Diferenciación inducida de células similares a células M en monocapas de enteroide ileal derivadas de células madre humanas

Immunology and Infection
 

Summary

Este protocolo describe cómo inducir la diferenciación de células M en monocapas ileales derivadas de células madre humanas y métodos para evaluar su desarrollo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las células M (microfold) del intestino funcionan para transportar el antígeno desde el lumen apical hasta los parches subyacentes de Peyer y lamina propria donde residen las células inmunitarias y, por lo tanto, contribuyen a la inmunidad de la mucosa en el intestino. Se carece de una comprensión completa de cómo las células M se diferencian en el intestino, así como los mecanismos moleculares de la acumulación de antígenos por las células M. Esto se debe a que las células M son una población rara de células en el intestino y porque los modelos in vitro para las células M no son robustos. El descubrimiento de un sistema de cultivo de células madre autorenovador del intestino, llamado enteroides, ha proporcionado nuevas posibilidades para el cultivo de células M. Los enteroides son ventajosos sobre las líneas celulares cultivadas estándar porque se pueden diferenciar en varios tipos de células principales que se encuentran en el intestino, incluyendo células de copa, células Paneth, células enteroendocrinas y enterocitos. La citoquina RANKL es esencial en el desarrollo de células M, y la adición de RANKL y TNF-o a los medios de cultivo promueve un subconjunto de células de enteroides ileales para diferenciarse en células M. El siguiente protocolo describe un método para la diferenciación de células M en un sistema monocapa polarizado epitelial transwell del intestino utilizando enteroides ileales humanos. Este método se puede aplicar al estudio del desarrollo y la función de la célula M.

Introduction

Las células M (microfold) son células epiteliales intestinales especializadas que se encuentran principalmente en el epitelio asociado al folículo (FAE) del intestino que cubre pequeñas regiones linfoides que se denominan parches de Peyer1. Las células M tienen microvilli apicalirregulares irregulares cortas y están profundamente invaginadas ensu lado basolateral, lo que permite que las células inmunitarias residan cerca de su cuerpo celular 2. Esta morfología única permite a las células M tomar muestras de antígeno dellumen apical del intestino y entregarlo directamente a las células inmunitarias subyacentes 2. De esta manera, las células M son importantes para la vigilancia inmune en el intestino, pero también pueden ser explotadas por patógenos para la entrada en la lámina propria1,2,3,4,5, 6,7.

El estudio de las células M se ha visto obstaculizado por varios factores. En primer lugar, las células M se encuentran a baja frecuencia en el ratón y el intestino humano8. En los sistemas de células cultivadas, las células similares a las células M se han inducido a diferenciar se dicultando co-cultivando una línea celular de adenocarcinoma polarizado, Caco-2, con linfocitos B de parches de ratón Peyer o la línea celular del linfoma de células B, Raji B9,10 . Esto da como resultado un subconjunto de células Caco-2 que expresan los marcadores de célulasM Sialyl Lewis Un antígeno y UEA-1 en el epitelio polarizado 9,10. (Estos marcadores también se expresan en las células de la copa en los tejidos intestinales, por lo que hoy en día se utilizan con menos frecuencia como marcadores de células M definitivas11,12.) Este sistema celular Caco-2-M se ha utilizado para estudiar la acumulación de partículas y la translocación de bacterias13,14. Sin embargo, las células Caco-2 son una línea celular establecida a partir de un adenocarcinoma intestinal grande con el factor de confunción que diferentes fuentes de células Caco-2 muestran diferentes fenotipos entre los laboratorios15. Además, es posible que no recapitulen completamente los niveles de transcripción de las células M verdaderas, ya que carecen de la expresión de los marcadores de células M actualmente conocidos GP2 y SpiB16. Por lo tanto, se necesitan modelos de cultivo adicionales y más fisiológicamente relevantes para poder estudiar el desarrollo y las funciones de las células M.

En los últimos diez años, el campo de los sistemas modelo derivados de enteroides del intestino ha estado avanzando rápidamente desde el descubrimiento inicial de que las células madre intestinales derivadas de la biopsia intestinal humana podrían autopropagarse y renovarse en cultivo 17 , 18. Es importante destacar que la eliminación de los factores de promoción de células madre de los medios de crecimiento permite que estos cultivos de células madre se diferencien en los muchos tipos de células que se encuentran en el intestino18. Además, los trabajos recientes sugieren la importancia de la señalización RANKL-RANK en el desarrollo de células M en el intestino19,20. El receptor RANK es un miembro de la familia DeNF de receptores que se expresa en células precursoras epiteliales en el intestino19, mientras que RANKL (el ligando del receptor RANK) es liberado por las células estromales de los parches del Peyer20. Dado que los tipos de células epiteliales presentes en los enteroides ileales no producen RANKL, la diferenciación celular M en los cultivos enteroideiales ileales puede deducirse mediante la adición de RANKL al medio de cultivo21,22. La inclusión de TNF en los medios de cultivo ayuda a apoyar el desarrollo de células M en enteroides ileales23. Aquí, describimos los métodos para inducir la diferenciación de células M en monocapas intestinales derivadas de enteroides ileales humanos. Nuestros métodos se basan en parte en modificaciones de los siguientes protocolos21,22,23.

Protocol

Todos los métodos descritos aquí han sido aprobados por la Universidad Tufts IBC y el IRB.

1. Inducción de la diferenciación celular M en monocapas derivadas de enteroides ileales humanos

NOTA: Este protocolo utiliza enteroides ileales derivados de la biopsia de tejido humano. Consulte los protocolos publicados para conocer los métodos sobre cómo crecer y pasar estas células18,24. Los siguientes métodos para el desarrollo de monocapas fueron adaptados de Zou et al.24. Los métodos para inducir células M en cultivos derivados de enteroides ileales se adaptaron a partir de informes anteriores21,22,23. Todo el trabajo se lleva a cabo en una campana de cultivo de tejido estéril y las incubaciones se realizan en la incubadora de campana o cultivo de tejido como se indica. Consulte Tabla de materiales necesarios para preparar monocapas enteroideiales ileales y varios medios.

  1. Crecer enteroides ileales durante 4-10 días en matriz extracelular (ECM) (ver Tabla de Materiales)(Figura 1), dependiendo de sus tasas de crecimiento intrínsecas, antes de sembrar sobre transolas.
  2. Recubrimiento de membranas transwell
    1. Coloque el número deseado de transpocillos en una placa de 24 pocillos creando un sistema de dos cámaras.
    2. Diluir ECM 25 veces en solución salina con fosfato estéril en frío (PBS) y añadir 100 l de solución diluida en frío en cada cámara superior en la membrana.
      NOTA: ECM y la solución diluida de ECM deben mantenerse en hielo hasta inmediatamente antes de la adición.
    3. Cubra la placa de 24 pocillos con tapa y coloque la placa en una incubadora de cultivo de tejido a 37 oC durante 2 h para permitir la solidificación de ECM en la membrana.
    4. Después de 2 h, retire la placa de la incubadora y colóquela en una campana de cultivo de tejido. Con pinzas estériles, invierta cada transpocor para eliminar suavemente la solución restante. Deje que las membranas se sequen en el capó con la tapa abierta mientras se recogen las células (pasos 1.3.1- 1.3.11).
  3. Disociación de los enteroides ileales en células individuales
    1. Retire la placa de los enteroides ileales de la incubadora y retire suavemente los medios de cultivo de cada pocal por aspiración al vacío o con una pipeta.
      NOTA: Un pozo de enteroides ileales que contienen aproximadamente 100 quistes sanos es suficiente para la semilla 1.5-2 pozos.
    2. Añadir 500 ml de hielo frío de 0,5 mM de ácido etilendiaminetetraacético (EDTA) a cada pocilido que contenga enteroides ileales suspendidos en ECM para romper el ECM. Pipetear hacia arriba y hacia abajo vigorosamente con un pipeteador P1000 establecido a 500 l para romper ECM liberando así enteroides ileales en la solución. Para mejorar la disolución de ECM, después de pipetear, agitar la placa vigorosamente a 4 oC durante 30 minutos.
    3. Recoger la solución de cada pozo en tubos cónicos de 15 ml.
      NOTA: Recoger hasta 10 pozos por tubo cónico de 15 ml para una óptima recolección de una sola célula.
    4. Pellet las células en una centrífuga a 140 x g y 4 oC durante 5 min. Pellet debe ser visible, pero se puede desalojar fácilmente, por lo que lentamente eliminar el sobrenadante por aspiración al vacío o con una pipeta.
      NOTA: Si le preocupa la pérdida de pellets y células, utilice una pipeta y guarde el sobrenadante en un tubo separado.
    5. Para digerir los enlaces de unión estrecha y dividir los enteroides ileales en células individuales, resuspenda el pellet en 500 ml de trippsina a temperatura ambiente por cada 5 pocillos recogidos en el paso 1.3.3. Usando un P1000, pipeta hacia arriba y hacia abajo para desagregar los grumos e incubar los tubos en un baño de agua de 37 oC durante 5 minutos o menos.
      NOTA: La optimización es necesaria para determinar la cantidad adecuada de tiempo necesario para incubar los tubos de modo que las células se rompan pero no se triprinen en exceso hasta el punto de que mueran. Utilice Trypan azul en el paso 1.3.9 para asegurarse de que las células son viables después del tratamiento con trippsina.
    6. Añadir 1 mL de DMEM/F12 avanzado con 10% de suero bovino fetal (FBS) por 500 ml de trippsina para inactivar la trippsina.
    7. Pipetear hacia arriba y hacia abajo con un P1000 establecido en 500 l al menos 50 veces contra el lado del tubo cónico para desagregar aún más los grumos restantes en células individuales.
    8. Coloque un colador de células de 40 m sobre un cónico de 50 ml y agregue 1 ml de DMEM/F12 avanzado con un 10% de FBS para mojar el colador celular. Pipetear la suspensión de una sola celda del cónico de 15 ml sobre el colador. Lave el colador con 1 ml de Advanced DMEM/F12 con 10% FBS.
    9. Transfiera las células que pasaron a través del colador celular desde el cónico de 50 ml a un nuevo tubo cónico de 15 ml. Durante el paso de centrifugación 1.3.10, el pellet celular se verá más fácilmente en un tubo cónico de 15 ml. Cuente las células usando un hemocaquímetro. Utilice Trypan blue para verificar que las celdas siguen vivas. Típicamente, >95% viabilidad se observa.
    10. Mientras cuenta las células, centrifugar las células en el nuevo tubo de 15 ml a 400 x g y la temperatura ambiente durante 5 minutos. Retire cuidadosamente el sobrenadante con una pipeta, de nuevo ahorrando el sobrenadante en caso de que el pellet se desaloje.
    11. Preparar medios de crecimiento completos modificados25 (medios MCMGF+) complementados con 10 M Y-27632. Resuspenda las células peletadas a 2,5 x 105 células/200 l en MCMGF+. Vea los comentarios en la discusión sobre la optimización del número de semilla de celda.
      NOTA: Los medios MCMGF+ son Advanced DMEM/F12 con 75% de medios condicionados con L-Wnt3a, 10% Medios acondicionados de R-spondin, 5% Medios acondicionados de Noggin, 1x Suplemento B27, 1x Suplemento N2, 1 mM N-acetilcisteína, 50 ng/ml ratón recombinante EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, HEPES de 10 mM, 2 mM glutaMAX y 1x penicilina/estreptomicina (opcional).
    12. Asegúrese de que las membranas recubiertas de ECM preparadas en el paso 1.2 se hayan secado completamente, según se evalúe a simple vista. Lavar la cámara superior con 200 ml de MCMGF+. Añadir 200 ml de solución celular en cada cámara superior.
    13. Añadir 700 s de MCMGF+ con 10 M Y-27632 a cada cámara inferior. Colocar la placa en una incubadora de cultivo detejido de 37oC con 5% de CO2.
    14. Después de 1 día de crecimiento, retire los medios de la cámara superior y sustitúyalos por 200 ml de MCMGF+ fresco, para evitar el crecimiento de múltiples capas celulares.
  4. Sustitución del medio
    1. Una vez que las monocapas son confluentes del 80 %, por lo general entre los días 1-3 posteriores a la sembración, sustituya los medios basolaterales por medios de diferenciación (DM) para los pozos de control (consulte el paso 1.4.2 para obtener más detalles) o con los medios de célulaM para los pozos de inducción de células M (consulte el paso 1.4.3 para obtener más detalles). Sustituya el soporte en la cámara superior por DM para ambas condiciones.
      NOTA: DM es DMEM avanzado/F12 con 5% de medios acondicionados Noggin, 1x B27 Suplemento, 1x N2 Suplemento, 1 mM N-acetilcisteína, 50 ng/mL ratón recombinante EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES Buffer, 2 mM GlutaMAX, y 1x Penicillin/Streptomycin (opcional ). Los medios de célulaM M son DM complementados con 200 ng/mL RANKL y 50 ng/mL TNF.
    2. Para los pozos de control que no deben contener células M, agregue 200 ml de DM a la cámara superior y 700 l DM a la cámara inferior.
    3. Para inducir células M, agregue 200 s de DM a la cámara superior y 700 l de medios celulares M a la cámara inferior.
    4. Sustituya el soporte cada 2 días. Para pozos de control, reemplace DM en las cámaras superior e inferior. Para los pozos de células M, reemplace DM en la cámara superior y medios de células M en la cámara inferior.
      NOTA: Para el día 7 después de la sembración celular, las células M son completamente inducidas en las monocapas.

2. Verificación de la diferenciación de células M por qRT-PCR

NOTA: Realice el siguiente trabajo en un espacio de banco estéril sin ARSa. Consulte la Tabla de materiales para obtener una lista de los materiales preferidos para qRT-PCR.

  1. Retire el medio de las cámaras superior e inferior y lave la cámara superior 2 veces suavemente con 300 ml de PBS a temperatura ambiente.
  2. Añadir 300 s de Trizol a cada cámara superior. Incubar a temperatura ambiente durante 5 min.
    ADVERTENCIA: Use guantes y protección para los ojos cuando utilice Trizol para evitar el contacto con la piel como se indica en las instrucciones del fabricante.
  3. Mientras tanto, etiquete los tubos de microcentrífuga para cada pocal y agregue 700 ml de Trizol a cada tubo.
  4. Recoger el homogeneizador celular pipeteando 3 veces hacia arriba y hacia abajo suavemente con un P1000 y transferir el contenido al tubo de microcentrífuga correspondiente. Vórtice para 5 s para mezclar.
  5. Mantenga las muestras a temperatura ambiente durante 3 minutos adicionales. A continuación, almacenar a -80 oC durante un mes.
  6. Siga la metodología qRT-PCR estándar para el aislamiento de ARN, el tratamiento DNase, la transcripción inversa y las reacciones qRT-PCR. Consulte la lista de imprimación en Tabla de materiales.

3. Verificación de la diferenciación celular M por inmunofluorescencia

NOTA: Mantenga siempre la cámara inferior de la placa llena de PBS para que las membranas permanezcan húmedas. Este procedimiento se realiza en el banco. Consulte la Tabla de Materiales para obtener una lista de los materiales preferidos para la inmunofluorescencia.

  1. Retire el medio de la cámara superior y lave 2 veces suavemente con 300 ml de PBS a temperatura ambiente. Añadir 100 s de temperatura ambiente 4% PFA en PBS a la cámara superior. Cubra la placa con papel de aluminio y deje reposar durante 25 minutos a temperatura ambiente. Retire 4% PFA.
    ADVERTENCIA: El 4% de PFA debe eliminarse adecuadamente como residuos químicos peligrosos.
  2. Lavar la cámara superior 3x con 300 sL de PBS a temperatura ambiente. En este punto, las muestras pueden permanecer a 4 oC hasta un mes antes de la tinción. Una vez manchadas, las muestras deben visualizarse dentro de una semana para obtener imágenes de la mejor calidad.
  3. Incubar las monocapas con 100 l de albúmina sérica bovina (BSA) al 5% disuelta en PBS durante 30 minutos en la oscuridad a temperatura ambiente para bloquear las monocapas.
  4. Preparar la solución de anticuerpos primarios GP2 en 1% de BSA en PBS a una dilución de 1:100. Añadir 100 l por pozo. Mancha durante 1 h a temperatura ambiente en la oscuridad. Retire la solución.
    NOTA: No permeabilizar las monocapas antes de que se produzca la mancha primaria para GP2 porque se logra una tinción óptima de la superficie GP2 primaria de las células M sin permeabilización.
  5. Lave la cámara superior 3 veces con 300 ml de PBS a temperatura ambiente.
  6. Preparar la solución de manchas secundarias de IgG antiratón de cabra etiquetada fluorescentemente a 1:200, faloidina a 1:100 y DAPI en 1% BSA + 0.1% tritón en PBS. Añadir 100 l por pozo. Mancha durante 30 min a temperatura ambiente en la oscuridad.
    NOTA: Tritón se añade a la solución de manchas secundaria para permeabilizar las células durante este paso para una mancha de faloidina adecuada.
  7. Lavar 3 veces con PBS de 300 l.
  8. Coloque una gota de 5 l de solución de montaje (Tablade materiales)en una corredera de vidrio. Retire el pozo de la placa de 24 pocillos e invierta. Corte cuidadosamente la membrana del pozo usando un bisturí. Coloque la membrana con las células hacia arriba sobre la gota de solución de montaje en la corredera de vidrio. Añadir 10 l de solución de montaje en la parte superior y central de la membrana y colocar un cubreobjetos en la parte superior para sellar la membrana entre la corredera de vidrio y la cubierta.
  9. Secar los portaobjetos a temperatura ambiente en la oscuridad durante 24 h. Las diapositivas manchadas deben visualizarse en el microscopio confocal dentro de 1 semana después de la tinción.

Representative Results

Los enteroides ileales cultivados en ECM son analizados visualmente y por qRT-PCR para su estado de salud relativo y estados de diferenciación como un medio de control de calidad para cultivos enteroides ileales y para su uso en monocapas. Los enteroides ileales indiferenciados cultivados en ECM parecen claros y quísticos en morfología, lo que indica la presencia de muchas células madre (Figura1A). Con el tiempo, los enteroides ileales indiferenciados cultivados en medios de crecimiento pueden adoptar un fenotipo intermedio donde algunos aparecerán quísticos y otros aparecerán opacos (Figura1B). Con frecuencia, nuestras muestras indiferenciadas se asemejan a las que se muestran en la Figura 1B en lugar de la Figura 1A. Estos cultivos intermedios contienen enterocitos más diferenciados terminalmente medidos por la expresión del marcador de enterocitos, la isomaltas de sucrasa (SI) y presumiblemente los enterocitos muertos extruidos en el lumen contribuyen a su aspecto denso. Los enteroides ileales se pueden utilizar en este estado intermedio para el desarrollo monocapa, pero debe tenerse en cuenta que la cantidad de células madre intestinales presentes en los cultivos puede ser baja, y algunos tipos de células diferenciadas pueden estar presentes (por ejemplo, véase qRT-PCR en muestras indiferenciadas cultivadas en ECM que se asemejan a la Figura 1B de la Figura 2). A modo de comparación, los enteroides ileales cultivados con medios de diferenciación en ECM durante más de 5 días aparecerán uniformemente oscurecidos y lobulares y las culturas con esta morfología no son buenas candidatas para la sembración de monocapas (Figura1C).

La expresión de genes de células madre y genes de diferenciación de células intestinales puede ser analizada por qRT-PCR como otro medio para evaluar el estado de salud de los enteroides ileales cultivados en ECM y sus capacidades de diferenciación una vez sembradas como monocapas en transolas. La expresión de un gen de células madre, LGR5, un gen de enterocitos, SI, un gen de células de copa, MUC2,y un gen de células Paneth, LYZ,se compara entre cultivos enteroide ileales indiferenciados cultivados en ECM y ileales diferenciados monocapas enteroide en presencia o ausencia de RANKL/TNF (Figura2). Mientras que los valores pueden diferir entre experimentos, la expresión de LGR5 debe disminuir después de la diferenciación de monocapas18,26. La expresión LGR5 no se detecta normalmente en las monocapas ileales diferenciadas sin RANKL y TNF para el día 7. Por el contrario, la expresión de marcadores de diferenciación de tipos de células específicas, como SI y MUC2, aumentan después de la diferenciación18. La expresión de LYZ generalmente disminuye después de la diferenciación en nuestras culturas. Si los cultivos enteroides ileales utilizados para hacer monocapas se parecen más a la Figura 1B que en la Figura 1A,los aumentos en los marcadores de diferenciación intestinal pueden ser modestos después de la diferenciación porque estos cultivos iniciales son heterogéneos en tipos de células intestinales y tienen un nivel basal más alto de SI y MUC2. Sin embargo, la diferenciación en monocapas todavía se produce como se evalúa por la pérdida de expresión de LGR5 y microscopía (ver más abajo). Además, la adición de RANKL y TNF a los medios de diferenciación reduce la pérdida de expresión LGR5 (Figura2). Paralelamente, la expresión de SI y MUC2 es ligeramente inferior a la de la condición diferenciada que carece de RANKL y TNF, aunque sus niveles aumentan por encima de la condición indiferenciada.

La diferenciación celular M en monocapas se determina tanto por qRT-PCR como por inmunofluorescencia utilizando dos marcadores específicos de células M, incluyendo la glicoproteína de superficie celular 2 (GP2) y el factor de transcripción SpiB21. La expresión de GP2 y SPIB se regula en las monocapas derivadas de enteroides ileales en presencia de RANKL y TNF y no se detecta en muestras tratadas no RANKL y TNF (Figura3). La expresión de estos marcadores también se puede normalizar a un pedazo de tejido intestinal pequeño22,si está disponible. Esto permite que el cambio de pliegue de estos marcadores de células M se comparen con el tejido que tiene células M en lugar de controlar monocapas que no tienen expresión de estos marcadores y permite la estandarización entre experimentos en un laboratorio. Las células M también se detectan por expresión superficial de GP2 por inmunofluorescencia (Figura4). Típicamente, en una monocapa confluente, se observan células de 1 a 5 M en un campo de microscopio dado con aumento de 40veces por los días 6 a 8 post-sembrado en muestras tratadas con RANKL y TNF (Figura4A-D). No se ve ninguna expresión GP2 en los ejemplos no tratados (Figura4E). La vista ortogonal del plano XZ superpuesta con una sonda de faloide muestra estructuras de actina que rodean cada celda y la expresión GP2 en la superficie apical de las células M (Figura4F-G). Este modelo recapitula la baja frecuencia de las células M que se encuentran en el intestino humano1,2,8. Para purificar y aislar las células M para su estudio posterior, las células M se pueden teñir mediante la expresión de superficie GP2 y clasificarse mediante FACS para celdas GP2+.

Las células M se unen y transportan el antígeno desdeel lumen intestinal a las células inmunitarias que residen debajo del epitelio 2. Secretory IgA producido en el intestino se une a las bacterias y puede unirse a la superficie apical de las células M para facilitar el transporte de los microbios27,28. Para determinar si las células M desarrolladas en este modelo son capaces de unirse a IgA, IgA sérico humano se añade a la cámara superior, se permite atar durante 1 h, y luego las monocapas están preparadas para el análisis de inmunofluorescencia. La presencia de IgA en las células M se visualiza utilizando un anticuerpo secundario conjugado por flúor que reconoce la pesada cadena de IgA sérica humana. Las células M tratadas con IgA durante 1 h tienen IgA unida a la superficie apical (Figura5A),mientras que las células M en pozos de control que sólo fueron tratadas con el anticuerpo secundario a IgA no tienen señal detectable (Figura5B). Además, IgA se une específicamente a la superficie apical de las células M y no se encuentra unida a ninguna célula que carezca de mancha de superficie GP2. Además, las células M tienen una actinadensa característicamente más corta en su superficie apical 2. Para analizar la morfología celular M en este modelo, las monocapas derivadas de enteroides ileales se cultivan durante 7 días y se cosechan para el análisis de inmunofluorescencia de F-actina utilizando faloidetina. Las mediciones de la intensidad de píxeles de actina se calculan para las células M y para las celdas no M que están directamente adyacentes a cada celda M utilizando el software ImageJ (Figura6A). La intensidad de Actin se reduce en las células GP2+ M en este modelo y una imagen representativa se muestra en la Figura 6B. En general, las células M desarrolladas en este modelo monocapa derivado de enteroideial es que tienen expresión génica característica, morfología y algunas funciones de células M de células M intestinales humanas, como la unión a IgA.

Figure 1
Figura 1: Morfología representativa de los enteroides ileales humanos en ECM de una semana después de la división. (A) Enteroides ileales indiferenciados claros y quísticos. (B) Fenotipo intermedio con algunos enteroides ileales quísticos y algunos enteroides ileales lobulares opacos. (C) Enteroides ileales oscuros y diferenciados lobulares. Imágenes tomadas a través de la lente de un microscopio de luz óptica con aumento 4x usando una cámara iPhone7. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Expresión relativa de células madre y marcadores de diferenciación de enteroides ileales humanos cultivados en ECM o diferenciados como monocapas. Los enteroides ileales se cultivaron durante 7 días en ECM (Indiferenciado) o se cultivaron y diferenciaron como monocapas sin (Diferenciado) o con RANKL y TNF (Diferenciado +R/T). Cultivos enteroide ileales o monocapas fueron cosechados en Trizol para la extracción de ARN. La expresión génica fue determinada por qRT-PCR y se expresa en relación con GAPDH. Los datos son un promedio de 3 pozos independientes de enteroides ileales o monocapas por condición. Las barras de error indican que no se detecta EL ND. La significancia estadística se determinó en valores transformados en registros utilizando ANOVA unidireccional con la prueba de comparaciones múltiples de Dunnett en comparación con el Indiferenciado. ** p < 0.01, *** p < 0.001 Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Expresión relativa de marcadores específicos de células M GP2 y SPIB a partir de monocapas derivadas de enteroides ileales humanos. Las monocapas tratadas y no tratadas con enteroide humano tratadas y no tratadas fueron cosechadas en Trizol para la extracción de ARN después de 7 días después de la sembrada. La expresión génica fue determinada por qRT-PCR y se expresa en relación con GAPDH. Los datos son un promedio de 6 monocapas independientes por condición. Las barras de error indican que no se detecta EL ND. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Inmunofluorescencia de la expresión de GP2 superficial en células M en monocapas derivadas de enteroides ileales humanos a lo largo del tiempo. Las monocapas derivadas de enteroides humanos tratadas y no tratadas por RANKL/TNF se fijaron en un 4% de PFA y se teñiron para inmunofluorescencia en varios días indicados después de la sembración. Las imágenes se analizaron utilizando el software ImageJ. DAPI - Azul; Glicoproteína 2 (GP2) - Rojo. (A-D) Las monocapas tratadas RANKL/TNF en varios días posteriores a la sembración. (E) Monocapa no tratada cosechada en el día 7 después de la sembrada. (F-G) Plano ortopédico XZ de monocapas en el día 7 post-sembrado superpuesto con sonda de faloide para F-actin. Faloidina - Cian. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: IgA se une específicamente a la superficie apical de las células M. Las monocapas derivadas de enteroides ileales humanos tratadas con RANKL/TNF se cultivaron durante 7 días y luego (A) tratadas con 10 g de IgA sérica humana durante 1 h o (B) tratadas con PBS solamente (sin control de IgA). Después de 1 h, las monocapas se lavaron 2 veces en PBS, se fijaron en 4% PFA, permeabilizado con 0.1% TritonX-100, y teñido para inmunofluorescencia. Las imágenes se analizaron utilizando el software ImageJ y son representativas de 3 experimentos independientes. DAPI - Azul; Glicoproteína 2 (GP2) - Rojo; Anticuerpo según el suero humano IgA - Green; Faloidina - Cian. Las flechas negras denotan IgA unida a la superficie apical de la célula M. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Las células M han reducido la intensidad de la actina en comparación con las células adyacentes no M. Las monocapas derivadas de enteroides ileales humanos tratadas con RANKL/TNF se cultivaron durante 7 días y luego se fijaron en un 4% de PFA y se teñiron para inmunofluorescencia. (A) Usando ImageJ, las células GP2+ M se delinearon usando la Herramienta selección a mano alzada y las mediciones de Área y Densidad Integrada se tomaron en el canal Phalloidin. El mismo análisis se completó entonces para cada celda adyacente no M que vecino de la celda M. La Densidad Integrada Raw se dividió por el área de cada celda individual para su normalización. La densidad/área integrada promedio se calculó para cada celda adyacente no M para cada celda M. Las imágenes fueron analizadas a partir de 3 experimentos independientes; cada punto es una célula M o un promedio de celdas vecinas. Las barras de error indican SD. Se determinó la significancia estadística en los valores transformados en registro mediante una prueba t emparejada. p - 0.0001 (B) Imagen representativa del plano XZ a partir de la gráfica en A. Las imágenes se analizaron utilizando el software ImageJ. DAPI - Azul; Glicoproteína 2 (GP2) - Rojo; Faloidina - Cian. Haga clic aquí para ver una versión más grande de esta figura.

Discussion

Para desarrollar monocapas que se diferencien adecuadamente en los principales tipos de células intestinales y células M, es fundamental tener en cuenta varios factores. Los enteroides ileales deben cosecharse de cultivos DeCM que son indiferenciados y tienen una alta proporción de células madre Lgr5+. Visualmente, la mayoría de los enteroides ileales en las referencias culturales ECM no deben oscurecerse y multilobulares, y la expresión LGR5 debe detectarse en estas referencias culturales mediante el análisis qRT-PCR. El control de calidad de los medios acondicionados es esencial para la propagación de cultivos indiferenciados a lo largo del tiempo y debe completarse para cada lote de medios acondicionados que se produce. El control de calidad se puede completar probando un nuevo lote de medios en algunos cultivos de ECM y comparando la morfología de los enteroides ileales con un lote anterior de medios en el transcurso de una semana. La expresión LGR5 debe seguir siendo relativamente similar en los cultivos enteroide ileales cultivados en el nuevo lote de medios en comparación con el lote anterior.

Durante la preparación de los enteroides ileales para la sembración en monocapas, es importante pipetear vigorosamente la solución celular después de la incubación con trippsina para dividir los enteroides ileales en células individuales. Los grumos celulares pueden conducir a la formación de varias capas cuando se sembran para monocapas. Además, es esencial determinar empíricamente el número de celdas necesarias para formar una monocapa para cada línea enteroide ileal individual que se obtiene. Típicamente, este valor puede variar de 2.5 x 105 – 5.0 x 105 células/bien, pero depende del grado de enteroides ileales quísticos a no quísticos en cultivos y varía para cada línea enteroide ileal individual. Por experiencia, los enteroides ileales cultivados en ECM que parecen menos quísticos requieren una mayor densidad de sembración celular para lograr monocapas. Es aconsejable lavar la cámara superior después de 1 día de crecimiento pipeteando suavemente los medios hacia arriba y hacia abajo 2-3 veces y reemplazando con medios de crecimiento fresco. Este proceso desaloja las células que han aterrizado encima de otras células, lo que reduce la probabilidad de formación de varias capas. Cambiar los medios de la cámara superior de los medios de crecimiento a los medios celulares M cuando las monocapas son confluentes del 80 %, lo que suele ocurrir en el día 2 posterior a la sembración, ayuda a lograr una buena diferenciación celular M. La adición de RANKL/TNF a la cámara superior durante la inducción de la célula M no conduce al desarrollo de un mayor número de células M por monocapa y, por lo tanto, se puede dejar fuera de los medios de la cámara superior. Transwells de diferentes tamaños de poros se pueden utilizar en este protocolo sin afectar el desarrollo de células M; sin embargo, la densidad de semilla celular debe optimizarse para aquellos con tamaños de poro smás grandes. El colágeno IV se puede sustituir por ECM como recubrimiento de proteína de membrana de sótano para transpocillos o placas de pozos que pueden ser más adecuados para ciertas aplicaciones.

Las monocapas derivadas de enteroides ileales en transolas proporcionan un sistema de dos cámaras que permite la creación de superficies apicales y basolaterales definidas de tal manera que los 4-5 tipos diferentes de células intestinales epiteliales pueden polarizar para expresar marcadores de superficie en cada lado relativo al que se encuentra en el intestino. Se pueden agregar factores adicionales a ambos lados, como partículas, agentes infecciosos u otros tipos de células. Sin embargo, hasta la fecha persisten algunas limitaciones. Como se describe, este sistema es un sistema estático que carece de flujo fisiológico, contracciones intestinales, y el contenido intestinal. Además, la arquitectura villus-crypt se pierde por la formación de una monocapa plana. Estos sistemas carecen de las regiones de parches de Peyer, las células inmunitarias y las células estromales. Si la falta de células inmunes y estromales que residen de cerca debajo de las células M afecta las invaginaciones que no se observan en este sistema y otro funcionamiento fisiológico es un área importante de investigación futura. Este protocolo se puede adaptar a una placa de 96 pocillos o a un formato de placa multipozo. El procedimiento para el recubrimiento de la placa de 96 pocillos con ECM y la sembración con células individuales de enteroides ileales sigue siendo el mismo que para los transpocillos. La valoración de la densidad de sembración celular necesaria para obtener monocapas debe hacerse, pero normalmente oscila entre 1.0 x 105 – 3.0 x 105 células/bien en un formato de placa de 96 pocillos. Las células M se inducen reemplazando los medios de crecimiento por medios celulares M cuando las monocapas son 80% confluente típicamente por los días 1-3 dependiendo de la densidad inicial de la semilla celular.

Este método de diferenciación de células M de enteroides ileales in vitro proporciona mejoras significativas sobre el método Caco-2. Los enteroides ileales son células primarias y al menos 4-5 tipos de células epiteliales están presentes en el sistema. Además, las líneas de enteroides ileales derivadas de diferentes personas se pueden estudiar para investigar cómo la genética o el estado de la enfermedad influyen en el desarrollo y el comportamiento de las células M. La manipulación adicional de los enteroides ileales durante la diferenciación celular M permitirá una mejor comprensión del desarrollo de la célula M, incluida la caracterización de células precursoras de células M. Por último, dado que los mecanismos moleculares de la fagocitosis de célulasM y la transocitosis todavía no se entienden completamente 3,29, este modelo proporciona la oportunidad de estudiar y visualizar la absorción de antígenos y partículas por las células M.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por NIAID U19AI131126 al Dr. Isberg (Escuela de Medicina de la Universidad de Tufts) y al Dr. Kaplan (Universidad de Tufts); (JM es líder del Proyecto 2) y NIAID R21AI128093 a JM. ACF fue apoyado en parte por NIAID T32AI007077. SEB y MKE fueron apoyados por NIAID U19AI116497-05. Agradecemos a los miembros del laboratorio Mecsas, el laboratorio Ng, y al Dr. Isberg en la Escuela de Medicina de la Universidad de Tufts por sus discusiones útiles. La imagen confocal se realizó en el Tufts Center for Neuroscience Research, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics