המושרה בידול של תאים כמו תא בתאי גזע האדם-הנגזר הנגזרת מונאואיד Monolayers

Immunology and Infection
 

Summary

פרוטוקול זה מתאר כיצד לגרום את הבידול של תאים M בתאי גזע האדם הנגזר ileal monolayers ושיטות כדי להעריך את התפתחותם.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (microfold) תאים של תפקוד המעי כדי להעביר את האנטיגן מן פסגה לומן לתוך טלאים של peyer בבסיס ולאמה קיננה שבו תאים חיסוניים מתגוררים ולכן לתרום חסינות רירית במעי. הבנה מלאה של איך תאים M להבדיל במעי, כמו גם מנגנונים מולקולריים של ספיגת אנטיגן על ידי תאי M חסר. הסיבה לכך היא שתאי M הם אוכלוסיה נדירה של תאים במעי ומשום שבמודלים של מבחנה עבור תאים M אינם חזקים. התגלית של מערכת לחידוש עצמי התרבות תא גזע של המעי, כינה enteroids, סיפקה אפשרויות חדשות עבור תאי culturing M. בידור הם יתרון על פני קווי התאים הסטנדרטיים תרבותי כי הם יכולים להיות מובחנים לכמה סוגי תאים עיקריים נמצא המעי, כולל בתאי גביע, Paneth תאים, בידור תאים האנדוקריניים ו-enteroids. הציטוקין RANKL חיוני בפיתוח תא M, והוספה של RANKL ו-TNF-α לתקשורת התרבות מקדמת תת מערכת של תאים מתוך הenteroids להבדיל לתאי M. הפרוטוקול הבא מתאר שיטה עבור בידול של תאי M במערכת האפיתל הטרנסג transwell של המעי באמצעות האדם בידור. ניתן להחיל שיטה זו על חקר הפיתוח והתפקוד של תא M.

Introduction

M (microfold) תאים הם מיוחדים תאים אפיתל המעי נמצא בעיקר האפיתל הקשורים זקיק (מיסטים) של המעי ואזורים הלימפה קטנים כינה טלאים של Peyer1. תאי M יש קצר מיקרוical מיקרו-הרשמי והוא הפכפך עמוקות על הצד הבאסולולי שלהם, אשר מאפשר לתאי החיסון לשכון באופן צמוד לגוף התאים שלהם2. זו מורפולוגיה ייחודית מאפשרת לתאי M לדגום אנטיגן מן לומן פסגה של המעי ולספק אותו ישירות לתאים החיסוניים הבסיסיים2. בדרך זו, תאי M חשובים עבור מעקב החיסונית במעי, אבל יכול להיות גם ניצל על ידי פתוגנים עבור כניסה לתוך לאמנה קינא1,2,3,4,5, 6,7.

המחקר של תאים M הפריע מספר גורמים. ראשון, תאי M נמצאים בתדר נמוך בעכבר המעי האנושי8. במערכות התאים המתורבתות, תאי התאים של M-תאים המושרה להבדיל על ידי co-culturing קו מקוטב אדנוקרצינומה התא, caco-2, עם לימפוציטים או b מתוך הטלאים של peyer של העכבר או התא B לימפומה התא, ראג'י B9,10 . זה התוצאות בקבוצת משנה של caco-2 תאים אשר לבטא את סמני תא M sialyl לואיס אנטיגן ו uea-1 ב אפיתל מקוטב9,10. (סמנים אלה מבוטאים גם על תאי גביע ברקמות המעיים, אז כיום הם משמשים לעתים קרובות פחות כסמני תא M הסופי11,12.) זה caco-2-M תא מערכת שימש לחקר ספיגת חלקיקים וחיידקים טרנסלוקציה13,14. עם זאת, תאים Caco-2 הם קו התא הוקמה מתוך אדנוקרצינומה מעיים גדול עם גורם מייסד כי מקורות שונים של Caco-2 תאים להציג פנוטיפים שונים בין מעבדות15. יתר על כן, הם לא יכולים לחלוטין לכידה של רמות שעתוק של תאים M אמיתי, כפי שהם חוסר הבעה של הידוע כיום GP2 סמנים תא ו-SpiB16. לכן, מודלים נוספים מבחינה פיזיולוגית התרבות הרלוונטית נדרשים כדי להיות מסוגל ללמוד פיתוח תא של M פונקציות.

בתוך עשר השנים האחרונות, השדה של מערכות מודל בידור הנגזרות של המעי התקדם במהירות קדימה מן התגלית הראשונית כי תאי גזע מעיים נגזר ביופסיה של המעי האנושי יכול להפיץ עצמית ולחדש בתרבות מיכל בן 17 , 18. חשוב, הסרת תא גזע קידום גורמים מן התקשורת הצמיחה מאפשר אלה תאי גזע התרבויות להבדיל לתוך סוגי תאים רבים שנמצאו המעי18. יתר על כן, העבודה האחרונה מציעה את החשיבות של האיתות rankl-דרגה בפיתוח תא M במעי19,20. הקולטן דירוג הוא חבר של משפחת TNF של קולטנים כי הוא מתבטא על התאים מקודפי האפיתל במעי19 בעוד rankl (לגאת הקולטן דירוג) הוא שוחרר על ידי תאים סטרומה של הטלאים של peyer20. מאז סוגי תאים אפיתל להציג ileal בידור לא לייצר rankl, M תא בידול בתרבויות ileal בידור יכול להיגרם על ידי תוספת rankl לתקשורת התרבות21,22. הכללת TNFα במדיית התרבות מסייעת לתמוך פיתוח תא M ב-בידור מדיום23. כאן, אנו מתארים את השיטות לגרימת הבידול של תאי M ב מעיים monolayers נגזר מתוך בידור אנושי. השיטות שלנו מבוססות בחלקו על שינויים מתוך הפרוטוקולים הבאים21,22,23.

Protocol

כל השיטות המתוארות כאן אושרו על ידי אוניברסיטת טאפטס IBC ו IRB.

1. גרימת בידול התא באמצעות המעי האנושי בידור-מונאולאיירס נגזר

הערה: פרוטוקול זה משתמש ב-ileal בידור שנגזר מביופסיה של רקמת האדם. נא לעיין פרוטוקולים שפורסמו עבור שיטות על איך לצמוח ומעבר תאים אלה18,24. השיטות הבאות לפיתוח מונאולאיירס הותאמו מ-Zou et al.24. שיטות לגרימת תאים M ב התרבויות הנגזרות ileal, הותאמו מדיווחים קודמים21,22,23. כל העבודות מתבצעות במכסה התרבותי של הרקמה הסטרילית, והincubations באינקובטור של תרבות הרקמה כמצוין. ראה את הטבלה של חומרים הדרושים כדי להכין ileal בידור monolayers ומדיה שונים.

  1. הגדל ileal בידור עבור 4-10 ימים ב מטריצה החילוץ (ECM) (ראה טבלה של חומרים) (איור 1), בהתאם לקצבי הצמיחה הפנימיים שלהם, לפני זריעה על טרנסולס.
  2. ממברנות כיסויים
    1. הניחו את מספר הטרנסוולס הרצוי בצלחת של 24 שעות ביצירת מערכת דו-קאמרית.
    2. לדלל ECM 25-מקפלים קר מלוחים סטרילי באגירה המלח (PBS) ולהוסיף 100 μL של פתרון קר מדולל לתוך כל תא עליון על הקרום.
      הערה: את הפתרון ECM ומדולל יש לשמור על הקרח עד מיד לפני חיבור.
    3. כסו את הצלחת 24-באר עם מכסה ומניחים את הצלחת לתוך חממה לתרבות רקמות ב 37 ° צ' עבור 2 h כדי להתיר מיצוק ECM על הקרום.
    4. לאחר 2 h, להסיר את הצלחת מן החממה ומקום בשכונה תרבות רקמה. שימוש בפינצטה סטרילית, היפוך כל transwell כדי להסיר בעדינות את הפתרון הנותר. הניחו לקרומים להתייבש בכיפה עם המכסה הפתוח בזמן איסוף התאים (שלבים 1.3.1-1.3.11).
  3. הנתק את בידור ה-ileal לתאים בודדים
    1. הסר את הצלחת של ileal בידור מן החממה ולהסיר בעדינות את מדיית התרבות מכל הבאר על ידי שאיפה ואקום או עם פיפטה.
      הערה: אחד היטב של בידור באמצעות המכיל כ 100 ציסטות בריאות מספיקה זרע 1.5-2 בארות.
    2. להוסיף 500 μL של קרח קר 0.5 mM השפעת החומצה (EDTA) על כל טוב המכיל את מזהי ileal מושעה ECM לשבור את ECM. פיפטה למעלה ולמטה במרץ עם P1000 ttor להגדיר ב 500 μL כדי לשבור ECM ובכך לשחרר את ileal הפתרון. כדי לשפר את פירוק ECM, לאחר ליטוף, לנענע את הצלחת במרץ 4 ° צ' עבור 30 דקות.
    3. לאסוף את הפתרון מכל טוב לתוך 15 מ ל שפופרות חרוט.
      הערה: איסוף עד 10 בארות לכל 15 מ"ל שפופרת חרוטי עבור אוסף מיטבי של תא יחיד.
    4. גלולה את התאים בצנטריפוגה ב 140 x g ו 4 ° צ' עבור 5 Min. גלולה צריך להיות גלוי אבל יכול בקלות להיות מחוץ, כך לאט להסיר את supernatant על ידי שאיפה ואקום או עם פיפטה.
      הערה: אם מודאגים לגבי אובדן של גלולה ותאים, השתמש בפיפטה ושמור את הסופרנטנט בצינור נפרד.
    5. כדי לעכל את הקשרים הדוקים הצומת ולשבור את ileal בידור לתוך תאים בודדים, להשעות את הגלולה ב 500 μL של טמפרטורת החדר טריפסין לכל 5 בארות שנאספו בשלב 1.3.3. באמצעות P1000, פיפטה למעלה ולמטה כדי לשלול את הגושים ואת המדגירה את הצינורות באמבט מים 37 ° c עבור 5 דקות או פחות.
      הערה: אופטימיזציה יש צורך לקבוע את כמות הזמן המתאים הנדרש כדי לאתר את הצינורות כך התאים הם שבורים אבל לא מעל טריסיזציה לנקודה שהם מתים. השתמש ב1.3.9 הכחול בשלב הפעולה כדי להבטיח שהתאים הם מעשי לאחר הטיפול בטריפסין.
    6. הוסף 1 מ ל של DMEM מתקדם/F12 עם 10% סרום שור עוברי (FBS) לכל 500 μL של טריפסין כדי להשבית את טריפסין.
    7. פיפטה למעלה ולמטה עם P1000 להגדיר ב 500 μL לפחות 50 פעמים נגד הצד של צינור החרוט כדי להפוך את הגושים הנותרים לתאים בודדים.
    8. מניחים מסננת תא 40 יקרומטר על גבי 50 mL ו להוסיף 1 mL של dmem תקדם/F12 עם 10% fbs להרטיב את מסננת התא. פיפטה תא הבולם היחיד מ 15 מ ל חרוט על המסננת. שטוף את המסננת עם 1 מ ל של DMEM תקדם/F12 עם 10% FBS.
    9. העבר את התאים שעברו את מסננת התא מן 50 mL חרוט לתוך צינור חדש 15 mL חרוט. במהלך 1.3.10 שלב צנטריפוגה, הגלולה הסלולרית יהיה בקלות יותר לראות בתוך 15 מ"ל צינור חרוט. לספור את התאים באמצעות הומוציטומטר. השתמש בכחול טרי, כדי לוודא. שהתאים עדיין בחיים בדרך כלל, הכדאיות של > 95% נצפתה.
    10. בזמן ספירת התאים, צנטריפוגה את התאים בצינור החדש של 15 מ ל ב-400 x g וטמפרטורת החדר עבור 5 דקות. גלולה תא צריך להיות גלוי. הסירו בזהירות את הסופרנטנט עם הפיפטה, והצלתי שוב את הסופרנטאנט במקרה שהגלולה הופכת להיות מחוצה.
    11. ההכנה שונה מדיה צמיחה מלאה25 (mcmgf + מדיה) שיושלם עם 10 Μm Y-27632. השהה מחדש את התאים הפלתד ב-2.5 x 10 תאים/200 μL בתוך MCMGF +. ראה הערות בדיון אודות אופטימיזציה של מספר זריעת תאים.
      הערה: MCMGF + מדיה היא DMEM תקדם/F12 עם 75% L-Wnt3a התקשורת הממוזגת, 10% R-לחתן מדיה ממוזג, 5% המדיה ממוזג, 1x B27 תוספת, 1x N2 תוספת, 1 מ"מ N-acetylcysteine, 50 ng/mL העכבר רקומביננטי EGF, 500 nM-8301, 10 ננומטר [Leu15]-גסטרין 10 מ"מ HEPES, 2 מ"מ גלוטמקס, ו-1x פניצילין/סטרפטומיצין (אופציונלי).
    12. ודא כי ממברנות ECM מצופה הכין בשלב 1.2 התייבשו לחלוטין, כפי שמוערך על ידי העין. לשטוף את התא העליון עם 200 μL של MCMGF +. הוסף 200 μL של פתרון התא לתוך כל תא עליון.
    13. הוסף 700 μL של MCMGF + עם 10 μM Y-27632 לכל תא תחתון. מניחים את הצלחת ב 37 באינקובטור התרבות בשנת צלסיוס עם 5% CO2.
    14. לאחר יום אחד של צמיחה, להסיר את המדיה מהתא העליון ולהחליף עם 200 μL של טרי MCMGF +, כדי למנוע צמיחה של שכבות תא מרובות.
  4. החלפת אמצעי בינוני
    1. לאחר monolayers הם ~ 80% confluent, בדרך כלל בין ימים 1-3 לאחר זריעה, להחליף מדיה basolateral עם בידול מדיה (DM) עבור בארות בקרה (ראה שלב 1.4.2 לפרטים נוספים) או עם מדיית התא M עבור M האינדוקציה תא בארות (ראה שלב 1.4.3 לפרטים נוספים). החלף את המדיה בחדר העליון עם DM עבור שני התנאים.
      הערה: מיט הוא מתקדם DMEM/F12 עם 5% מדיה ממוזג, 1x B27 תוספת, 1x N2 תוספת, 1 מ"מ N-acetylcysteine, 50 ng/mL רקומביננטי EGF, 500 nM-8301, 10 ננומטר [Leu15]-גסטרין I, 10 מ"מ מאגר HEPES, 2 מ"מ גלוטמקס, ו-1x פניצילין/סטרפטומיצין (אופציונלי ). M מדיה תא הוא DM בתוספת עם 200 ng/mL RANKL ו 50 ng/mL TNFα.
    2. עבור בארות שליטה כי לא צריך להכיל M תאים, להוסיף 200 μL של מיט אל החדר העליון ו 700 μL DM לחדר התחתון.
    3. כדי לגרום לתאי M, להוסיף 200 μL של מיט אל החדר העליון ו 700 μL של מדיית תא M לחדר התחתון.
    4. החליפו את המדיה כל יומיים. עבור בארות בקרה, להחליף מיט בחדרי העליון והתחתון. עבור בארות תא M, להחליף מיט בחדר העליון ומדיה תא M בחדר התחתון.
      הערה: ביום 7 הודעה לאחר זריעת תאים, תאי M הם המושרה באופן מלא ב monolayers.

2. אימות מידול התא באמצעות רביעיית-PCR

הערה: בצע את העבודה הבאה בשטח ספסל סטרילי מבית RNAse. ראה טבלת חומרים לרשימת חומרים מועדפים לרביעיית ה-PCR.

  1. להסיר את המדיה מתאי העליון והתחתון ולשטוף את התא העליון 2x בעדינות עם 300 μL של טמפרטורת החדר PBS.
  2. הוסף 300 μL של Trizol לכל תא עליון. דגירה בטמפרטורת החדר עבור 5 דקות.
    התראה: לבשו כפפות והגנה על העין בעת שימוש Trizol כדי למנוע מגע עם העור כפי שמצוין הוראות היצרן.
  3. בינתיים, תוויות מיקרוצנטריפוגה התווית עבור כל טוב ולהוסיף 700 μL של Trizol לכל צינור.
  4. לאסוף תא המגון לאכול על ידי pipetting למעלה ולמטה 3x בעדינות עם P1000 ולהעביר את התוכן לתוך צינור מיקרוצנטריפוגה המקביל. מערבולת עבור 5 s לערבב.
  5. שמרו את הדגימות בטמפרטורת החדר עבור 3 דקות נוספות. ואז לאחסן ב-80 ° צ' עד חודש אחד.
  6. בצע את מתודולוגיית רביעיית ה-PCR הסטנדרטית לבידוד RNA, טיפול DNase, תמלול הפוכה ותגובות לרביעיית ה-PCR. יש לעיין ברשימת החומרים התחל.

3. אימות תא בידול על ידי Immunofluorescence

הערה: שמרו תמיד על החדר התחתון של הלוחית המלאה ב-PBS, כך שקרום הקרומים יישאר רטוב. הליך זה מבוצע על הספסל. ראה טבלת חומרים לקבלת רשימה של חומרים מועדפים לאימונולואורסנס.

  1. להסיר את המדיה מהתא העליון ולשטוף 2x בעדינות עם 300 μL של טמפרטורת החדר PBS. הוסף 100 μL של טמפרטורת החדר 4% כיתה בערוץ PBS לחדר העליון. מכסים את הצלחת בנייר כסף ומאפשרים לעמוד 25 דקות בטמפרטורת החדר. . הסירו 4% לכיוון הבמה
    התראה: 4% כלפי התחתית צריך להיות מושלך כראוי כפסולת כימית מסוכנת.
  2. לשטוף את החדר העליון 3x עם 300 μL של טמפרטורת החדר PBS. בשלב זה, הדגימות יכולות להישאר ב -4 ° c עד חודש לפני הצביעת. לאחר מוכתם, דגימות צריך להיות דמיינו בתוך שבוע לתמונות באיכות הטובה ביותר.
  3. מודטה the monolayers עם 100 μL של 5% בסרום בקון (BSA) הומס PBS עבור 30 דקות בחושך בטמפרטורת החדר כדי לחסום את monolayers.
  4. הכינו פתרון נוגדן ראשוני GP2 בשנת 1% BSA ב-PBS בדילול של 1:100. הוסף 100 μL לכל היותר. . כתם ל -1 בטמפרטורת החדר בחושך הסר את הפתרון.
    הערה: אין לחדור את monolayers לפני הכתם העיקרי עבור GP2 מתרחשת מכיוון אופטימלית הראשי GP2 פני השטח של תאי M מושגת ללא חדירות.
  5. לשטוף את התא העליון 3x פעמים עם 300 μL של טמפרטורת החדר PBS.
  6. להכין את הפתרון כתם משני של מתויג בקצב עז נגד עכבר IgG ב 1:200, phalloidin ב 1:100 ו DAPI ב 1% BSA + 0.1% טריטון ב-PBS. הוסף 100 μL לכל היותר. כתם 30 דקות בטמפרטורת החדר בחושך.
    הערה: טריטון מתווסף לפתרון כתם משני כדי לחלחל את התאים במהלך שלב זה עבור הכתם phalloidin הנכון.
  7. שטוף 3x עם 300 μL PBS.
  8. מניחים 5 שטיפת μL של פתרון ההרכבה (טבלת חומרים) על מגלשת זכוכית. להסיר את הבאר מ 24 צלחת ולהפוך. חותכים בזהירות את הקרום מתוך הבאר באמצעות אזמל. הצב את הקרום עם התאים הפונים כלפי מעלה אל ה-droplet של הפתרון הגובר על שקופית הזכוכית. הוסף 10 μL של פתרון ההרכבה על החלק העליון והמרכז של הקרום ומניחים שמיכות על גבי כדי לאטום את הקרום בין שקופית הזכוכית לבין coverslip.
  9. יבש את השקופיות בטמפרטורת החדר בחשכה עבור 24 שעות. שקופיות ויטראז צריך להיות מדמיינו על מיקרוסקופ קונפוקלית וקד בתוך שבוע 1 לאחר כתמים.

Representative Results

בידור האילנואידים גדל ECM הם נותחו ויזואלית על ידי רביעיית ה-PCR עבור מצב הבריאות היחסי שלהם מדינות בידול כאמצעי איכות בקרת התרבויות ileal בידור ו לשימוש monolayers. מובחן בידור ileal גדל ב-ECM מופיעים ברורים פיברוזיס במבנה מורפולוגיה, המציין נוכחות של תאי גזע רבים (איור 1A). במשך הזמן, מובחן בידור ileal גדל במדיה הצמיחה עשוי לקחת על פנוטיפ ביניים שבו כמה יופיעו פיברוזיס וחלקם מופיעים אטום (איור 1B). לעתים קרובות, הדוגמאות שלנו מובחן דומות לאלה המוצגות באיור 1B ולא באיור 1b. אלה תרבויות ביניים מכילים יותר מבדיל סופני מובחנים כאשר נמדד על ידי ביטוי של סמן בידור, sucrase איזואלבורסה (SI), וכנראה הבלטת בידור מת בתאי לומן לתרום המראה הצפוף שלהם. בידור ileal יכול לשמש במצב ביניים זה לפיתוח מונאולייר, אך יש לזכור כי כמות תאי גזע המעיים המצויים בתרבויות עשויה להיות נמוכה, וחלק מסוגי התאים המבודקיים עשויים להופיע (לדוגמה, ראה רביעיית-PCR רמות בדגימות מובחן גדל ECM דמוי דמות 1B באיור 2. לעומת זאת, ileal בידור תרבותי עם מדיה בידול ב ECM עבור 5 + ימים יופיעו בצורה אחידה הכהה ולאוולי ותרבויות עם המבנה הזה הם לא מועמדים טובים לזריעת monolayers (איור 1C).

ביטוי של הגנים גזע תאים וגנים של בידול תא מעיים ניתן לנתח על ידי רביעיית PCR כאמצעי אחר כדי להעריך את מצב הבריאות של ileal בידור גדל ECM ואת יכולות הבידול שלהם פעם הופרה כמו monolayers על טרנסבארות. הביטוי של הגן תא גזע, LGR5, גן בידור, SI, גן של תא של גביע, MUC2, ו Paneth תא גן, lyz, מושווה בין תרבויות מובחן ileal בידור גדל ecm ו ileal הבדיל enteroid monolayers בנוכחות או העדר של RANKL/TNFα (איור 2). בעוד הערכים עשויים להיות שונים בין ניסויים, ביטוי של LGR5 צריך להקטין לאחר הבידול של monolayers18,26. LGR5 ביטוי הוא בדרך כלל לא מזוהה ileal הבדיל מבלי rankl ו-TNFα ביום 7. לעומת זאת, ביטוי של סמנים של בידול של סוגי תאים ספציפיים, כגון SI ו MUC2, להגדיל לאחר בידול18. ביטוי של Lyz יורדת בדרך כלל לאחר בידול בתרבויות שלנו. אם התרבויות ileal המשמש לעשיית monolayers להיראות כמו איור 1B מאשר איור 1b, עליות סמנים בידול מעיים עשוי להיות צנוע לאחר בידול כי התרבויות הראשוניות האלה הם הטרוגנית תאי מעיים ובעלי רמת בסיס גבוהה יותר של SI ו- MUC2. עם זאת, הבידול במונאולאיירס עדיין מתרחשת כאומדן על ידי אובדן של LGR5 ביטוי מיקרוסקופ (ראה להלן). יתר על כן, תוספת RANKL ו-TNFα לתקשורת בידול מפחית את אובדן הביטוי LGR5 (איור 2). במקביל, הביטוי של SI ו MUC2 הם מעט נמוך יותר מאשר במצב הבדיל חסר Rankl ו tnfα למרות רמות שלהם להגדיל מעל המצב מובחן.

M בידול התא monolayers נקבע הן על ידי רביעיית-PCR ו immunofluorescence באמצעות שני סמנים מסוימים תא M כולל משטח תא גליקופרוטאין 2 (GP2) ושעתוק פקטור SpiB21. ביטוי של GP2 ו- spib הוא upregulated ב בידור ileal בתוך מונו הנגזר בנוכחות Rankl ו tnfα והוא לא זוהה ב-Rankl ו tnfα התייחסו דגימות (איור 3). ביטוי של סמנים אלה יכול גם להיות מנורמל לחתיכת רקמת המעי הקטנה22, אם זמין. זה מתיר את שינוי הקיפול של אלה סמנים תא M להיות מושווה לרקמות כי יש תאים M במקום לשלוט monolayers כי אין להם ביטוי של סמנים אלה ומאפשר סטנדרטיזציה בין ניסויים במעבדה אחת. תאי M מזוהים גם על ידי הביטוי פני השטח של GP2 על ידי מאימונולואואורוסנס (איור 4). בדרך כלל, במונאולייר שוטפת, 1 עד 5 תאים שנצפו בשדה מיקרוסקופ נתון בהגדלה של 40X על ידי ימים 6 עד 8 לאחר זריעה בדגימות שטופלו RANKL ו-TNFα (איור 4א-ד). אין GP2 ביטוי בדגימות שאינן מטופלות (איור 4E). התצוגה אורתוגונלית של מטוס xz מצופה בדיקה phalloidin מראה אקטין מבנים סביב כל תא ו GP2 ביטוי על פני השטח הרשמי של M תאים (איור 4F-G). מודל זה מסכם את התדירות הנמוכה של תאי M המצויים במעי האנושי1,2,8. כדי לטהר ולבודד תאי M למחקר נוסף, תאי M יכול להיות מוכתם באמצעות GP2 ביטוי פני השטח מיון באמצעות FACS עבור GP2 + תאים.

תאים M לאגד אנטיגן הובלה מן המעיים לומן אל התאים החיסוניים המתגוררים מתחת האפיתל2. הפרשה IgA המיוצר במעי נקשר חיידקים והוא יכול לאגד את פני השטח פסגה של התאים M כדי להקל על התחבורה של חיידקים27,28. כדי לקבוע אם התאים M שפותחו במודל זה הם מסוגלים לאגד IgA, נסיוב האדם IgA מתווסף לחדר העליון, מותר לאגד עבור 1 h, ולאחר מכן monolayers מוכנים ניתוח מimmunofluorescence. הנוכחות של IgA על התאים של M הוא דמיינו באמצעות משני fluor-מעלה נוגדנים המכיר את השרשרת הכבדה של הנסיוב האנושי IgA. תאי m מטופלים עם IgA עבור 1 h יש IgA כרוך לפני השטח הרשמי (איור 5A), ואילו תאים M בבארות שליטה שטופלו רק עם הנוגדן המשני כדי IgA אין אות לזיהוי (איור 5a). עוד, IgA מאגד במיוחד לפני השטח הרשמי של M תאים ולא נמצא מאוגד לתאים כלשהם חסר GP2 פני השטח. בנוסף, תאי M יש כאופייני אקטין צפוף צפופה על פני השטח הרשמי שלהם2. כדי לנתח את המבנה התאי של M במודל זה, מונאולאן הנגזר של ileal מגודלים במשך 7 ימים וקוצרים עבור ניתוח מimmunofluorescence של F-actin באמצעות phalloidin. מדידות של עוצמת פיקסלים אקטין מחושבים עבור תאים m ועבור תאים שאינם מתוצרת M הסמוכים ישירות לכל תא M באמצעות תוכנת imagej (איור 6a). עוצמת actin מופחתת על GP2 + M תאים במודל זה ותמונה ייצוגית מוצג באיור 6B. באופן כללי, התאים M שפותחו במודל זה ileal הנגזר מודל מונאולאר יש ביטוי גנטי אופייני, מורפולוגיה וכמה פונקציות תא M של תאי המעי האנושי, כגון קשירה ל-IgA.

Figure 1
איור 1: המבנה הייצוגי של בידור המעי האנושי ב-ECM בשבוע שלאחר הפיצול. (A) ברור ו פיברוזיס מובחן בידור. (ב) פנוטיפ ביניים עם מספר בידור סיסטיק-פיברוזיס וכמה מחלות אטימות מסוג lobular. (ג) הכהה ולוייתי הבדיל בידור המעי העקום. תמונות שנלקחו דרך העדשה של מיקרוסקופ אור אופטי בהגדלה 4x באמצעות מצלמת iPhone7. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: הביטוי היחסי של תא גזע ו בידול של האדם בידור החיים גדל ECM או הבדיל כמו monolayers. Ileal בידור גדלו במשך 7 ימים ב ECM (מובחן) או גדל והבדיל כמו monolayers ללא (הבדיל) או עם RANKL ו TNFα (הבדיל + R/T). תרבויות ileal בידור או monolayers נקצרו Trizol להפקת RNA. הביטוי הגנטי נקבע על ידי רביעיית ה-PCR והוא מבוטא ביחס למנד- dh. נתונים הוא ממוצע של 3 בארות עצמאיות של מוננואידים או monolayers לכל תנאי. קווי שגיאה מציינים כי SEM. ND אינו מזוהה. מובהקות סטטיסטית נקבע על ערכים השתנה ביומן באמצעות ANOVA חד כיוון עם השוואות מרובות של דאננט מבחן השוואת מובחן. * * p < 0.01, * * * p < 0.001 נא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: ביטוי יחסי של תא M סמנים ספציפיים GP2 ו spib מן האדם ileal בידור הנגזר monolayers. Rankl/TNFα טיפל לא מטופלים האנושית ileal בידור הנגזר monolayers נקצרו Trizol להפקת RNA לאחר 7 ימים שלאחר זריעה. הביטוי הגנטי נקבע על ידי רביעיית ה-PCR והוא מבוטא ביחס למנד- dh. הנתונים ממוצעים ב -6 מונאולאיירס עצמאיים לכל תנאי. קווי שגיאה מציינים כי SEM. ND אינו מזוהה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: Immunofluorescence הבעה של פני השטח GP2 ביטוי על התאים M של האדם בידור מונאיד הנגזר monolayers לאורך זמן. RANKL/TNFα מטופל ובלתי מטופלים האנושית ileal בידור הנגזר מונאולאיירס שהיו קבועים ב 4% כדור הדור הלבן ומוכתם עבור immunofluorescence על ימים שונים המצוין לאחר זריעה. התמונות נותחו באמצעות תוכנת ImageJ. DAPI = כחול; גליקופרוטאין 2 (GP2) = אדום. (A-D) RANKL/TNFα טיפל monolayers בימים שונים לאחר זריעה. (ה) מונאולייר לא מטופל שנקטפו ביום 7 לאחר זריעה. (F-G) מטוס XZ אורתוגונני של monolayers ביום 7 לאחר זריעה מצופה עם phalloidin בדיקה עבור F-actin. פלאלודין = ציאן. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: IgA נקשר במיוחד על פני השטח הרשמי של M תאים. RANKL/TNFα-מטופלים האדם ileal בידור-הנגזר monolayers גדלו במשך 7 ימים ולאחר מכן (א) מטופלים עם 10 μg של סרום האדם IgA עבור 1 h או (ב) מטופל מבוים עם PBS בלבד (ללא שליטה IgA). לאחר 1 h, monolayers נשטפו 2x ב PBS, היו קבועים 4% בלשית, החדיר עם 0.1% TritonX-100, ו ויטראז עבור immunofluorescence. התמונות נותחו באמצעות תוכנת ImageJ ומייצגות 3 ניסויים עצמאיים. DAPI = כחול; גליקופרוטאין 2 (GP2) = אדום; נוגדן לנסיוב האנושי IgA = ירוק; פלאלודין = ציאן. חיצים שחורים לציין IgA מאוגד לפני השטח הרשמי של M תא. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 6
איור 6: תאים M הפחיתו אינטנסיביות אקטין לעומת תאים שאינם M סמוכים. RANKL/TNFα-מטופלים האדם ileal בידור הנגזר מונאולז הנגזרים גדלו במשך 7 ימים ולאחר מכן תוקן ב 4% הלדור והיה מוכתם עבור immunofluorescence. (א) באמצעות imagej, תאים GP2 + M היו מתוארים באמצעות הכלי בחירה ביד חופשית ומדידות שטח ודחיסות משולבת נלקחו בערוץ Phalloidin. אותו ניתוח הושלם לאחר מכן עבור כל תא non-M סמוכים ששכנים תא M. הדחיסות המשולבת הגולמית חולקה על-ידי השטח של כל תא בודד לנורמליזציה. הצפיפות/האזור המשולבת הממוצעת חושבה עבור כל תא שאינו מתוצרת M הסמוכה לתאי M. התמונות נותחו מ 3 ניסויים עצמאיים; כל נקודה היא תא M או ממוצע של תאים שכנים. קווי שגיאה מציינים SD. משמעות סטטיסטית נקבעה בערכים הופכים ליומני רישום באמצעות בדיקה משויכת. p = 0.0001 (ב) הדמות המייצגת של Xz מטוס מתוך העלילה A. תמונות נותחו באמצעות תוכנת imagej. DAPI = כחול; גליקופרוטאין 2 (GP2) = אדום; פלאלודין = ציאן. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Discussion

כדי לפתח monolayers כי להבדיל כראוי לתוך סוגי תא המעיים העיקריים תאים M, זה קריטי להיות מודע מספר גורמים. בידור הללו יש לקצור מתרבויות ECM כי הם מובחן ויש להם שיעור גבוה של Lgr5 + תאי גזע. באופן חזותי, רוב הבקומנואידים בתרבויות ECM לא צריך להיות כהים ומרובה, וביטוי LGR5 יש לזהות בתרבויות אלה על ידי ניתוח ה-PCR. בקרת איכות של המדיה הממוזגת חיונית להפצת תרבויות מובחן לאורך זמן ויש להשלימה עבור כל אצווה של מדיה ממוזג המיוצר. בקרת איכות ניתן להשלים על ידי בדיקת אצווה חדשה של מדיה על כמה תרבויות ECM והשוואת המבנה של ileal בידור לקבוצה קודמת של מדיה במהלך שבוע. LGR5 ביטוי צריך להישאר דומה יחסית בתרבויות ileal בידור גדל בקבוצה חדשה של מדיה לעומת האצווה הקודמת.

במהלך ההכנות של ileal בידור עבור זריעה כמו monolayers, חשוב הצינורות במרץ את הפתרון התא לאחר דגירה עם טריפסין לשבור את בידור ileal לתוך תאים בודדים. גושי תאים יכולים להוביל ליצירת שכבות מרובות בעת זריעה עבור monolayers. בנוסף, זה חיוני כדי מדעית לקבוע את מספר התאים הנדרשים כדי ליצור מונאולייר עבור כל קו בידור בודדים ileal המתקבל. בדרך כלל, ערך זה יכול לנוע בין 2.5 x 105 – 5.0 x 105 תאים/גם אבל תלוי במידת של סיסטיק-בידור לא פיברוזיס בתרבויות ומשתנה עבור כל קו בודד ileal בידור. מניסיון, בידור המעי הגדול ב-ECM שנראים פחות פיברוזיס דורשים צפיפות תאים גבוהה יותר כדי להשיג monolayers. מומלץ לשטוף את התא העליון לאחר יום אחד של צמיחה על ידי ליטוף בעדינות את התקשורת למעלה ולמטה 2-3 פעמים והחלפה עם מדיית גדילה טרייה. תהליך זה פירוק תאים שנחתו על גבי תאים אחרים הפחתת הסבירות של היווצרות ריבוי שכבות. מיתוג את התקשורת בתא העליון ממדיית הצמיחה למדיית תא M כאשר monolayers הם ~ 80% confluent, אשר בדרך כלל מתרחשת ביום 2 לאחר זריעה, עוזר להשיג טוב בידול תא M. תוספת RANKL/TNFα אל החדר העליון במהלך אינדוקציה תא M אינו מוביל לפיתוח של מספר גדול יותר של תאים למונאולייר ולכן ניתן להשאיר מחוץ לתקשורת קאמרית העליון. טרנסולס של מידות נקבוביות משתנות ניתן להשתמש בפרוטוקול זה מבלי להשפיע על פיתוח תא M; עם זאת, צפיפות הזריעה של התא חייבת להיות ממוטבת עבור אלה עם גדלי נקבובית גדולים יותר. קולגן הרביעי יכול להיות מוחלף ECM כציפוי חלבון במרתף הממברנה עבור transwells או צלחות היטב אשר עשוי להיות מתאים יותר עבור יישומים מסוימים.

Ileal בידור הנגזר monolayers על transwells לספק מערכת דו-קאמרית המאפשרת יצירת הגדרה של משטחים פסגה מוגדר באסולצלעות כגון 4-5 סוגים שונים של תאי מעיים אפיתל יכול להקטז כדי לבטא סמנים פני השטח על כל בצד שנמצא במעי. ניתן להוסיף גורמים נוספים לשני הצדדים, כגון חלקיקים, חומרים מדבקים או סוגי תאים אחרים. עם זאת, עד לתאריך מספר מגבלות יישארו. כפי שמתואר, מערכת זו היא מערכת סטטית חסר זרימה פיזיולוגית, התכווצויות מעיים, ותוכן מעיים. בנוסף, הארכיטקטורה של villus-קריפטה אבודה על ידי היווצרות של מונאולייר שטוח. מערכות אלה חסרות אזורי טלאי של Peyer, תאים חיסוניים, ותאים סטרומה. בין אם העדר תאים חיסוניים וסטרומה המתגוררים באופן מקרוב מתחת לתאי M משפיע על הפולשים אשר לא נצפתה במערכת זו ותפקוד פיזיולוגי אחרים הוא אזור עתידי חשוב של חקירה. פרוטוקול זה יכול להיות מותאם לצלחת 96-באר או תבנית מרובת הצלחות. ההליך לציפוי 96-ובכן צלחת עם ECM ו זריעה עם תאים בודדים מתוך בידור המאידים נשאר זהה עבור transwells. טיטור של צפיפות התא זריעת הנדרש כדי להשיג monolayers חייב להיעשות, אבל בדרך כלל נע בין 1.0 x 105 – 3.0 x 105 תאים/גם בפורמט 96-באר. תאי m הם המושרה על ידי החלפת מדיית הצמיחה עם מדיית תא M כאשר monolayers הם 80% confluent בדרך כלל על ידי ימים 1-3 בהתאם לצפיפות הראשונית הזרע מזריעה.

שיטה זו של הבחנה תאים M מתוך המעי החדש של מדיום מספק שיפורים משמעותיים על השיטה Caco-2. בידור מסוג ileal הם התאים העיקריים ולפחות 4-5 סוגי תאים אפיתל קיימים במערכת. בנוסף, שורות ileal בידור נגזר מאנשים שונים ניתן ללמוד לחקור כיצד גנטיקה או מחלות השפעה המדינה פיתוח תא M והתנהגות. מניפולציה נוספת של בידור ileal במהלך בידול תא M יאפשר הבנה טובה יותר של פיתוח תא M כולל אפיון תא מקודמי תאים. בסופו של דבר, מאז המנגנונים המולקולריים של תא M phagocyציטוזה ו הטרנססקיטוזה עדיין לא הבינו לחלוטין3,29, מודל זה מספק את ההזדמנות ללמוד ולהמחיש אנטיגן וספיגת חלקיקים על ידי תאי M.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

עבודה זו נתמכה על ידי NIAID U19AI131126 ד ר Isberg (בית הספר לרפואה של האוניברסיטה של טאפטס) וד ר קפלן (אוניברסיטת טאפטס); (JM הוא מנהיג פרויקט 2) ו NIAID R21AI128093 ל-JM. ACF נתמך בחלקו על ידי NIAID T32AI007077. התמיכה ב-סאב ו-MKE נתמכה על ידי NIAID U19AI116497-05. אנו מודים לחברי מעבדת Mecsas, מעבדת Ng, וד ר Isberg בבית הספר לרפואה של האוניברסיטה של טאפטס לדיונים שימושיים. ההדמיה הקונקלית בוצעה במרכז טאפטס לחקר מדעי המוח, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics