Mapeo genético de las diferencias de termotolerancia entre especies de levadura Saccharomyces a través del análisis de hemizygosity recíproca en todo el genoma

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La hemizigosidad recíproca a través de la secuenciación (RH-seq) es un nuevo y poderoso método para mapear la base genética de una diferencia de rasgos entre especies. Los grupos de hemizygotes son generados por la mutagénesis de la transposon y su estado físico es rastreado a través del crecimiento competitivo usando la secuenciación alta a lo largo de la secuenciación. El análisis de los datos resultantes identifica los genes subyacentes al rasgo.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Un objetivo central de la genética moderna es entender cómo y por qué los organismos en la naturaleza difieren en fenotipo. Hasta la fecha, el campo ha avanzado en gran medida en la fuerza de los métodos de mapeo de vinculación y asociación, que trazan la relación entre las variantes de secuencia de ADN y el fenotipo a través de la progenie recombinante a partir de apareamientos entre individuos de una especie. Estos enfoques, aunque poderosos, no son adecuados para las diferencias de rasgos entre especies aisladas reproductivamente. Aquí describimos un nuevo método para la disección del genoma de la variación del rasgo natural que se puede aplicar fácilmente a especies incompatibles. Nuestra estrategia, RH-seq, es una implementación en todo el genoma de la prueba recíproca de hemizygote. Lo aprovechamos para identificar los genes responsables del sorprendente crecimiento a altas temperaturas de la levadura Saccharomyces cerevisiae en relación con su especie hermana S. paradoxus. RH-seq utiliza mutagénesis transposon para crear un conjunto de hemizygotes recíprocos, que luego se rastrean a través de una competencia de alta temperatura a través de la secuenciación de alto rendimiento. Nuestro flujo de trabajo de RH-seq como se establece aquí proporciona una manera rigurosa e imparcial de diseccionar rasgos antiguos y complejos en el clado de levadura en ciernes, con la advertencia de que se necesita una secuenciación profunda que consume muchos recursos para garantizar la cobertura genómica para la cartografía genética. A medida que los costos de secuenciación disminuyen, este enfoque es muy prometedor para el uso futuro en eucariotas.

Introduction

Desde los albores del campo, ha sido un objetivo primordial en genética entender la base mecanicista de la variación entre individuos salvajes. A medida que mapeamos loci subyacentes a un rasgo de interés, los genes emergentes pueden ser de uso inmediato como dianas para el diagnóstico y los fármacos, y pueden arrojar luz sobre los principios de la evolución. El estándar de la industria hacia este fin es probar una relación entre el genotipo y el fenotipo a través de una población a través de la vinculación o asociación1. Tan poderosos como estos enfoques, tienen una limitación clave: se basan en grandes paneles de progenie recombinante de cruces entre individuos interfértiles. No sirven de nada en el estudio de especies que no pueden aparearse para formar progenie en primer lugar. Como tal, el campo ha tenido poca capacidad para disección imparcial de las diferencias de rasgos entre las especies aisladas reproductivamente2.

En este trabajo informamos de los fundamentos técnicos de un nuevo método, RH-seq3, para estudios a escala del genoma de la base genética de la variación del rasgo entre especies. Este enfoque es una versión masivamente paralela de la prueba recíproca de hemizygote4,5, que fue concebida por primera vez como una manera de evaluar los efectos fenotípicos de las diferencias alélicas entre dos orígenes genéticamente distintos en un locus particular (Figura1A). En este esquema, los dos individuos divergentes se aparean primero para formar un híbrido, la mitad de cuyo genoma proviene de cada uno de los padres respectivos. En este fondo, se generan varias cepas, cada una de las cuales contiene una copia interrumpida o eliminada del alelo de cada uno de los padres del locus. Estas cepas son hemizygous ya que permanecen diploides en todas partes en el genoma excepto en el locus de interés, donde se consideran haploides, y se conocen como recíprocas ya que cada una carece de alelo de un solo padre, con su alelo restante derivado del otro padre. Al comparar los fenotipos de estas cepas recíprocas de hemizigoto, se puede concluir si las variantes de secuencia de ADN en el locus manipulado contribuyen al rasgo de interés, ya que las variantes en el locus son la única diferencia genética entre la recíproca hemizygote cepas. De esta manera, es posible vincular las diferencias genéticas entre las especies con una diferencia fenotípica entre ellas en una configuración experimental bien controlada. Hasta la fecha, las aplicaciones de esta prueba han estado en un marco candidato-gen, es decir, casos en los que la hipótesis ya está en la mano de que la variación natural en un locus candidato podría afectar a un rasgo.

En lo que sigue, establecemos el protocolo para una pantalla de hemizigosidad recíproca a escala del genoma, utilizando la levadura como sistema modelo. Nuestro método crea un complemento genómico de mutantes hemizygote, generando híbridos F1 viables y estériles entre especies y sometiéndolos a mutagénesis de transposión. Agrupamos los hemizygotes, medimos sus fenotipos en ensayos basados en secuenciación y probamos las diferencias de frecuencia entre los clones de la piscina que llevan los alelos de los dos padres de un gen dado. El resultado es un catálogo de loci en el que las variantes entre especies influyen en el rasgo de interés. Implementamos el flujo de trabajo de RH-seq para dilucidar la base genética de las diferencias de termotolerancia entre dos especies de levadura en ciernes, Saccharomyces cerevisiae y S. paradoxus,que divergieron hace 5 millones de años6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Preparación del plásmido que contiene piggyBac para la transformación

  1. Saltear a colonias individuales la cepa E. coli que alberga plásmido pJR487 en una placa de agar LB + carbenicilina. Incubar durante 1 noche a 37oC o hasta que aparezcan colonias individuales.
    NOTA: Una descripción de cómo se clonó el plásmido pJR487 se puede encontrar en nuestro trabajo anterior3.
  2. Inocular 1 L de LB + carbenicilina a 100 g/ml con una sola colonia de E. coli que contenga pJR487 en un matraz de vidrio de 2 L. Crecer durante la noche a 37 oC con agitación a 200 rpm hasta que esté saturado (OD600 s 1,0).
  3. Purifique el ADN plásmido del cultivo utilizando un kit de preparación de plásmido a gran escala como se indica en el protocolo publicado por el fabricante (ver Tabla de Materiales para más detalles). Eluir el ADN después de una incubación de 10 minutos con 5 ml de tampón de elución calentado a 37 oC.
  4. Mida la cantidad y calidad del ADN plásmido con un espectrofotómetro (ver Tabla de Materiales para más detalles).
  5. Repita los pasos 1.2 – 1.4 hasta que un total de al menos 11 mg de ADN plásmido en una relación A260:A280 de al menos 1.8 estén aislados. Esto puede tomar algunos preparativos, dependiendo de la eficiencia.
  6. Mezclar todos los preparativos de plásmido en un solo tubo y llevar el volumen total hasta 20 ml con tampón de elución o agua. Mida la cantidad y la calidad final de nuevo con un espectrofotómetro. La concentración de plásmido debe ser de al menos 538 ng/L en este volumen final de 20 ml. Si la concentración es superior a 538 ng/L, diluya el plásmido con tampón de elución o agua a 538 ng/L. El plásmido se puede almacenar a 4 oC hasta unas pocas semanas hasta su uso.

2. Creación de un conjunto de hemizitos recíprocos no dirigidos en todo el genoma

  1. Preparación de células de levadura híbridas para la transformación
    1. Saque el JR507 de una cepa de caldo de congelador de -80 oC a colonias individuales en una placa de agar YPD. Incubar a 26oC durante 2 días o hasta que aparezcan las colonias.
      NOTA: JR507 es una cepa híbrida hecha a través del acoplamiento de una sola célula de esporas haploides de S. cerevisiae DBVPG1373 y S. paradoxus Z1 (utilizando un microscopio de disección tetrad)3.
    2. Inocular 100 ml de YPD líquido en un matraz de vidrio de 250 ml con una sola colonia de JR507 y agitar a 28 oC, 200 rpm durante 24 horas o hasta que se alcance la fase estacionaria.
    3. Al día siguiente, medir la densidad óptica a 600 nm (OD600) del cultivo nocturno. Cree un nuevo cultivo diluyendo parte del cultivo nocturno con YPD líquido fresco en un nuevo matraz de vidrio de 1 L a una OD600 de 0,2 y un volumen de 500 ml.
      NOTA: Ejemplo de cálculo de una dilución posterior si el cultivo nocturno tiene un OD600 de 5.0, donde C es densidad óptica y V es volumen:
      Equation 1
      Por lo tanto, 20 mL de cultivo de la noche saturada se añadirían a 480 mL de YPD líquido para hacer un total de 500 mL de cultivo en una OD600 de 0.2.
    4. Repita el paso 2.1.3 tres veces más para hacer un total de cuatro cultivos de 500 ml en una OD600 de 0,2 en cuatro matraces de vidrio de 1 L, utilizando el mismo cultivo nocturno para los cuatro nuevos cultivos. Incubarlos a 28oC durante 6 horas (2-3 generaciones) agitando a 200 rpm.
    5. Combine dos de las culturas de 500 ml para crear una cultura de 1 L. Combine las dos culturas restantes de 500 ml para crear otra cultura de 1 L. En este punto, hay dos culturas de 1 L. Cada uno de estos cultivos de 1 L estará sujeto a transformación con pJR487 en los siguientes pasos.
  2. Transformación de pJR487 en células de levadura híbridas
    1. Divida cada uno de los cultivos de 1 L en veintitrés alícuotas de 50 ml en 20 tubos cónicos de plástico para un total de 40 tubos. Deje a un lado 20 tubos y realice los siguientes pasos en 20 tubos a la vez.
    2. Centrifugar cada uno de los veinte tubos durante 3 min a 1.000 x g para peletizar las células de levadura. Descarta el sobrenadante.
    3. Resuspenda cada pellet con 25 ml de H2O estéril por vórtice. Centrífuga durante 3 min a 1.000 x g. Descarta el sobrenadante.
    4. Resuspenda cada pellet con 5 ml de 1x TE, 0,1 M de búfer LiOAc por vórtice. Centrífuga durante 3 min a 1.000 x g. Descarta el sobrenadante.
    5. Repita el paso 2.2.4. Mientras que las células son centrifugadoras, preparar al menos 120 mL de una solución de 39.52% polietilenglicol, 0.12 M LiOAc y 1.2x Tris-EDTA buffer (12 mM Tris-HCl y 1.2 mM EDTA). Almacenar en hielo.
    6. Para preparar el ADN plásmido para la transformación, primero hierva 4 ml de ADN esperma de salmón a 100 oC durante 5 min e inmediatamente enfriarlo en hielo durante 5 min. A continuación, mezclar 20 ml de pJR487 (obtenido en la sección 1) a una concentración de 538 ng/L con los 4 ml de ADN esperal esperal de salmón enfriado para un volumen total de 24 ml. Mantener en hielo hasta su uso.
    7. Añadir 600 ml de ADN plásmido mezclado con ADN espermeado de salmón encima de cada pellet celular. No resuspenda todavía.
    8. Añadir 3 ml de solución PEG-LiOAc-TE fabricada en el paso 2.2.5 a cada pellet. Resuspende el pellet pipeteando hacia arriba y hacia abajo y vórtina.
    9. Incubar cada tubo durante 10 minutos a temperatura ambiente.
    10. Choque por calor de cada tubo durante 26 minutos en un baño de agua ajustado a 39 oC.
      NOTA: Cada pocos minutos, invierta cada tubo para evitar que las células se asienten en la parte inferior del tubo.
    11. Centrifugar cada tubo durante 3 min a 1.000 x g. Deseche el sobrenadante y resuspenda cada pellet en 10 ml de YPD vórtrelo. Combine los veinte tubos en un nuevo matraz de vidrio. El volumen total de las celdas debe ser de 200 ml.
    12. Transfiera 66,6 ml de células a un nuevo matraz de vidrio de 1 L y lleve hasta un volumen de 500 ml con YPD líquido. Repita dos veces más para utilizar los 200 ml completos de celdas transformadas. Mida el OD600 de cada nuevo cultivo de 500 ml (espere un OD600 de 0,35-4).
    13. Agitar los tres matraces a 28oC durante 2 horas para recuperarlos (<1 generación) a 200 rpm.
    14. Añadir 0,5 ml de 300 mg/ml G418 a cada uno de los tres matraces, a una concentración final de 300 g/ml G418 y volver a agitar a 28oC, 200 rpm.
      NOTA: Antes de este paso, las celdas híbridas transformadas se han estado recuperando de la transformación. Tras la adición de G418, se selecciona la presencia del plásmido pJR487. Cualquier célula que no tomó el plásmido durante la transformación comenzará a morir.
    15. Repita los pasos 2.2.2 – 2.2.14 con los 20 tubos cónicos restantes de las células. En este punto debe haber seis matraces de vidrio de 1 L, cada uno con 500 ml de celdas con G418 añadido.
    16. Incubar los seis matraces de células a 28 oC, agitando a 200 rpm, durante aproximadamente 2 días o hasta que se alcance una OD600 de 2,3 euros en cada matraz. Combina los seis matraces para crear una sola cultura.
      NOTA: Aunque todas las celdas de esta referencia cultural no se utilizarán en pasos posteriores, el objetivo de usar volúmenes tan grandes ha sido crear tantos eventos de transformación únicos como sea posible y normalizar cualquier sesgo en una sola transformación abanagruparlos todos Juntos.
    17. Utilice el cultivo creado en 2.2.16 para inocular dos nuevos matraces de 1 L con 500 ml de YPD + G418 (300 g/ml) a un OD600 de 0,2. Habrá cultura sobrante que se puede descartar.
    18. Incubar ambos matraces de 1 L a 28oC durante la noche, con agitación a 200 rpm, hasta que cada uno alcance un OD600 de 2,2 euros (3,5 generaciones). Combine ambas culturas en una sola cultura y mida de nuevo la Do600 de la cultura combinada.
      NOTA: En este punto, el cultivo debe estar compuesto casi en su totalidad de células que albergan plásmido pJR487. En parte de la población de células, el transposón PiggyBac habrá sido transpuesto del plásmido al genoma por la transposasa expresada fuera del plásmido. Sin embargo, la expresión continua de la transposasa puede conducir a la transposición durante el curso de una selección, lo que oscurecería la relación entre el genotipo y el fenotipo. El objetivo de los siguientes pasos es realizar una contraselección contra la presencia del plásmido, para asegurarse de que no haya más expresión de la transposasa. El grupo resultante es una mezcla de células con o sin el transposón integrado en el genoma, pero sólo las células que contienen el transposón se detectan durante los pasos de mapeo posteriores. El tiempo de transformación durante el cual se expresa la transposasa, antes de que se pierda la codificación plásmido, puede regir la posibilidad de que un clon dado después de la mutagénesis alberga más de una inserción de transposon. La frecuencia de estos, que se manifiestan como mutaciones "secundarias" en el análisis de cualquier gen a la vez, se puede estimar mediante la matriz de un número definido de colonias después de la mutagénesis, luego la combinación de su ADN y secuencia que confirman el número de inserción independiente posiciones en la piscina.
    19. Centrífuga 25 mL de este cultivo durante 3 min a 1.000 x g. Calcule el número total de600 unidades de celdas OD totales que se encuentran en los 25 ml (consulte el cálculo de ejemplo a continuación). Deseche el sobrenadante y resuspende en suficiente H2O para crear una suspensión celular de 1.85 OD600/mL por vórtice.
      NOTA: Ejemplo de cálculo para la resuspensión de células en agua si OD600 de cultivo combinado fue 2.2:
      Equation 2
      Por lo tanto, después de girar 25 ml de cultivo celular y desechar el sobrenadante, agregue suficiente H2O a las células para llevar el volumen total de células y agua hasta 29,7 ml (ya que el pellet celular también tendrá un volumen, agregue menos de 29,7 ml de H2O).
    20. Usando perlas de vidrio, placa 1 ml de celdas resuspendidas en agua sobre cada una de las 12 placas de agar sintéticas cuadradas grandes con 5-FOA. Incubar cada plato a 28oC durante 1-2 días o hasta que se forme un césped en la placa.
    21. Usando pequeñas chirriduras estériles, raspe las células de cada una de las 6 placas y en un tubo con 35 ml de agua estéril. Repita con las otras 6 placas para un total de dos tubos de células y agua. Combine todas las suspensiones celulares en un solo tubo. Mida la OD600 de esta suspensión, utilizando agua como blanco. Lleve la concentración de OD600/ml de células a 44,4 OD600 unidades/ml con agua. En nuestra experiencia, la eficiencia de transposición (la proporción de células KAN+ que son URA-) es en promedio del 50%.
    22. Determinar el número de existencias de congelador de -80 oC de células para almacenar. Cada alícuota se puede utilizar en el futuro para un solo experimento.
      NOTA: Dado el tiempo que consume la generación de la piscina, almacene varios viales en caso de mal uso accidental o para realizar experimentos de réplica. 20-30 acciones son un número razonable.
    23. Cada material congelador contendrá 40 OD600 unidades de células en 1 ml de DMSO al 10%. Agregue 900 l de células a 100 s de DMSO. Repita el proceso para el número total de stocks de congelador creados. Conservar cada uno a -80 oC para su uso futuro.

3. Selección de hemizygotes recíprocos en formato agrupado

  1. Descongelar desde el congelador de -80 oC una sola alícuota de hemizygotes recíprocos agrupados de la sección 2 a temperatura ambiente.
    NOTA: No deje que la alícuota se quede largamente a temperatura ambiente una vez que se descongela, úsela inmediatamente.
  2. Utilice la alícuota de 1 ml para inocular 150 ml de YPD líquido en un matraz de vidrio de 250 ml. Medir la OD600 de este cultivo, y luego incubar a 28 oC, temblando a 200 rpm, durante 7 horas, o hasta que la cultura haya pasado por 2-3 duplicaciones de población. En este punto, la cultura está lista para ser utilizada para inocular culturas sometidas a selección.
    NOTA: Ejemplo de cálculo: Si el OD600 del matraz original mide 0,25, incubar el cultivo hasta que alcance una OD600 de al menos 1,0. Si se desea algún punto de muestra en "Tiempo-cero" (T-0), como una manera de investigar la población de hemizygote antes de la selección, los pellets celulares se pueden tomar ahora mediante centrifugación de 5-10 ml de cultivo por pellet a 1.000 x g durante 3 min, descartando el sobrenadante y congelación a -80 oC.
  3. Utilice la piscina de hemizygote cultivada para inocular cultivos para su selección en un esquema de replicación adecuado, tanto a alta temperatura (39 oC) como a temperatura permisiva (28 oC). Como mínimo, establezca tres cultivos de selección de réplicas biológicas a cada temperatura, para un total de seis cultivos de selección.
    1. Cree cada cultivo de selección con un total de 500 ml en un matraz de vidrio de 2 L con YPD líquido e inocular a una Dota600 de 0,02. Agitar cada cultivo de selección a 100 rpm a 28 oC o 39 oC hasta que se hayan producido duplicaciones de población de 6-7 (correspondientes a una DoT600 de 1,28-2,56). Trate de emparejar lo más cerca posible la OD600 final de todas las culturas de selección.
      NOTA: Los cultivos de selección a 28 oC crecerán más rápido que los cultivos de selección a 39 oC. En consecuencia, los cultivos de selección a 39 oC pasarán un período de tiempo más largo en la incubadora. Continúe con los siguientes pasos con cada matraz a medida que esté listo, independientemente del número total de horas invertidas en la incubadora. En nuestra experiencia, las culturas a 28 oC o 39 oC tardaron 12 o 18 horas, respectivamente, en alcanzar una DoT de 2,0 euros. Las largas selecciones podrían tener la ventaja de amplificar pequeños efectos de fitness, pero también permitir que surjan mutaciones de fondo de novo, lo que introduciría ruido en la distribución final de fitnesss a través de mutantes de transposon en cualquier gen/alelo. Como tal, es importante limitar el tiempo de selección en un experimento RH-seq.
  4. Cosecha de pellets celulares de cada cultivo de selección. Calcular el volumen necesario para obtener 7 OD600 unidades de células y centrífuga a 1.000 x g durante 3 min al menos cuatro pellets de este volumen de cada cultivo de selección como réplicas técnicas para la preparación y secuenciación de la biblioteca (ver secciones 4 y 5 , a continuación). Deseche el sobrenadante y guárdelo a -80 oC.
    NOTA: Ejemplo si un matraz de selección tiene una OD finalde 600 de 2.0:
    Equation 3

4. Construcción de la biblioteca Tn-seq y secuenciación de Illumina para determinar la abundancia de hemizygotes mutantes de transposon

  1. Descongelar en hielo cada pellet celular de la sección 3 que va a ser secuenciado.
  2. Aísle el ADN genómico total (ADNr) de cada pellet celular utilizando un kit de purificación de ADNados de levadura siguiendo las instrucciones del fabricante. Resuspender el ADN en 50 s de tampón de elución calentado a 65 oC.
  3. Cuantifique la cantidad de ADN gde cada pellet utilizando un fluorímetro. La cantidad total mínima de gDNA necesaria para cada pellet celular para crear una biblioteca de secuenciación de próxima generación (NGS) para Tn-seq utilizando el siguiente procedimiento es de 1 g.
    NOTA: Se puede utilizar menos de 1 g de GDNA para crear una biblioteca, pero la cantidad y calidad finales de la biblioteca se verá afectada.
  4. Siga un protocolo establecido para crear bibliotecas Tn-seq7. Tenga en cuenta la siguiente información relevante que es única para este protocolo:
    1. Después de la cizalladura gDNA, la reparación final y la ligadura del adaptador, amplificar el GDNA que contiene el transposón a través de PCR. Para ese PCR, utilice la siguiente imprimación directa e inversa, que son específicas para los adaptadores de transposón PiggyBac y NGS, respectivamente:
      Adelante (N – nucleótido aleatorio)
      5' ATGATACGGCGACCACCACCATCTACCTTTCCCTACACGAC
      CTCTTCCGATCTNNNNNNNAGCAATATTTCAAGAATGCATGCGTCAAT 3'
      Invertir (el tramo de Ns representa un índice único de 6 bp utilizado para la multiplexación. Ver más abajo para más información sobre los índices)
      5' CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTAGTA1
      ACGTGTGCTCTTCCGATCT 3'
    2. Utilice los pasos de limpieza incluidos con cordones de tamaño selectivo para minimizar la proporción de fragmentos clonados en la biblioteca final que sería demasiado corto para incluir una secuencia genómica como mínimo.
      NOTA: Después de haber seguido los requisitos mínimos de réplica hasta ahora para los cultivos de selección, habrá 24 muestras de GDNA individuales para la secuenciación. Dado el costo actual de la secuenciación, es poco probable que cada muestra se ejecute por sí sola. Para combinar muestras en el mismo carril, cree varias imprimaciones inversas, cada una con un índice de par único de 6 bases. Las muestras con índices diferentes se pueden combinar en el mismo carril de secuenciación y separarse computacionalmente después.
  5. Secuenciar lecturas de un solo extremo de 150 bp de cada biblioteca utilizando tecnologías NGS a través de ocho carriles.
    NOTA: La cantidad de lecturas de secuenciación requeridas depende en gran medida de la calidad de las bibliotecas preparadas en el paso anterior (es decir, la proporción de ADN en la biblioteca que realmente contiene ADN de transposon, que representa el ADN procedente de hemizygotes recíprocos). Hay dos factores principales que contribuyen a esto. En primer lugar, dado que las celdas sin un transposón integrado no se contraseleccionan durante la creación de la agrupación, cada cultivo será una mezcla de celdas con y sin el transposón. En segundo lugar, incluso dentro de los genomas de los hemizygotes recíprocos que contienen transposón, la mayor parte del genoma no es una secuencia que contiene transposon, y este ADNado será inevitablemente parte de la preparación de la biblioteca. El objetivo de la amplificación final de PCR del ADN que contiene transposón es aumentar la proporción de ADN que contiene transposón a estas dos fuentes de ADN de fondo. Cuanto más eficiente sea esta amplificación, mayor será la proporción de lecturas que se podrá utilizar en el análisis posterior. Cuanto menor sea la calidad de las bibliotecas, más secuenciación tendrá que hacerse, ya que una proporción cada vez mayor de lecturas no contendrá ADN de transposon y no será útil. Dadas las limitaciones anteriores, ocho carriles de secuenciación eran capaces de rastrear las abundancias recíprocas de hemizygote en un grado razonable. Una secuenciamás más permitidas permitiría un análisis más profundo.

5. Mapeo de las ubicaciones de las inserciones de transposon y análisis RH-seq

NOTA: El siguiente análisis de datos se realizó con scripts de Python personalizados (que se encuentran en línea en https://github.com/weiss19/rh-seq), pero se pudo rehacer utilizando otros lenguajes de scripting. A continuación, se describen los pasos principales del proceso. Realice los pasos siguientes en cada archivo de lectura de réplica individual a menos que se anota para combinarlos.

  1. Recortar secuencias de adaptadores fuera de lecturas y separar las lecturas de cada réplica según el índice.
  2. Encuentre lecturas que contengan cruces transposón-genoma. Para lograr esto, busque dentro de cada lectura los últimos 20 pares base del transposón, CAGACTATCTTTCTAGGGTTAA. Deseche todas las lecturas que no contengan esta secuencia.
    NOTA: En nuestra experiencia, la proporción de mapas de lecturas hasta el final del transposón es del 83-95%.
  3. Recorte las lecturas restantes que contienen transposon para contener solo la secuencia aguas abajo del extremo de 3' del transposón. Al mapear esta secuencia al genoma de la levadura, determine el contexto genómico de la inserción de transposon para cada lectura (paso 5.4 a continuación).
  4. Utilice BLAT o una herramienta de mapeo equivalente para asignar la secuencia aguas abajo del transposon al genoma híbrido s. cerevisiae DBVPG1373 x S. paradoxus Z1 (nombre de script: map_and_pool_BLAT.py).
    1. Deseche las lecturas para las que haya menos de 50 pares base de secuencia utilizable aguas abajo del extremo de 3' del transposón. Las secuencias cortas son difíciles de asignar de forma única.
    2. Si utiliza BLAT, utilice los siguientes parámetros: identidad: 95, tamaño de tesela 12.
    3. Cree un genoma híbrido básico para utilizarlo para la cartografía concatenando las últimas versiones de los genomas de referencia de S. cerevisiae S288c y S. paradoxus CBS432.
      NOTA: Un archivo de anotación básico que describe los límites genómicos de genes individuales a través del genoma híbrido se puede encontrar en el repositorio de Github mencionado anteriormente (Nombre de archivo: YS2+CBS432+plásmid_clean). Utilice únicamente lecturas que se asignen a una sola ubicación en el genoma híbrido (es decir, son exclusivas de S. cerevisiae o S. paradoxus). Se espera una frecuencia uniforme de los eventos de inserción en todo el genoma; la distribución de las posiciones de inserción a través de los genomas se notifica en otros lugares3.
  5. Tally el número total de lecturas de mapeo a cada ubicación de inserción de transposon única, que inferimos todas se originaron a partir de celdas de un solo clon mutante de inserción de transposon. La suma de todos estos valores de una sola biblioteca se conoce como el número total de lecturas asignadas para esa biblioteca.
  6. En los casos en que haya varias asignaciones de inserciones dentro de 3 pares base entre sí, combínelas todas en un único punto de inserción, asignando todas las lecturas a la única ubicación con el recuento de lectura más alto. Este valor, ninsert, representa la abundancia de ese clon de inserción en el pellet celular desde el que se secuencia baserigz. En este punto, habrá listasde n insert, cada una la abundancia de una inserción de transposón mapeado única, una lista para cada pellet de celda secuenciado.
    NOTA: El transposón PiggyBac inserta en secuencias TTAA en el genoma, una secuencia de 4 pares base. Por lo tanto, deducimos que la asignación de inserciones dentro de 3 pares base entre sí debe haberse originado en el mismo sitio TTAA.
  7. Puesto que habrá un número ligeramente diferente de lecturas totales procedentes de cada biblioteca secuenciada, normalice los valores deinserción n en todos los archivos si se van a comparar. Para ello, tabule el número total de lecturas asignadas de cada biblioteca individual, npellet, y tome el promedio de todos los npellet en todas las bibliotecas, pellet>. Multiplique cadainserción n en los datos de una biblioteca individual por la relaciónde pellet> / npellet para calcular una plaquita, la abundancia normalizada de un clon de inserción de transposón determinado.
    Equation 4
    Como alternativa, el tamaño de la biblioteca se puede estimar utilizando herramientas disponibles como DESeq28 (nombre de script: total_reads_and_normalize.py).
  8. Tabular el conjunto de todas las inserciones asignadas en todas las bibliotecas. Para las inserciones que se encuentran en algunas bibliotecas, pero no en otras, establezca unainserción n.o 1 para los cálculos posteriores.
  9. Filtre las lecturas para encontrar las inserciones que se encuentran dentro de genes según el archivo de anotación (nombre de script: remove_NC_and_plasmid_inserts.py).
  10. Para cada inserción única, calcule la abundancia media a través de réplicas técnicas de cada selección (cada cultivo a 28 o39 oC), inserción>técnica (nombre de script: combine_tech_reps_V2.py).
  11. Para cada inserción única, calcule la abundancia media a través de réplicas biológicas de cada temperatura, inserto>total, tomando la media de todo inserto>técnico a cada temperatura. Al mismo tiempo, calcule el coeficiente de variación para cada inserción,la inserción CV, el total en la inserción técnica (nombre de script: combine_bio_reps.py).
    NOTA: En este punto, para cada temperatura, 28oC y 39oC, hay una lista de inserciones de transposón únicas, su abundancia media y el coeficiente de variación entre réplicas biológicas para cada una. Estos datos para nuestro experimento se informan en otros lugares3.
  12. Filtre la lista de todas las inserciones para las que tienen, ya sea a 28 oC o 39 oC, inserción>total > 1.1 ycv insert,total á 1.5 (nombre de script: filter_inserts.py).
  13. Para cada inserción única, calcule el registro2(plaquita>total,28 oC / insert>total,39 oC). Este valor representa la "termotolerancia" de un clon mutante de inserción de transposon determinado (nombre de script: fitness_ratios.py).
  14. Ordenar todas las inserciones únicas por gen y por alelo (S. cerevisiae o S. paradoxus), y tabular el número de inserciones en cada alelo. Filtre los genes de modo que solo se analicen los genes que tienen al menos 5 inserciones en cada alelo (nombre de script: organize_and_filter_genes.py).
    NOTA: Múltiples inserciones únicas en cada alelo permiten una medida más precisa de la termotolerancia de ese hemizygote recíproco. Es posible reducir el número de inserciones necesarias por alelo, pero comprometerá la precisión de esta medida y aumentará la carga de pruebas múltiples al permitir que se prueben más genes. Además, filtrar los genes con muy pocas inserciones por alelo ayudará a reducir el impacto en los resultados de las pruebas de cualquier clon de hemizygote individual que alberga una mutación del sitio secundario que confiere un fenotipo muy dispar.
  15. Para cada gen restante en el conjunto de datos después del filtrado anterior, compare las termotolerancias (relaciones de registro 2) de todas las inserciones en el alelo de S. cerevisiae con las del alelo de S. paradoxus utilizando una prueba Mann-Whitney U. Alternativamente, se podría implementar un modelo de regresión, adaptado de DESeq28 (nombre del script: mann_whitney_u.py).
  16. Corregir los valores ppara múltiples pruebas utilizando el método Benjamini-Hochberg.
  17. Los genes con valores psignificativos (digamos, 0,01) son candidatos a genes importantes para las diferencias en la termotolerancia entre las dos especies.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nos acoplamos S. cerevisiae y S. paradoxus para formar un híbrido estéril, que sometimos a mutagénesis transposon. Cada clon mutagenizado era un hemizygote, un híbrido diploide en el que se interrumpe un alelo de un gen (Figura1A, Figura2). Competimos los hemizygotes uno contra el otro por el crecimiento a 39 oC y, en un experimento separado como control, a 28 oC (Figura1B),y aislamos el ADN de cada cultivo. Para informar de la aptitud de cada hemizygote cuantificamos la abundancia a través de la secuenciación a granel, utilizando un protocolo en el que el ADN estaba fragmentado y ligado a los adaptadores, seguido de la amplificación de las posiciones de inserción de transposon (Figura1C). Si las imprimaciones para esta amplificación son distintas y menos eficientes que las proporcionadas en el protocolo, las lecturas de fondo predominarán en los datos de secuenciación, lo que dará lugar a menos lecturas utilizables y a erosionar la precisión de las estimaciones de aptitud. Problemas de calidad similares pueden resultar de una baja entrada de ADN en la preparación de la biblioteca de secuenciación.

Con los resultados en la mano de nuestra secuenciación, para un gen dado comparamos abundancias de hemizygote a las dos temperaturas entre dos clases de hemizygotes: clones donde sólo el alelo de S. cerevisiae era de tipo salvaje y funcional, y clones que dependían sólo de los S. paradoxus allele (Figura 1D). En el análisis en esta etapa, si no se sigue la estrategia computacional de postprocesamiento del protocolo y se incluyen genes con relativamente pocos mutantes de transposon en la piscina, el poder estadístico disminuirá y no se producirán llamadas genéticas significativas. En nuestra implementación, detectamos una señalfuerte en ocho genes de limpieza (Figura 3). En cada caso, las inserciones de transposon en el alelo S. cerevisiae en el híbrido comprometió el crecimiento a alta temperatura (Figura3). Estos loci representaban determinantes candidatos del rasgo de termotolerancia que distingue a S. cerevisiae de S. paradoxus. En experimentos separados reportados en otros lugares, validamos el impacto de la variación alélica en cada sitio utilizando métodos de transgénesis estándar más allá del alcance del protocolo actual3.

Figure 1
Figura 1. Esquema del flujo de trabajo RH-seq.
A. S. cerevisiae y S. paradoxus (azul y amarillo respectivamente), se aparean para formar un híbrido (verde) que contiene una sola copia de cada uno de los genomas de los padres. En un locus dado en el híbrido, una inserción de transposon (caja negra) en el alelo de cada especie a su vez crea un hemizygote, que es diploide en el resto del genoma excepto para el locus de interés. La comparación de fenotipos entre hemizygotes revela los efectos fenotípicos de la variación alélica en el locus manipulado. B. A través de muchos clones hemizygous en un gen dado (YFG), algunos alcanzan mayor abundancia que otros en la cultura competitiva, como se cuantifica por la secuenciación. C. El ADN de una piscina de hemizygote se cizalla y se liga a los adaptadores (rojo). Para un clon determinado, la unión entre el transposón (tn, negro) y el genoma (azul) se amplifica con una imprimación específica del transposón (cabeza de flecha negra) y una imprimación específica del adaptador (cabeza de flecha roja). Secuenciación de lectura cuenta en el informe amplicon la aptitud del clon en la población. D. Para un golpe en el gen RH-seq, tabular laproporción de clones de hemizygote (eje y) que exhiben una aptitud dada después de la competencia a alta temperatura (ejex)revela una diferencia notable entre dos clases genotípicas: las que tienen una inserción de transposon en el alelo de S. cerevisiae (con el s. paradoxus allele restante; amarillo) y aquellos con el s. paradoxus allele interrumpido (y S. cerevisiae alelo restante; azul).
Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2. Esquema de selección para generar un grupo de hemizygotes recíprocos en todo el genoma con el transposon de plásmido PiggyBac.
El plásmido PiggyBac (pJR487) se transforma en un clon URA3-/- del híbrido diploide S. cerevisiae DBVPG1373 x S. paradoxus Z1 (JR507). La presencia del plásmido o transposón se selecciona para el crecimiento a través del crecimiento en G418, que selecciona para la presencia del casete KanMX; son células que han tomado el plásmido PiggyBac y/o albergan una transposon integrada. Las células sin este último se seleccionan contra a través del crecimiento en 5-FOA, que es tóxico en presencia del casete URA3. Dado que el híbrido no transformado es URA3-/-, las únicas células que morirán en este paso son aquellas que todavía contienen el plásmido PiggyBac, que contiene un casete URA3. Lo que queda es un grupo de células mutantes híbridas que contienen el transposón integrado en el genoma. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3. Los mejores golpes asignados por RH-seq.
Cada grupo especial informa de los datos de RH-seq para el gen indicado de RH-seq. El eje xinforma del registro2 de abundancia de un clon mutante transposón después de la selección a 39 oC, en relación con la cantidad análoga a 28 oC. El eje yinforma de la proporción de todos los clones que llevan inserciones en el alelo indicado que exhibió la relación de abundancia en el x,como una estimación de densidad del núcleo. Los datos de lectura y recuento subyacentes para las inserciones se notifican en otros lugares3. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Las ventajas de RH-seq con los métodos estadístico-genéticos anteriores son varias veces. A diferencia del análisis de vinculación y asociación, RH-seq ofrece una resolución de mapeo monogenético; como tal, probablemente será de utilidad significativa incluso en estudios de variación de rasgos entre individuos de una especie dada, así como diferencias interespecíficas. Además, los intentos anteriores de análisis de hemizigosidad recíproca en todo el genomautilizaron colecciones de mutantes de eliminación de genes, algunos de los cuales albergan mutaciones secundarias que pueden conducir a resultados falsos positivos 9,10. La estrategia RH-seq descarta este problema al generar y fenotiar a muchos mutantes hemizygote en cada gen a su vez, de modo que el trasfondo de cualquier clon mutante individual contribuye sólo marginalmente al resultado final. En principio, RH-seq también ofrece el estudio de loci no codificantes, aunque en el trabajo actual nos centramos exclusivamente en los genes.

Hay algunas peculiaridades a RH-seq, algunas biológicas y algunas técnicas, que un practicante exitoso se ocupará por adelantado para maximizar la utilidad del enfoque y acelerar el camino hacia los mejores resultados. Biológicamente, RH-seq sólo tiene sentido como técnica si las dos especies objetivo pueden aparearse para formar un híbrido estable y viable que pueda ser manipulado genéticamente. Por lo tanto, no podemos imaginar la aplicación de RH-seq a especies tan divergentes que no se fusionan en un diploide karyotípicamente estable. Por otro lado, si los dos padres del híbrido diploide son demasiado similares a nivel de ADN, la mayoría de las lecturas de la secuencia de inserción de transposon no se pueden mapear el alelo, específicamente a uno de los dos genomas principales y serán inutilizables; por lo tanto, un experimento RH-seq dado será más exitoso cuando los padres tienen genomas de referencia de alta calidad disponibles y golpear un "punto dulce" de divergencia de secuencia. Como punto de consideración separado, dado un proyecto RH-seq formulado para diseccionar la base genética de una diferencia de rasgo entre las especies madre, es probable que los resultados sean mucho más interpretables cuando, para el rasgo de interés, la biología del híbrido sirve como un representante razonable de la de los padres. Los fenotipos extremos únicos del híbrido (heterosis) podrían influir u oscurecer los efectos de los genes de interés subyacentes al fenotipo, ya que difiere entre los padres. Cualquier genes mapeado a través del análisis recíproco de hemizygosity debe ser validado por experimentos independientes de intercambio de alelos en los antecedentes genéticos de la especie madre de raza pura.

En cuanto a problemas técnicos en un experimento de RH-seq, nuestra experiencia ha destacado varias fuentes potenciales de ruido y ha proporcionado soluciones viables. El ruido se manifiesta como desacuerdo entre las estimaciones basadas en secuenciación de la aptitud de los hemizygotes que albergan inserciones de transposon en un alelo dado de un gen dado. Esto puede derivar de diferentes mutaciones secundarias en los fondos de los mutantes de transposón (ver más abajo); variabilidad en la eficiencia de la PCR que amplifica los diferentes sitios de inserción; baja representación de un mutante dado en la piscina a granel, lo que conduce a una baja cobertura de secuenciación que debilita la precisión; y las diferencias en la posición de la inserción de la transposon dentro del gen (por ejemplo, transposones que se insertan en un extremo geneagénico de 3' pueden tener un efecto fenotípico mínimo). Por todas estas razones, consideramos fundamental generar grandes grupos mutantes de transposón y, en el análisis final, excluir de la prueba de cualquier gen sin un número razonable de mutantes en cada uno de los dos alelos. Observamos que, aunque no lo hemos implementado aquí, un sistema de transposon con código de barras7 podría ayudar aún más a resolver problemas de sesgo de PCR y reducir el costo y la mano de obra de un experimento de RH-seq.

En conclusión, hemos establecido un flujo de trabajo sencillo para RH-seq y hemos especificado advertencias del enfoque. Encontramos que este último no compromete significativamente la utilidad de RH-seq; consideramos que es una gran promesa para la disección a escala del genoma de alta resolución de las consecuencias fenotípicas de la variación genética, incluidas las diferencias entre especies que han estado aisladas reproductivamente durante millones de años.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a J. Roop, R. Hackley, I. Grigoriev, A. Arkin y J. Skerker por sus contribuciones al estudio original, F. AlZaben, A. Flury, G. Geiselman, J. Hong, J. Kim, M. Maurer, y L. Oltrogge por la asistencia técnica, D. Savage por su generosidad con la microscopía recursos, y B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson y A. Sasikumar para su discusión; también agradecemos a J. Dueber (Departamento de Bioingeniería, UC Berkeley) por el plásmido PiggyBac. Este trabajo fue apoyado por R01 GM120430-A1 y por Community Sequencing Project 1460 a RBB en el U.S. Department of Energy Joint Genome Institute, un DoE Office of Science User Facility. El trabajo realizado por este último fue apoyado por la Oficina de Ciencia del Departamento de Energía de los Estados Unidos en virtud del Contrato No. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics