاع على قائمة بالمواد المفضلة لـ qRT-PCR.

  1. إزالة وسائل الإعلام من الغرف العليا والسفلية وغسل الغرفة العليا 2X بلطف مع 300 درجة مئوية من درجة حرارة الغرفة PBS.
  2. أضف 300 لتر من التريزول إلى كل غرفة علوية. الحضانة في درجة حرارة الغرفة لمدة 5 دقائق.
    تحذير: ارتداء القفازات وحماية العين عند استخدام Trizol لتجنب الاتصال مع الجلد كما هو مبين في تعليمات الشركة المصنعة.
  3. وفي الوقت نفسه، تسمية أنابيب الطرد المركزي الدقيق لكل بئر وإضافة 700 درجة مئوية من Trizol إلى كل أنبوب.
  4. جمع التجانس الخلية عن طريق الأنابيب صعودا وهبوطا 3X بلطف مع P1000 ونقل المحتويات إلى أنبوب الطاردة الدقيقة المقابلة. دوامة لمدة 5 s لخلط.
  5. الحفاظ على العينات في درجة حرارة الغرفة لمدة 3 دقائق إضافية. ثم تخزين في -80 درجة مئوية لمدة تصل إلى شهر واحد.
  6. اتبع منهجية qRT-PCR القياسية لعزل الحمض النووي الريبي، وعلاج DNase، والنسخ العكسي وردود الفعل qRT-PCR. الرجوع إلى قائمة التمهيدي في جدول المواد.

3. التحقق من تمايز الخلايا M عن طريق الفلورة المناعية

ملاحظة: دائما الحفاظ على الغرفة السفلى من لوحة مليئة PBS بحيث تبقى الأغشية الرطبة. يتم تنفيذ هذا الإجراء على مقاعد البدلاء. انظر جدول المواد للحصول على قائمة بالمواد المفضلة للمناعة.

  1. إزالة وسائل الإعلام من الغرفة العليا وغسل 2X بلطف مع 300 درجة مئوية من درجة حرارة الغرفة PBS. إضافة 100 درجة مئوية من درجة حرارة الغرفة 4٪ PFA في PBS إلى الغرفة العليا. تغطية لوحة مع احباط والسماح الوقوف لمدة 25 دقيقة في درجة حرارة الغرفة. إزالة 4% PFA.
    تحذير: ينبغي التخلص من 4 في المائة من الهيدروكربون المشبع بالفلور على النحو الصحيح كنفايات كيميائية خطرة.
  2. غسل الغرفة العليا 3X مع 300 درجة مئوية من درجة حرارة الغرفة PBS. عند هذه النقطة، يمكن أن تبقى العينات عند 4 درجة مئوية لمدة تصل إلى شهر قبل تلطيخ. مرة واحدة ملطخة، وينبغي تصور العينات في غضون أسبوع للحصول على أفضل جودة الصور.
  3. احتضان الطبقات الأحادية مع 100 درجة مئوية من 5٪ ألبوم المصل البقري (BSA) المذاب في PBS لمدة 30 دقيقة في الظلام في درجة حرارة الغرفة لمنع الطبقات الأحادية.
  4. إعداد GP2 حل الأجسام المضادة الأولية في 1٪ BSA في PBS في تخفيف 1:100. إضافة 100 درجة مئوية لكل بئر. وصمة عار لمدة ساعة واحدة في درجة حرارة الغرفة في الظلام. إزالة الحل.
    ملاحظة: لا تُحيّر الطبقات الأحادية قبل حدوث وصمة عار أساسية لـ GP2 لأن تلطيخ سطح GP2 الأساسي الأمثل لخلايا M يتحقق دون نفاذية.
  5. اغسل الغرفة العليا 3x مرات مع 300 درجة مئوية من درجة حرارة الغرفة PBS.
  6. إعداد حل وصمة عار الثانوية من الفلورسنت الموسومة الماعز المضادة للماوس IgG في 1:200، phalloidin في 1:100 وDAPI في 1٪ BSA + 0.1٪ تريتون في PBS. إضافة 100 درجة مئوية لكل بئر. وصمة عار لمدة 30 دقيقة في درجة حرارة الغرفة في الظلام.
    ملاحظة: يتم إضافة تريتون إلى محلول وصمة عار الثانوية لنفاذ الخلايا خلال هذه الخطوة لوصمة عار phalloidin السليم.
  7. غسل 3X مع 300 ميكرولتر PBS.
  8. وضع قطرة 5 ميكرولتر منحل تصاعد (جدول المواد) على شريحة زجاجية. إزالة البئر من لوحة جيدا 24 وعكس. قطع الغشاء بعناية من البئر باستخدام مشرط. وضع الغشاء مع الخلايا التي تواجه ما يصل إلى قطرات من حل تصاعد على الشريحة الزجاجية. إضافة 10 درجة مئوية من حل تصاعد على الجزء العلوي والوسط من الغشاء ووضع غطاء على رأس لختم الغشاء بين الشريحة الزجاجية وغطاء.
  9. تجفيف الشرائح في درجة حرارة الغرفة في الظلام لمدة 24 ساعة.

Representative Results

يتم تحليل الأورويدات اللفائفية المزروعة في ECM بصريا ً وبواسطة qRT-PCR لحالتها الصحية النسبية وحالات التمايز كوسيلة لمراقبة الجودة للثقافات المعوية اللفائفية وللاستخدام في الطبقات الأحادية. تظهر الأورويدات اللفائفية غير المتمايزة المزروعة في ECM واضحة وكيسية في المورفولوجيا، مما يشير إلى وجود العديد من الخلايا الجذعية (الشكل 1A). مع مرور الوقت، قد تأخذ المعتضدات اللفائفية غير المتمايزة التي تنمو في وسائل النمو على النمط الظاهري الوسيط حيث يظهر البعض في سنسية وبعضها يبدو غير شفاف (الشكل1B). في كثير من الأحيان، لدينا عينات غير متمايزة تشبه تلك المبينة في الشكل 1B بدلا من الشكل 1A. تحتوي هذه الثقافات المتوسطة على خلايا مطية أكثر تمايزًا بشكل نهائي كما تقاس بالتعبير عن علامة الخلايا المعوية، والسوكرات isomaltase (SI)، ويفترض أن الخلايا المعوية الميتة المقذوفة في التجويف تساهم في مظهرها الكثيف. يمكن استخدام المعتريات اللفائفية في هذه الحالة المتوسطة لتطوير الطبقة الأحادية، ولكن يجب أن يوضع في الاعتبار أن كمية الخلايا الجذعية المعوية الموجودة في الثقافات قد تكون منخفضة، وبعض أنواع الخلايا المتمايزة قد تكون موجودة (على سبيل المثال، انظر qRT-PCR مستويات في عينات غير متمايزة نمت في ECM تشبه الشكل 1B في الشكل2). وللمقارنة، فإن المعتديين اللفائفي المثقفين بوسائط التمايز في ECM لمدة 5 أيام+ سوف يظهرون مظلمينبشكل موحد ومستووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووووو

يمكن تحليل التعبير عن جينات الخلايا الجذعية وجينات تمايز الخلايا المعوية بواسطة qRT-PCR كوسيلة أخرى لتقييم الحالة الصحية للمعتنية اللفائفية المزروعة في ECM وقدرات التمايز الخاصة بها مرة واحدة بذرك كطبقات أحادية على الآبار. يتم مقارنة التعبير عن جين الخلايا الجذعية، LGR5، جين الخلايا المعوية، SI،جين خلية الغبول، MUC2،وجين خلية بانيث، LYZ،بين الثقافات المعوية اللفائفية غير المتمايزة التي نمت في ECM واللفائفي المتمايزة الطبقات الأحادية المعوية في وجود أو غياب RANKL / TNFα (الشكل2). في حين أن القيم قد تختلف بين التجارب، يجب أن ينخفض التعبير عن LGR5 بعد تمايز الطبقات الأحادية18،26. لا يتم الكشف عن تعبير LGR5 عادةً في الطبقات الأحادية اللفائفية المتمايزة بدون RANKL وTNFα بحلول اليوم 7. وعلى العكس من ذلك، فإن التعبير عن علامات التمايز بين أنواع خلايا محددة، مثل SI وMUC2، يزيد بعد التمايز18. التعبير عن LYZ ينخفض عموما بعد التمايز في ثقافاتنا. إذا كانت الثقافات المعوية اللفائفية المستخدمة لجعل الطبقات الأحادية تبدو أكثر مثل الشكل 1B من الشكل 1A، قد تكون الزيادات في علامات التمايز المعوي متواضعة بعد التمايز لأن هذه الثقافات الأولية غير متجانسة في أنواع الخلايا المعوية ولها مستوى القاعدية أعلى من SI وMUC2. ومع ذلك، لا يزال التمايز في الطبقات الأحادية يحدث كما هو مُقيَّم بفقدان التعبير والفحص المجهري LGR5 (انظر أدناه). وعلاوة على ذلك، فإن إضافة RANKL وTNFα إلى وسائطالتمايز تقلل من فقدان تعبير LGR5 (الشكل 2). وبالتوازي مع ذلك، فإن تعبير SI وMUC2 أقل قليلاً مما هو عليه في الحالة المتمايزة التي تفتقر إلى RANKL وTNFα على الرغم من أن مستوياتها تزيد فوق الحالة غير المتمايزة.

يتم تحديد تمايز الخلايا M في الطبقات الأحادية عن طريق كل من qRT-PCR والفلورة المناعية باستخدام اثنين من علامات الخلية الخاصة بما في ذلك بروتين جليكو بروتين سطح الخلية 2 (GP2) وعامل النسخ SpiB21. التعبير عن GP2 وSPIB هو upregulated في الطبقات الأحادية المشتقة من التمعي في وجود RANKL وTNFα ولا يتم الكشف عنها في العينات المعالجة غير رانكل وTNFα (الشكل3). ويمكن أيضا أن يكون التعبير عن هذه العلامات تطبيع إلى قطعة من أنسجة الأمعاء الدقيقة22، إذا كان متوفرا. وهذا يسمح بتغيير أضعاف هذه علامات الخلية M لمقارنتها إلى الأنسجة التي تحتوي على خلايا M بدلاً من السيطرة على الطبقات الأحادية التي ليس لديها تعبير عن هذه العلامات ويسمح بالتوحيد بين التجارب في مختبر واحد. كما يتم الكشف عن الخلايا M عن طريق التعبيرالسطحي من GP2 عن طريق الفلورة المناعية (الشكل 4). عادة، في أحادية الطبقات confluent، لوحظ 1 إلى 5 M الخلايا في حقل المجهر معين في التكبير 40X من قبل أيام 6 إلى 8 ما بعد البذر في العينات المعالجة مع RANKL وTNFα (الشكل4A-D). لا ينظر إلى أي تعبير GP2 في العينات غير المعالجة (الشكل4E). تظهر الرؤية المتعامدة للطائرة XZ المطلة على مسبار فالودين هياكل الأكتين المحيطة بكل خلية والتعبير GP2 على السطح الأبيكي للخلايا M (الشكل 4F-G). هذا النموذج يلخص التردد المنخفض للخلايا M الموجودة في الأمعاء البشرية1،2،8. لتنقية وعزل الخلايا M لمزيد من الدراسة، يمكن تلوين الخلايا M باستخدام التعبير السطحي GP2 وفرزها باستخدام FACS لخلايا GP2+.

خلايا M ربط ونقل مستضد من التجويف المعوي إلى الخلايا المناعية المقيمة تحت ظهارة2. إفراز IgA المنتجة في الأمعاء يربط البكتيريا ويمكن أن تربط إلى سطح apical من الخلايا M لتسهيل نقل الميكروبات27،28. لتحديد ما إذا كانت الخلايا M المتقدمة في هذا النموذج قادرة على ربط IgA، يتم إضافة المصل البشري IgA إلى الغرفة العليا، ويسمح لربط لمدة 1 ساعة، ومن ثم يتم إعداد الطبقات الأحادية لتحليل الفلورة المناعية. يتم تصور وجود IgA على الخلايا M باستخدام جسم مضاد ثانوي مترافق الفلور الذي يتعرف على السلسلة الثقيلة من المصل البشري IgA. الخلايا M تعامل مع IgA لمدة 1 ح لديها IgA ملزمة إلى سطح apical (الشكل5A)،في حين أن الخلايا M في آبار التحكم التي تم التعامل معها فقط مع الأجسام المضادة الثانوية إلى IgA ليس لديها إشارة قابلة للكشف (الشكل5B). وعلاوة على ذلك، IgA يربط على وجه التحديد إلى سطح apical من الخلايا M ولم يتم العثور ملزمة لأي خلايا تفتقر إلى وصمة عار سطح GP2. وبالإضافة إلى ذلك، خلايا M لديها أكين أقصر بشكل مميز على سطحها apical2. لتحليل مورفولوجيا الخلية M في هذا النموذج، تزرع الطبقات الأحادية المستمدة من الإنعيال المعوي لمدة 7 أيام ويتم حصادها لتحليل الفلورة المناعية من F-أكتين باستخدام الفيلويدين. يتم حساب قياسات كثافة بكسل الأكتين للخلايا M والخلايا غير M المجاورة مباشرة لكل خلية M باستخدام برنامج ImageJ (الشكل6A). يتم تقليل كثافة الأكتين على خلايا GP2 + M في هذا النموذج وتظهر صورة تمثيلية في الشكل 6B. عموما، خلايا M التي وضعت في هذا النموذج أحادي الطبقة المستمدة من اللفائفي المعوي لها التعبير الجيني المميز، مورفولوجيا وبعض وظائف الخلايا M من الخلايا M المعوية البشرية، مثل ملزمة لIgA.

Figure 1
الشكل 1: مورفولوجيا تمثيلية للمعتّد اللفائفية البشرية في فترة ما بعد التقسيم لمدة أسبوع واحد. (أ) المعتجيات اللفائفية الواضحة والكيسية غير المتمايزة. (ب) النمط الظاهري المتوسط مع بعض المعتجية الكيسية والوأدخلات اللفائفية الفصية غير الشفافة. (C) معزوة وفصية متمايزة اللفائفي المعوية. الصور التي تم التقاطها من خلال عدسة المجهر الضوئي الضوئي في التكبير 4X باستخدام كاميرا iPhone7. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: التعبير النسبي للخلايا الجذعية وعلامات التمايز للمعويين اللفائفي البشري ينمون في إدارة المحتوى في المؤسسة أو يُميّزون كطبقات أحادية. نمت المعطيات اللفائفية لمدة 7 أيام في ECM (غير متمايزة) أو نمت وتميز كطبقات أحادية دون (متمايزة) أو مع RANKL وTNFα (متمايزة + R / T). تم حصاد الثقافات المعوية اللفائفية أو الطبقات الأحادية في تريزول لاستخراج الحمض النووي الريبي. تم تحديد التعبير الجيني من قبل qRT-PCR ويتم التعبير عنه بالنسبة لGAPDH. البيانات هي في المتوسط 3 آبار مستقلة من المعتَوَدال أو الطبقات الأحادية لكل حالة. أشرطة الخطأ تشير إلى SEM. لم يتم الكشف عن ND. تم تحديد الأهمية الإحصائية على القيم التي تم تحويلها إلى السجل باستخدام ANOVA في اتجاه واحد مع اختبار المقارنات المتعددة لـ Dunnett مقارنة مع غير المتمايزة. ** p < 0.01, *** p < 0.001 الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: التعبير النسبي للعلامات الخاصة بالخلية M GP2 وSPIB من الطبقات الأحادية المشتقة من اللفائفي البشري. تم حصاد الطبقات الأحادية المستمدة من اللفائفي البشري المعالج وغير المعالج في تريزول لاستخراج الحمض النووي الريبي بعد 7 أيام بعد البذر. تم تحديد التعبير الجيني من قبل qRT-PCR ويتم التعبير عنه بالنسبة لGAPDH. البيانات هي في المتوسط 6 طبقات أحادية مستقلة لكل شرط. أشرطة الخطأ تشير إلى SEM. لم يتم الكشف عن ND. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: الفلورة المناعية للتعبير السطحي GP2 على الخلايا M في الطبقات الأحادية المستمدة من اللفائفي البشري مع مرور الوقت. تم إصلاح الطبقات الأحادية المستمدة من اللفائفي البشري المعالج وغير المعالج في 4% من PFA وملطخة بالفلورة المناعية في الأيام المختلفة المشار إليها بعد البذر. تم تحليل الصور باستخدام برنامج ImageJ. DAPI = الأزرق; بروتين سكري 2 (GP2) = أحمر. (A-D) معالجة RANKL/TNFα الطبقات الأحادية في أيام مختلفة بعد البذر. (هـ) حصد الطبقة الأحادية غير المعالجة في اليوم السابع بعد البذر. (واو-زاي) متعامد XZ الطائرة من الطبقات الأحادية في اليوم 7 بعد البذر متراكبة مع التحقيق phalloidin لF-أكتين. فالودين = سماوي. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 5
الشكل 5: يربط IgA على وجه التحديد إلى السطح apical من الخلايا M. تم زراعة الطبقات الأحادية المستمدة من اللفائفي البشري المعالجة من قبلرانكل/TNFα لمدة 7 أيام ثم (أ) عولجت بـ 10 ميكروغرام من مصل الإنسان IgA لمدة ساعة واحدة أو (B) المعالجة وهمية مع PBS فقط (لا يوجد تحكم IgA). بعد 1 ساعة، تم غسل الطبقات الأحادية 2X في PBS، تم إصلاحها في 4٪ PFA، نفاذية مع 0.1٪ تريتونإكس-100، وملطخة للمناعة. تم تحليل الصور باستخدام برنامج ImageJ وهي تمثل 3 تجارب مستقلة. DAPI = الأزرق; بروتين سكري 2 (GP2) = أحمر; الأجسام المضادة إلى المصل البشري IgA = الأخضر. فالودين = سماوي. السهام السوداء تدل على IgA ملزمة إلى سطح apical من الخلية M. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 6
الشكل 6: خفضت الخلايا M كثافة الأكتين مقارنة بالخلايا غير M المجاورة. تم زراعة الطبقات الأحادية المستمدة من اللفائفي البشري المعالجة من RANKL/TNFα لمدة 7 أيام ثم تم إصلاحها في 4% PFA وكانت ملطخة بالفلورة المناعية. (أ) باستخدام ImageJ، تم تحديد خلايا GP2+ M باستخدام أداة التحديد الحر وقياسات المنطقة والكثافة المتكاملة التي تم أخذها في قناة Phalloidin. ثم تم إكمال نفس التحليل لكل خلية غير M المجاورة المجاورة المجاورة للخلية M. قسمت الكثافة خام يضمّ معدّلة كان بالمنطقة من كلّ خلية فرديّة لتطبيع. تم حساب متوسط الكثافة المتكاملة/المنطقة لكل خلية غير M متجاورة لكل خلية M. تم تحليل الصور من 3 تجارب مستقلة; كل نقطة هي خلية M أو متوسط الخلايا المجاورة. تشير أشرطة الخطأ إلى SD. تم تحديد الأهمية الإحصائية على القيم المحولة إلى السجل باستخدام اختبار t المقترن. ع = 0.0001 (B) صورة تمثيلية للطائرة XZ من مؤامرة في A. تم تحليل الصور باستخدام برنامج ImageJ. DAPI = الأزرق; بروتين سكري 2 (GP2) = أحمر; فالودين = سماوي. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Discussion

لتطوير الطبقات الأحادية التي تميز بشكل صحيح في أنواع الخلايا المعوية الرئيسية والخلايا M، فمن المهم أن تكون على بينة من عدة عوامل. يجب حصاد المعتجيات اللفائفية من ثقافات ECM غير المتمايزة ولديها نسبة عالية من الخلايا الجذعية Lgr5+. بصريا، لا ينبغي أن تكون مظلمة غالبية enteroids اللفائفي في ثقافات ECM ومتعددة الفص، وينبغي الكشف عن التعبير LGR5 في هذه الثقافات عن طريق تحليل qRT-PCR. مراقبة جودة الوسائط المكيفة أمر ضروري لنشر الثقافات غير المتمايزة مع مرور الوقت ويجب إكمالها لكل دفعة من الوسائط المكيفة التي يتم إنتاجها. يمكن إكمال مراقبة الجودة عن طريق اختبار دفعة جديدة من وسائل الإعلام على بعض الثقافات ECM ومقارنة مورفولوجيا enteroids اللفائفي إلى دفعة سابقة من وسائل الإعلام على مدى أسبوع. يجب أن يبقى التعبير LGR5 مشابهًا نسبيًا في الثقافات المعوية اللفائفية التي نمت في الدفعة الجديدة من الوسائط مقارنة بالدفعة السابقة.

أثناء إعداد enteroids اللفائفي للبذر كطبقات أحادية، من المهم أن ماصة بقوة حل الخلية بعد الحضانة مع التربسين لتفريق enteroids اللفائفي في خلايا واحدة. يمكن أن تؤدي كتل الخلايا إلى تشكيل متعدد الطبقات عند زرعها للطبقات الأحادية. وبالإضافة إلى ذلك، من الضروري أن تحدد تجريبيا عدد الخلايا اللازمة لتشكيل طبقة أحادية لكل خط إدخالي اللفائفي الفردية التي يتم الحصول عليها. عادة، يمكن أن تتراوح هذه القيمة من 2.5 × 105 - 5.0 × 105 خلايا / جيدا ولكن يعتمد على درجة الكيسي إلى الانفيال غير الكيسي المعوية في الثقافات ويختلف لكل خط إدخالي اللفائفي الفردية. من الخبرة، enteroids اللفائفي نمت في ECM التي تظهر أقل الكيسي تتطلب أعلى كثافة البذر الخلية لتحقيق الطبقات الأحادية. فمن المستحسن لغسل الغرفة العليا بعد يوم واحد من النمو عن طريق الأنابيب بلطف وسائل الإعلام صعودا وهبوطا 2-3 مرات واستبدالها مع وسائل الإعلام النمو جديدة. هذه العملية يزيل الخلايا التي هبطت على رأس الخلايا الأخرى مما يقلل من احتمال تشكيل متعدد الطبقات. تبديل وسائل الإعلام في الغرفة العليا من وسائل الإعلام النمو إلى وسائط الخلية M عندما تكون الطبقات الأحادية ~ 80٪ confluent، والذي يحدث عادة في اليوم 2 بعد البذر، يساعد على تحقيق التمايز جيدة الخلية M. إضافة RANKL / TNFα إلى الغرفة العليا أثناء تحريض الخلية M لا يؤدي إلى تطوير عدد أكبر من الخلايا M لكل طبقة أحادية، وبالتالي يمكن تركها خارج وسائل الإعلام الغرفة العليا. يمكن استخدام Transwells من أحجام المسام متفاوتة في هذا البروتوكول دون التأثير على تطوير الخلية M; ومع ذلك، يجب تحسين كثافة بذر الخلايا لأولئك الذين لديهم أحجام المسام أكبر. الكولاجين الرابع يمكن أن تحل محل ECM كطلاء بروتين غشاء الطابق السفلي لtranswells أو لوحات جيدا التي قد تكون أكثر ملاءمة لتطبيقات معينة.

توفر الطبقات الأحادية المشتقة من اللفائفية المعوية على الترانسويلز نظام ًا من غرفتين يسمح بإنشاء أسطح محددة من الأوابيك والأطراف الباعية بحيث يمكن للأنواع المختلفة من الخلايا المعوية الظهارية أن تستقطب للتعبير عن علامات السطح على كل منها الجانب بالنسبة لتلك الموجودة في الأمعاء. يمكن إضافة عوامل إضافية إلى أي من الجانبين مثل الجسيمات أو العوامل المعدية أو أنواع الخلايا الأخرى. ومع ذلك، لا تزال هناك حتى الآن بعض القيود. كما هو موضح، هذا النظام هو نظام ثابت يفتقر إلى التدفق الفسيولوجي، وتقلصات الأمعاء، ومحتويات الأمعاء. وبالإضافة إلى ذلك، يتم فقدان الهندسة المعمارية فيلوس سرداب من خلال تشكيل طبقة أحادية مسطحة. هذه النظم تفتقر إلى مناطق التصحيح باير، والخلايا المناعية، والخلايا سترومال. ما إذا كان نقص الخلايا المناعية والسترومال المقيمة عن كثب تحت الخلايا M يؤثر على الإسراف التي لا لوحظت في هذا النظام والأداء الفسيولوجي ة الأخرى هو مجال مهم في المستقبل للتحقيق. يمكن تكييف هذا البروتوكول مع لوحة 96 جيدا أو تنسيق لوحة متعددة جيدا. لا يزال إجراء طلاء لوحة 96 جيدا مع ECM والبذر مع خلايا واحدة من enteroids اللفائفي هو نفسه بالنسبة للترانسويلز. يجب أن يتم معايرة كثافة بذر الخلايا المطلوبة للحصول على الطبقات الأحادية، ولكن عادة ما تتراوح بين 1.0 × 105 - 3.0 × 105 خلايا / جيدا في شكل لوحة 96 جيدا. يتم حث الخلايا M عن طريق استبدال وسائل الإعلام النمو مع وسائط الخلية M عندما تكون الطبقات الأحادية 80٪ الملتحمة عادة من قبل أيام 1-3 اعتمادا على كثافة البذر الخلية الأولية.

توفر هذه الطريقة للتميّز خلايا M من المعتَدِّد اللفائفي في المختبر تحسينات كبيرة على طريقة كاكو-2. المعوّقات اللفائفية هي خلايا أولية وعلى الأقل 4-5 أنواع الخلايا الظهارية موجودة في النظام. وبالإضافة إلى ذلك، يمكن دراسة خطوط اللفائفي المعوية المستمدة من أشخاص مختلفين للتحقيق في كيفية تأثير علم الوراثة أو مرض الدولة على تطوير الخلية M والسلوك. ومن شأن التلاعب الإضافي بالأمعاء اللفائفية أثناء تمايز الخلايا M أن يسمح بفهم أفضل لتطوير الخلايا M بما في ذلك توصيف الخلايا السلائفية للخلايا M. وأخيرا، منذ الآليات الجزيئية من M الخلية phagocytosis وtranscytosis لا تزال غير مفهومة تماما3،29، وهذا النموذج يوفر الفرصة لدراسة وتصور مستضد والتقاط الجسيمات من قبل الخلايا M.

Disclosures

وليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

وقد دعم هذا العمل المعهد الوطني للتنمية الدولية U19AI131126 إلى الدكتور إيسبرغ (كلية الطب بجامعة تافتس) والدكتور كابلان (جامعة تافتس)؛ (JM هو زعيم المشروع 2) وNIAID R21AI128093 إلى JM. وقد تم دعم ACF جزئيا من قبل NIAID T32AI007077. وقد تم دعم SEB وMKE من قبل NIAID U19AI116497-05. نشكر أعضاء مختبر Mecsas، ومختبر Ng، والدكتور Isberg في كلية الطب بجامعة تافتس على المناقشات المفيدة. تم إجراء التصوير البؤري في مركز تافتس لبحوث علم الأعصاب، P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics