Geïnduceerde differentiatie van M cel-achtige cellen in menselijke stamcel-afgeleide Ileal Enteroid monolayers

Immunology and Infection
 

Summary

Dit protocol beschrijft hoe de differentiatie van M cellen in menselijke stamcel afgeleide ileale monolagen en methoden om hun ontwikkeling te beoordelen induceren.

Cite this Article

Copy Citation | Download Citations

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (microfold) cellen van de darmfunctie voor het vervoer van antigeen van de apicale lumen naar de onderliggende Peyer patches en lamina propria waar immuuncellen wonen en daarom bijdragen aan mucosale immuniteit in de darm. Een volledig begrip van hoe M-cellen differentiëren in de darm en de moleculaire mechanismen van antigeen-opname door M-cellen ontbreekt. Dit komt omdat M-cellen een zeldzame populatie van cellen in de darm zijn en omdat in vitro-modellen voor M-cellen niet robuust zijn. De ontdekking van een zelf-vernieuwend stamcel kweek systeem van de darm, genaamd enteroïden, heeft nieuwe mogelijkheden geboden voor het kweken van M-cellen. Enteroïden zijn voordelig ten opzichte van standaard gekweekte cellijnen omdat ze kunnen worden gedifferentieerd in verschillende belangrijke celtypen gevonden in de darm, met inbegrip van Goblet cellen, Paneth cellen, enteroendocrine cellen en enterocyten. De cytokine RANKL is essentieel in de ontwikkeling van M-cellen, en toevoeging van RANKL en TNF-α aan cultuur media bevordert een subset van cellen van ileale-enteroïden om onderscheid te maken in M-cellen. Het volgende protocol beschrijft een methode voor de differentiatie van M-cellen in een transwell epitheel gepolariseerd monolaag-systeem van de darm met behulp van menselijke ileale-enteroïden. Deze methode kan worden toegepast op de studie van M-celontwikkeling en-functie.

Introduction

M (microfold) cellen zijn gespecialiseerde intestinale epitheliale cellen gevonden in de eerste plaats in de follikel geassocieerde epitheel (FAE) van de darm bovenliggende kleine lymfoïde gebieden genoemd Peyer's patches1. M-cellen hebben korte onregelmatige apicale microvilli en zijn diep invaginated op hun basolaterale kant, waardoor immuuncellen nauw kunnen verblijven in hun cellichaam2. Deze unieke morfologie stelt M-cellen in staat om antigeen van het apicale lumen van de darm te proeven en deze rechtstreeks aan de onderliggende immuuncellen te leveren2. Op deze manier zijn M-cellen belangrijk voor immuun surveillance in de darm, maar kunnen ze ook worden misbruikt door pathogenen voor binnenkomst in de lamina propria1,2,3,4,5, 6,7.

De studie van M-cellen is gehinderd door verschillende factoren. Eerste, M cellen zijn te vinden op een lage frequentie in de muis en de menselijke darm8. In gekweekte cellen systemen, M cel-achtige cellen zijn geïnduceerd om te differentiëren door coculturing een gepolariseerde adenocarcinoom cellijn, CaCO-2, met ofwel b lymfocyten van muis Peyer patches of de b Cell lymfoom cellijn, Raji B9,10 . Dit resulteert in een subset van CaCO-2-cellen die de M-celmarkeringen sialyl Lewis a antigen en UEA-1 in het gepolariseerde epitheel9,10uitdrukken. (Deze markers worden ook uitgedrukt in Goblet cellen in intestinale weefsels, dus tegenwoordig worden minder vaak gebruikt als definitieve M cel markeringen11,12.) Dit CaCO-2-M-celsysteem is gebruikt om de opname van deeltjes en bacteriën translocatie13,14te bestuderen. Echter, CaCO-2 cellen zijn een gevestigde cellijn van een grote intestinale adenocarcinoom met de verstorende factor dat verschillende bronnen van CaCO-2 cellen verschillende fenotypes tussen Labs15weergeven. Verder kunnen ze de transcriptie niveaus van echte M-cellen niet volledig recapituleren, omdat ze geen uitdrukking hebben van de momenteel bekende M-celmarkeringen GP2 en SpiB16. Daarom zijn aanvullende en fysiologisch relevante cultuur modellen nodig om M-celontwikkeling en-functies te kunnen bestuderen.

In de afgelopen tien jaar, het gebied van enteroid-afgeleide modelsystemen van de darm is snel vooruitgang van de eerste ontdekking dat intestinale stamcellen afgeleid van menselijke intestinale biopsie kunnen zichzelf propageren en Self-renew in cultuur 17 , 18. belangrijk is dat het verwijderen van stamcel bevorderende factoren uit de groeimedia deze stamcel culturen kan onderscheiden in de vele celtypen die in de darm18worden aangetroffen. Bovendien, recent werk suggereert het belang van Rankl-rang signalering in M celontwikkeling in de darm19,20. De rang receptor is een lid van de TNF familie van receptoren die wordt uitgedrukt op epitheliale precursor cellen in de darm19 terwijl Rankl (de rang receptor ligand) wordt vrijgegeven door stromale cellen van de Peyer patches20. Aangezien de epitheliale celtypen aanwezig in ileale-enteroïden geen Rankl produceren, kan M celdifferentiatie in ileale enteroid culturen worden geïnduceerd door de toevoeging van Rankl aan de cultuur media21,22. Opname van TNFα in de cultuur media helpt bij de ontwikkeling van M-cellen in ileale-enteroïden23. Hier beschrijven we de methoden voor het induceren van differentiatie van M-cellen in intestinale monolagen afgeleid van menselijke ileale-enteroïden. Onze methodes zijn deels gebaseerd op wijzigingen van de volgende protocollen21,22,23.

Protocol

Alle hier beschreven methoden zijn goedgekeurd door de Tufts University IBC en IRB.

1. inducerende M celdifferentiatie in humaan Ileal Enteroid-afgeleide monolayers

Opmerking: Dit protocol maakt gebruik van ileale-enteroïden afgeleid van menselijk weefsel biopsie. Raadpleeg de gepubliceerde protocollen voor methoden over hoe te groeien en doorgang deze cellen18,24. De volgende methoden voor de ontwikkeling van monolagen werden aangepast van zou et al.24. Methoden voor het induceren van M cellen in ileale enteroid-afgeleide culturen werden aangepast uit eerdere rapporten21,22,23. Al het werk wordt uitgevoerd in een steriele weefselcultuur en incubaties zijn in de afzuigkap of weefselkweek incubator zoals aangegeven. Zie de tabel met materialen die nodig zijn om ileale enteroid monolagen en verschillende media te bereiden.

  1. Groei van de ileale-enteroïden gedurende 4-10 dagen in de extracellulaire matrix (ECM) (Zie tabel met materialen) (Figuur 1), afhankelijk van hun intrinsieke groeisnelheid, voordat zaaien op trans putten.
  2. Coating trans well membranen
    1. Plaats het gewenste aantal trans putten in een 24-putplaat die een twee kamer systeem creëert.
    2. Verdun ECM 25-voudige in koude steriele fosfaatgebufferde zoutoplossing (PBS) en voeg 100 μL koude verdunde oplossingen toe aan elke bovenste kamer op het membraan.
      Opmerking: De ecu-en verdunde ECM-oplossing moeten op ijs worden gehouden tot vlak voor de toevoeging.
    3. Bedek de 24-put plaat met deksel en plaats de plaat in een kweek van weefselkweek bij 37 °C gedurende 2 uur om de ecu-stolling op het membraan mogelijk te maken.
    4. Na 2 uur, verwijder de plaat uit de incubator en plaats in een weefselcultuur kap. Gebruik steriele pincet om elke trans well te omkeren om de resterende oplossing zachtjes te verwijderen. Laat de membranen aan de lucht drogen in de kap met het deksel open terwijl cellen worden verzameld (stappen 1.3.1-1.3.11).
  3. Dissociëren van de ileale-enteroïden in afzonderlijke cellen
    1. Verwijder de plaat van de ileale-enteroïden uit de incubator en verwijder voorzichtig de kweekmedia van elke put door vacuüm aspiratie of met een pipet.
      Opmerking: Een goed van ileale enteroïden bevattende ongeveer 100 gezonde cysten is voldoende om zaad 1.5-2 putten.
    2. Voeg 500 μL ijskoud 0,5 mM ethyleendiaminetetraazijnzuur (EDTA) toe aan elke put met ileale-enteroïden die in de ECM zijn opgehangen om de ECM op te splitsen. Pipetteer krachtig op en neer met een P1000 pipet die is ingesteld op 500 μL om de ecu op te splitsen, waardoor ileale-enteroïden in de oplossing worden gebracht. Om de ontbinding van de ECM te verbeteren, schud na het pipetteren de plaat gedurende 30 minuten krachtig op 4 °C.
    3. Verzamel de oplossing van elk goed in 15 mL conische buizen.
      Opmerking: Verzamel tot 10 putjes per 15 mL conische buis voor optimale enkelvoudige celverzameling.
    4. Pellet de cellen in een centrifuge bij 140 x g en 4 °c gedurende 5 min. pellet moet zichtbaar zijn, maar kan gemakkelijk worden gedemonveerd, dus Verwijder langzaam het supernatant door vacuüm aspiratie of met een pipet.
      Opmerking: Als u bezorgd over het verlies van pellets en cellen, gebruik een pipet en sla het supernatant in een aparte buis.
    5. Om nauwe junctie verbanden te verteren en de ileale-enteroïden in afzonderlijke cellen op te splitsen, moet de pellet in 500 μL kamertemperatuur trypsine per elke 5 putjes die in stap 1.3.3 worden verzameld, worden hervat. Gebruik een P1000 om de klontjes op en neer te scheiden en de buisjes in een waterbad van 37 °C gedurende 5 min. of minder te inbroed.
      Opmerking: Optimalisatie is nodig om de juiste hoeveelheid tijd te bepalen die nodig is om de buizen te inbroed, zodat de cellen worden afgebroken, maar niet overdreven trypsinized tot het punt dat ze sterven. Gebruik Trypan Blue in stap 1.3.9 om ervoor te zorgen dat de cellen levensvatbaar zijn na behandeling met trypsine.
    6. Voeg 1 mL Advanced DMEM/F12 toe met 10% foetaal runderserum (FBS) per 500 μL trypsine om de trypsine te deactiveren.
    7. Pipetteer op en neer met een P1000 ingesteld op 500 μL ten minste 50 keer tegen de zijkant van de conische buis om resterende klonters in afzonderlijke cellen verder te scheiden.
    8. Plaats een 40 μm-celzeef over een conische 50 mL en voeg 1 mL Advanced DMEM/F12 toe met 10% FBS om de celzeef nat te maken. Pipetteer de suspensie van één cel van de 15 mL conische op de zeef. Was de zeef met 1 mL Advanced DMEM/F12 met 10% FBS.
    9. Breng de cellen die door de cel zeef van de 50 mL conische in een nieuwe conische buis van 15 mL. Tijdens de centrifugeren stap 1.3.10, de cellulaire pellet zal gemakkelijker worden gezien in een 15 mL conische buis. Tel de cellen met behulp van een hemocytometer. Gebruik Trypan Blue om te controleren of cellen nog in leven zijn. Meestal wordt > 95% levensvatbaarheid waargenomen.
    10. Terwijl het tellen van de cellen, centrifugeer de cellen in de nieuwe 15 mL buis op 400 x g en kamertemperatuur voor 5 min. celpellet moet zichtbaar zijn. Verwijder voorzichtig het supernatant met een pipet en spaar het supernatant opnieuw in het geval dat de pellet wordt afgekeurd.
    11. Aangepaste volledige groeimedia voorbereiden25 (mcmgf + media) aangevuld met 10 μM Y-27632. Respendeer de cellen van gepileerde met 2,5 x 105 cellen/200 μL in mcmgf +. Zie opmerkingen in discussie over het optimaliseren van het zaaien nummer van cellen.
      Opmerking: MCMGF + media is geavanceerde DMEM/F12 met 75% L-Wnt3a airconditioning media, 10% R-spondin geconditioneerde media, 5% Noggin geconditioneerde media, 1x B27 supplement, 1x N2 supplement, 1 mM N-Acetylcysteïne, 50 ng/mL muis recombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrine 10 mM HEPES, 2 mM GlutaMAX, en 1x Penicillaire/streptomycine (optioneel).
    12. Zorg ervoor dat de met ECM gecoate membranen die in stap 1,2 zijn bereid volledig zijn gedroogd, zoals beoordeeld door het oog. Was de bovenste kamer met 200 μL MCMGF +. Voeg 200 μL celoplossing toe aan elke bovenste kamer.
    13. Voeg 700 μL MCMGF + met 10 μM Y-27632 toe aan elke onderste kamer. Plaats de plaat in een incubator voor weefselkweek van 37 °C met 5% CO2.
    14. Na 1 dag van de groei, verwijder de media uit de bovenste kamer en vervang met 200 μL van verse MCMGF +, om te voorkomen dat de groei van meerdere cellagen.
  4. Medium vervangen
    1. Zodra monolagen zijn ~ 80% Confluent, meestal tussen dagen 1-3 na het zaaien, vervangen basolaterale media met differentiatie media (DM) voor controle putten (zie stap 1.4.2 voor meer informatie) of met m Cell media voor m Cell inductie putten (zie stap 1.4.3 voor meer informatie). Vervang de media in de bovenste kamer door DM voor beide condities.
      Opmerking: DM is geavanceerde DMEM/F12 met 5% Noggin geconditioneerde media, 1x B27 supplement, 1x N2 supplement, 1 mM N-Acetylcysteïne, 50 ng/mL muis recombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrine I, 10 mM HEPES buffer, 2 mM GlutaMAX en 1x Penicillaire/streptomycine (optioneel ). M Cell media is DM aangevuld met 200 ng/mL RANKL en 50 ng/mL TNFα.
    2. Voor controle putten die geen M-cellen mogen bevatten, voeg 200 μL DM toe aan de bovenste kamer en 700 μL DM naar de onderste kamer.
    3. Om M-cellen te induceren, voeg 200 μL DM toe aan de bovenste kamer en 700 μL M-celmedia in de onderste kamer.
    4. Vervang de media elke 2 dagen. Vervang DM in de bovenste en onderste kamers voor controle putten. Vervang DM in de bovenste kamer en M-celmedia in de onderste kamer voor M-celputten.
      Opmerking: Overdag 7 post Cell-seeding, M cellen worden volledig geïnduceerd in de monolayers.

2. verifiëren van M-celdifferentiatie door qRT-PCR

Opmerking: Voer het volgende werk uit op een steriele RNAse vrije tafelruimte. Zie tabel met materialen voor een lijst met voorkeurs materialen voor QRT-PCR.

  1. Verwijder de media uit de bovenste en onderste kamers en was de bovenste kamer 2x zachtjes met 300 μL kamertemperatuur PBS.
  2. Voeg 300 μL Trizol toe aan elke bovenste kamer. Incuberen bij kamertemperatuur gedurende 5 min.
    Let op: Draag handschoenen en oogbescherming bij het gebruik van Trizol om contact met de huid te vermijden zoals aangegeven in de instructies van de fabrikant.
  3. Ondertussen, label microcentrifuge buizen voor elk goed en voeg 700 μL Trizol toe aan elke buis.
  4. Verzamel cel homogenaat door pipetteren op en neer 3x zachtjes met een P1000 en breng de inhoud over in de bijbehorende microcentrifuge buis. Vortex voor 5 s te mengen.
  5. Houd de monsters nog 3 min bij kamertemperatuur. Dan bewaren bij-80 °C gedurende maximaal één maand.
  6. Volg de standaard qRT-PCR-methodologie voor RNA-isolatie, DNase-behandeling, omgekeerde transcriptie en qRT-PCR-reacties. Raadpleeg de grondstof lijst in de Inhoudsopgave.

3. verifiëren van M-celdifferentiatie door immunofluorescentie

Opmerking: Houd altijd de onderste kamer van de plaat gevuld met PBS, zodat de membranen NAT blijven. Deze procedure wordt uitgevoerd op de Bank. Zie tabel met materialen voor een lijst van voorkeurs materialen voor immunofluorescentie.

  1. Verwijder de media uit de bovenste kamer en was 2x zachtjes met 300 μL kamertemperatuur PBS. Voeg 100 μL kamertemperatuur 4% PFA in PBS toe aan de bovenste kamer. Bedek de plaat met folie en laat 25 minuten staan bij kamertemperatuur. Verwijder 4% PFA.
    Let op: 4% PFA moet naar behoren worden afgevoerd als gevaarlijk chemisch afval.
  2. Was de bovenste kamer 3x met 300 μL kamertemperatuur PBS. Op dit punt kunnen monsters gedurende maximaal een maand vóór de kleuring op 4 °C blijven. Eenmaal bevlekt moeten monsters binnen een week worden gevisualiseerd voor afbeeldingen van de beste kwaliteit.
  3. Inbroed de monolagen met 100 μL van 5% boviene serum albumine (BSA) opgelost in PBS gedurende 30 minuten in het donker bij kamertemperatuur om de monolagen te blokkeren.
  4. Bereid de GP2 Primary antilichaam oplossing in 1% BSA in PBS bij een verdunning van 1:100. Voeg 100 μL per put toe. Vlek gedurende 1 uur bij kamertemperatuur in het donker. Verwijder de oplossing.
    Opmerking: Permeabiliseer de monolagen niet voordat primaire vlek voor GP2 optreedt, omdat optimale primaire GP2-oppervlakte kleuring van M-cellen wordt bereikt zonder permeisatie.
  5. Was de bovenste kamer 3x maal met 300 μL kamertemperatuur PBS.
  6. Bereid secundaire vlek oplossing van fluorescently gelabeld geit anti-muis IgG bij 1:200, phalloidin bij 1:100 en DAPI in 1% BSA + 0,1% Triton in PBS. Voeg 100 μL per put toe. Vlek gedurende 30 minuten bij kamertemperatuur in het donker.
    Opmerking: Triton wordt toegevoegd aan de secundaire vlek oplossing om de cellen tijdens deze stap te permeabiliseren voor een goede phalloidin vlek.
  7. Was 3x met 300 μL PBS.
  8. Plaats een druppel montage oplossing van 5 μL (tabel met materialen) op een glazen glijbaan. Verwijder de put van de 24 goed plaat en inverteren. Snijd het membraan voorzichtig van de put met behulp van een scalpel. Plaats het membraan met de cellen naar boven gericht op de druppel van de montage oplossing op de glazen glijbaan. Voeg 10 μL montage oplossing toe aan de bovenkant en het midden van het membraan en plaats een afdekplaat bovenop om het membraan tussen de glazen glijbaan en de dekglaasje te dichten.
  9. Droog de glaasjes bij kamertemperatuur in het donker gedurende 24 uur. gekleurde dia's moeten worden gevisualiseerd op confocale Microscoop binnen 1 week na de kleuring.

Representative Results

Ileale-enteroïden die in ECM worden geteeld, worden visueel geanalyseerd en door qRT-PCR voor hun relatieve gezondheidstoestand en differentiatie toestanden als een middel voor kwaliteitscontrole voor ileale enteroid culturen en voor gebruik in monolagen. Ongedifferentieerde ileale-enteroïden die in ecu worden geteeld, lijken helder en cystic in morfologie, wat duidt op de aanwezigheid van veel stamcellen (Figuur 1a). Na verloop van tijd, ongedifferentieerde ileale-enteroïden geteeld in groeimedia kunnen nemen op een tussenliggende fenotype waar sommige Cystic verschijnen en sommige lijken ondoorzichtig (Figuur 1b). Onze ongedifferentieerde monsters lijken vaak op die in Figuur 1b in plaats van Figuur 1a. Deze tussenliggende culturen bevatten meer terminaal gedifferentieerde enterocyten zoals gemeten door uitdrukking van de enterocyte marker, sucrase isomaltase (SI), en vermoedelijk geëxtrudeerde dode enterocyten in het lumen dragen bij aan hun dichte uiterlijk. Ileal-enteroïden kunnen in deze intermediaire toestand worden gebruikt voor de ontwikkeling van monolagen, maar het moet in gedachten worden gehouden dat de hoeveelheid intestinale stamcellen in de culturen laag kan zijn, en sommige gedifferentieerde celtypen kunnen aanwezig zijn (zie bijvoorbeeld qRT-PCR- gehalten in niet-gedifferentieerde monsters die zijn geteeld in ecu die lijken op Figuur 1b in Figuur 2). Ter vergelijking, ileale enteroids gekweekt met differentiatie media in ECM voor 5 + dagen zal uniform verduisterd en lobulair en culturen met deze morfologie zijn niet goed kandidaten voor zaaien monolagen (figuur 1c).

Expressie van stamcel genen en genen van intestinale celdifferentiatie kan worden geanalyseerd door qRT-PCR als een andere manier om de gezondheidstoestand van ileale-enteroïden die in ECM worden geteeld te beoordelen en hun differentiatie capaciteiten, eenmaal als monolagen op trans putten. De uitdrukking van een stamcel gen, LGR5, een enterocyte gen, si, een Goblet celgen, MUC2, en een Paneth celgen, lyz, wordt vergeleken tussen ongedifferentieerde ileale enteroid culturen die in ECM worden geteeld en gedifferentieerde ileale enteroid monolagen in de aanwezigheid of afwezigheid van Rankl/tnfα (Figuur 2). Hoewel de waarden kunnen verschillen tussen experimenten, expressie van LGR5 moet afnemen na differentiatie van monolagen18,26. LGR5 expressie wordt meestal niet gedetecteerd in de gedifferentieerde ileale monolagen zonder Rankl en tnfα op dag 7. Omgekeerd, expressie van markers van differentiatie van specifieke celtypen, zoals si en MUC2, toenemen na differentiatie18. De uitdrukking van Lyz neemt over het algemeen af na differentiatie in onze culturen. Als de ileale enteroid culturen die worden gebruikt voor het maken van monolagen meer op Figuur 1b lijken dan Figuur 1a, kunnen stijgingen van de intestinale differentiatie markeringen bescheiden na differentiatie zijn omdat deze eerste culturen heterogeen zijn in intestinale celtypen en hebben een hoger basaal niveau van si en MUC2. Differentiatie in monolagen komt echter nog steeds voor als beoordeeld door verlies van LGR5 expressie en microscopie (zie hieronder). Bovendien vermindert de toevoeging van RANKL en TNFα aan de differentiatie media het verlies van LGR5 expressie (Figuur 2). Parallel, de uitdrukking van si en MUC2 zijn iets lager dan in de gedifferentieerde toestand ontbreekt Rankl en tnfα hoewel hun niveaus boven de ongedifferentieerde voorwaarde toenemen.

M celdifferentiatie in monolagen wordt zowel door QRT-PCR als door immunofluorescentie bepaald met behulp van twee M cel-specifieke markers, inclusief celoppervlak glycoproteïne 2 (GP2) en transcriptiefactor spib21. De uitdrukking van de GP2 en spib is upregulated in de ileale-enteroid-afgeleide monolagen in de aanwezigheid van Rankl en tnfα en wordt niet gedetecteerd in niet-Rankl-en tnfα-behandelde monsters (Figuur 3). Expressie van deze markers kan ook worden genormaliseerd naar een stukje van kleine darmweefsel22, indien beschikbaar. Dit maakt de vouw verandering van deze m celmarkeringen te vergelijken met weefsel dat m cellen heeft in plaats van het beheersen van monolagen die geen uitdrukking van deze markers hebben en maakt standaardisatie tussen experimenten in één Lab. M-cellen worden ook gedetecteerd door de oppervlakte uitdrukking van de GP2 door immunofluorescentie (Figuur 4). Typisch, in een confluente monolayer, worden 1 tot 5 M cellen waargenomen in een gegeven Microscoop veld bij 40X vergroting door dag 6 tot en met 8 na seeding in monsters behandeld met RANKL en TNFα (Figuur 4a-D). Er wordt geen GP2-uitdrukking gezien in de onbehandelde monsters (figuur 4e). De orthogonale weergave van het XZ-vlak met een phalloidin-sonde toont actine-structuren rond elke cel en de GP2-uitdrukking op het apicale oppervlak van M-cellen (Figuur 4F-G). Dit model aan de lage frequentie van M cellen gevonden in de darm van de mens1,2,8. Om M-cellen te zuiveren en te isoleren voor verder onderzoek, kunnen M-cellen worden gekleurd met behulp van de GP2-oppervlakte uitdrukking en gesorteerd met behulp van FACS voor de GP2 +-cellen.

M-cellen binden aan en transporteren antigeen van de intestinale lumen naar de immuuncellen die zich onder het epitheel2bevinden. Secretoire Iga geproduceerd in de darm bindt aan bacteriën en kan binden aan het apicale oppervlak van M cellen ter vergemakkelijking van het transport van de microben27,28. Om te bepalen of de M-cellen die in dit model zijn ontwikkeld, in staat zijn om te binden aan IgA, wordt humaan serum IgA toegevoegd aan de bovenste kamer, toegestaan om te binden voor 1 h, en vervolgens worden de monolagen bereid voor immunofluorescentie analyse. De aanwezigheid van IgA op M-cellen wordt gevisualiseerd met behulp van een fluor-geconjugeerd secundair antilichaam dat de zware keten van humaan serum IgA herkent. M-cellen die zijn behandeld met IgA voor 1 uur hebben IgA gebonden aan het apicale oppervlak (figuur 5a), terwijl m-cellen in controle putten die alleen werden behandeld met het secundaire antilichaam voor Iga geen detecteerbaar signaal hebben (Figuur 5b). Verder bindt IgA zich specifiek aan het apicale oppervlak van M-cellen en is het niet gebonden aan cellen die de GP2-oppervlakte vlek missen. Bovendien hebben M-cellen karakteristieke kortere dichte actine op hun apicale oppervlak2. Om de morfologie van de M-cel in dit model te analyseren, worden ileale-enteroid-afgeleide monolagen gedurende 7 dagen geteeld en geoogst voor immunofluorescentie analyse van F-actin met phalloidine. Metingen van de intensiteit van actine pixels worden berekend voor M-cellen en voor niet-M-cellen die direct naast elke M-cel worden gebruikt met ImageJ-software (Figuur 6a). De actin-intensiteit wordt verlaagd op de GP2 + M-cellen in dit model en een representatief beeld wordt weergegeven in Figuur 6b. Over het algemeen hebben de M-cellen die zijn ontwikkeld in dit ileale enteroid-afgeleide monolaag-model karakteristieke genexpressie, morfologie en sommige M-celfuncties van humane intestinale M-cellen, zoals binding aan Iga.

Figure 1
Figuur 1: representatieve morfologie van menselijke ileale-enteroïden in ECM na splitsing van één week. A) heldere en cystische ongedifferentieerde ileale-enteroïden. B) intermediair fenotype met enkele Cystic ileale enteroids en enkele ondoorzichtige lobulaire ileale-enteroïden. C) verduisterd en lobulaire gedifferentieerde ileale-enteroïden. Beelden genomen door de lens van een optische lichtmicroscoop met 4x vergroting met behulp van een iPhone7 camera. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: relatieve expressie van stamcel-en differentiatie markeringen van menselijke ileale-enteroïden die in ecu worden geteeld of worden gedifferentieerd als monolagen. Ileal-enteroïden werden gedurende 7 dagen geteeld in ecu (ongedifferentieerd) of gekweekt en gedifferentieerd als monolagen zonder (gedifferentieerd) of met RANKL en TNFα (gedifferentieerd + R/T). Ileal enteroid culturen of monolagen werden geoogst in trizol voor RNA-extractie. Genexpressie werd bepaald door qRT-PCR en wordt uitgedrukt ten opzichte van Gapdh. Gegevens zijn gemiddeld 3 onafhankelijke putten van ileale-enteroïden of monolagen per aandoening. Foutbalken geven aan dat SEM. ND niet is gedetecteerd. Statistische significantie werd bepaald op Log-getransformeerde waarden met behulp van One-way ANOVA met Dunnett de meervoudige vergelijkingstest vergeleken met de ongedifferentieerde. * * p < 0,01, * * * p < 0,001 Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: relatieve expressie van M-cel-specifieke markers GP2 en spib van humane ileale-enteroid-afgeleide monolayers. Rankl/tnfα behandelde en niet-behandelde humane ileale enteroid-afgeleide monolagen werden na 7 dagen na het zaaien in trizol voor RNA-extractie geoogst. Genexpressie werd bepaald door qRT-PCR en wordt uitgedrukt ten opzichte van Gapdh. Gegevens zijn gemiddeld 6 onafhankelijke monolagen per aandoening. Foutbalken geven aan dat SEM. ND niet is gedetecteerd. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: immunofluorescentie van de GP2-expressie van het oppervlak op M-cellen in humane ileale-enteroid-afgeleide monolagen na verloop van tijd. RANKL/TNFα behandelde en niet-behandelde humane ileale enteroid-afgeleide monolagen werden vastgesteld in 4% PFA en gekleurd voor immunofluorescentie op verschillende aangegeven dagen na het zaaien. Afbeeldingen werden geanalyseerd met behulp van ImageJ-software. DAPI = blauw; Glycoproteïne 2 (GP2) = rood. (a-D) Rankl/tnfα behandelde monolagen op verschillende dagen na de seeding. E) niet-behandelde monolaag die op dag 7 na het zaaien wordt geoogst. (F-G) Orthogonaal xz-vlak van monolagen op dag 7 na seeding overgelegd met phalloidin-sonde voor F-actin. Phalloidin = cyaan. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: Iga bindt specifiek aan het apicale oppervlak van M-cellen. RANKL/TNFα-behandelde humane ileale-enteroid-afgeleide monolagen werden gedurende 7 dagen geteeld en vervolgens (a) behandeld met 10 μg humaan serum Iga voor 1 uur of (B) met een mock behandeld met PBS alleen (geen Iga-controle). Na 1 h werden monolagen 2x in PBS gewassen, werden opgelost in 4% PFA, permeabel met 0,1% tritonx-100, en gekleurd voor immunofluorescentie. Afbeeldingen werden geanalyseerd met behulp van ImageJ-software en zijn representatief voor 3 onafhankelijke experimenten. DAPI = blauw; Glycoproteïne 2 (GP2) = rood; Antilichamen tegen humaan serum IgA = groen; Phalloidin = cyaan. Zwarte pijlen duiden IgA gebonden aan apicale oppervlak van M cel. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6: M-cellen hebben een verminderde actine-intensiteit in vergelijking met aangrenzende niet-M-cellen. RANKL/TNFα-behandelde humane ileale enteroid-afgeleide monolagen werden gedurende 7 dagen geteeld en vervolgens vastgesteld op 4% PFA en werden bevlekt voor immunofluorescentie. (A) met IMAGEJ werden GP2 + M-cellen geschetst met behulp van de FreeHand Selection Tool en metingen van het gebied en de geïntegreerde dichtheid werden genomen in het Phalloidin-kanaal. Dezelfde analyse werd vervolgens voltooid voor elke aangrenzende niet-M-cel die de M-cel buren. De onbewerkte geïntegreerde dichtheid werd gedeeld door het gebied van elke individuele cel voor normalisatie. De gemiddelde geïntegreerde dichtheid/oppervlakte werd berekend voor elke aangrenzende niet-M-cellen voor elke M-cel. Beelden werden geanalyseerd van 3 onafhankelijke experimenten; elke stip is een M-cel of gemiddelde van naburige cellen. Foutbalken geven SD aan. statistische significantie werd bepaald op Log-getransformeerde waarden met behulp van een gekoppelde t-test. p = 0,0001 (B) representatief beeld van xz-vlak vanaf plot in A. afbeeldingen werden geanalyseerd met behulp van imagej-software. DAPI = blauw; Glycoproteïne 2 (GP2) = rood; Phalloidin = cyaan. Klik hier om een grotere versie van dit cijfer te bekijken.

Discussion

Om monolagen te ontwikkelen die goed differentiëren in de belangrijkste intestinale celtypen en M-cellen, is het essentieel om op de hoogte te zijn van verschillende factoren. Ileal-enteroïden moeten worden geoogst uit ECM-culturen die ongedifferentieerd zijn en een hoog percentage van Lgr5 + stamcellen hebben. Visueel moet het merendeel van de ileale-enteroïden in de ECM-culturen niet worden verduisterd en multilobular, en moet LGR5 expressie in deze culturen worden gedetecteerd door QRT-PCR-analyse. Kwaliteitscontrole van geconditioneerde media is essentieel voor de verspreiding van niet-gedifferentieerde culturen in de loop van de tijd en moet worden voltooid voor elke batch geconditioneerde media die wordt geproduceerd. Kwaliteitscontrole kan worden voltooid door een nieuwe batch media te testen op sommige ECM-culturen en de morfologie van de ileale-enteroïden te vergelijken met een vorige media batch in de loop van een week. LGR5 expressie moet relatief vergelijkbaar blijven in de ileale enteroid culturen die in de nieuwe batch media worden geteeld ten opzichte van de vorige batch.

Tijdens de bereiding van de ileale-enteroïden voor het zaaien als monolagen is het belangrijk om de celoplossing krachtig te Pipetteer na incubatie met trypsine om de ileale-enteroïden in afzonderlijke cellen op te splitsen. Celklonters kunnen leiden tot meerlaagse vorming wanneer ze voor monolayers worden gesempt. Daarnaast is het essentieel om het aantal cellen dat nodig is om een monolaag te vormen, te bepalen voor elke afzonderlijke ileale enteroid lijn die wordt verkregen. Typisch, deze waarde kan variëren van 2,5 x 105 – 5,0 x 105 cellen/goed maar hangt af van de mate van Cystic tot niet-Cystic ileale enteroids in culturen en varieert voor elke afzonderlijke ileale enteroid lijn. Uit ervaring, ileale-enteroïden gekweekt in ECM die lijken minder Cystic vereisen hogere celseeding dichtheid om monolagen te bereiken. Het is raadzaam om de bovenste kamer te wassen na 1 dag van de groei door zachtjes pipetteren van de media op en neer 2-3 keer en vervangen door nieuwe groeimedia. Dit proces spaanders cellen die zijn geland op de top van andere cellen verminderen van de kans op meerlaagse vorming. Overschakelen van de media in de bovenste kamer van groeimedia naar M Cell media wanneer de monolagen zijn ~ 80% Confluent, die meestal optreedt op dag 2 na seeding, helpt bereiken goede M celdifferentiatie. Toevoeging van Rankl/tnfα aan de bovenste kamer tijdens M-celinductie leidt niet tot de ontwikkeling van een groter aantal M-cellen per monolaag en kan daarom buiten de media van de bovenste kamer worden gelaten. Trans putten van verschillende poriegroottes kunnen in dit protocol worden gebruikt zonder de ontwikkeling van M-cellen te beïnvloeden; de dichtheid van de celseeding moet echter worden geoptimaliseerd voor mensen met een grotere poriegrootte. Collageen IV kan worden vervangen door ECM als een kelder membraan proteïne coating voor trans putten of goed platen die beter geschikt voor bepaalde toepassingen kunnen zijn.

Ileal enteroid-afgeleide monolagen op trans Wells bieden een tweekamer systeem dat het mogelijk maakt om gedefinieerde apicale en basolaterale oppervlakken te creëren, zodat de 4-5 verschillende soorten epitheel intestinale cellen kunnen polariseren om oppervlak markeringen op elke zijde ten opzichte van de in de darm gevonden. Aanvullende factoren kunnen aan beide zijden worden toegevoegd, zoals deeltjes, infectieuze agentia of andere celtypen. Tot op heden blijven echter enkele beperkingen bestaan. Zoals beschreven, dit systeem is een statisch systeem dat geen fysiologische stroming, intestinale contracties, en intestinale inhoud ontbreekt. Daarnaast is de villus-crypt-architectuur verloren gegaan door de vorming van een platte monolayer. Deze systemen missen Peyer's patch gebieden, immuuncellen en stromale cellen. Of het gebrek aan immuun en stromale cellen die nauw onder M cellen wonen beïnvloedt de invaginaties die niet worden waargenomen in dit systeem en andere fysiologische werking is een belangrijk toekomstig gebied van onderzoek. Dit protocol kan worden aangepast aan een 96-well plaat of een multi-well plate formaat. De procedure voor het coaten van de 96-boorput plaat met ECM en zaaien met enkelvoudige cellen van ileale-enteroïden blijft hetzelfde als voor trans putten. Titratie van de celseeding dichtheid vereist voor het verkrijgen van monolagen moet worden gedaan, maar meestal varieert van 1,0 x 105 – 3,0 x 105 cellen/goed in een 96-well plaat formaat. M-cellen worden geïnduceerd door het vervangen van de groeimedia met M-celmedia wanneer de monolagen 80% Confluent Health zijn, meestal door dagen 1-3, afhankelijk van de eerste celseeding dichtheid.

Deze methode van het differentiëren van M cellen van ileale-enteroïden in vitro biedt significante verbeteringen ten opzichte van de CaCO-2-methode. De ileale-enteroïden zijn primaire cellen en ten minste 4-5 epitheelcellen zijn aanwezig in het systeem. Bovendien, ileale enteroid lijnen afgeleid van verschillende mensen kunnen worden bestudeerd om te onderzoeken hoe genetica of ziekte staat beïnvloeden M celontwikkeling en gedrag. Extra manipulatie van de ileale-enteroïden tijdens M-celdifferentiatie zal een beter begrip van M-celontwikkeling mogelijk maken, inclusief het karakteriseren van M-celprecursor cellen. Tot slot, aangezien de moleculaire mechanismen van M-cel fagocytose en transcytose nog steeds niet volledig worden begrepen3,29, biedt dit model de mogelijkheid om antigeen-en deeltjes opname door M-cellen te bestuderen en te visualiseren.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gesteund door NIAID U19AI131126 aan Dr. Isberg (Tufts University School of Medicine) en Dr. Kaplan (Tufts University); (JM is project 2 Leader) en NIAID R21AI128093 aan JM. ACF werd deels ondersteund door NIAID T32AI007077. SEB en MKE werden ondersteund door NIAID U19AI116497-05. We bedanken leden van het Mecsas Lab, het ng Lab en Dr. Isberg aan de Tufts University School of Medicine voor nuttige discussies. De confocale beeldvorming werd uitgevoerd in het Tufts centrum voor neurowetenschappelijk onderzoek, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics