Kıvılcım Susturma: CRISPR/Cas9 Zayıf Elektrikli Balıklarda Genom Düzenleme

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada CRISPR/Cas9 genom nakavt elektrikli balık üretimi ve arkası için bir protokol sunulmuştur. Ayrıntılı olarak özetlenen bir gymnotiform ve mormyrid hem de gerekli moleküler biyoloji, Üreme ve hayvancılık gereksinimleri ve cas9 indel F0 larvaları üretmek için enjeksiyon teknikleri vardır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Constantinou, S. J., Nguyen, L., Kirschbaum, F., Salazar, V. L., Gallant, J. R. Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish. J. Vis. Exp. (152), e60253, doi:10.3791/60253 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Omurgalıların evrimsel tarihinde elektroresepsiyon ve elektrogenez değişmiştir. Ortak bir genetik mimariyi paylaşan bu bağımsız olarak elde edilen fenotiplerde çarpıcı bir yakınsama derecesi vardır. Bu belki de en iyi gymnotiforms ve mormyrids, üretmek ve zayıf elektrik alanları tespit ve zayıf elektrikli balık denir iki tür zengin teleost clades sayısız yakınsak özellikleri ile örneklenir. Zayıf elektrikli balıkların çevrelerini algılamak ve iletişim kurmak için elektriği kullandıklarının keşfinden bu yana geçen 50 yıl içinde, büyüyen bir bilim adamı topluluğu, gelişim, sistem ve devrelerin nörolojisinin evrimi hakkında muazzam bir içgörü kazandı. hücresel fizyoloji, ekoloji, evrimsel biyoloji ve davranış. Daha yakın zamanlarda, elektrikli balıklar için genomik kaynakların çoğalması olmuştur. Bu kaynakların kullanımı zaten bu türlerde genotip ve fenotip arasındaki bağlantı ile ilgili önemli anlayışlar kolaylaştırmıştır. Genomik verilerin zayıf elektrikli balıkların henotik verileriyle bütünleştirilmesinin önündeki en büyük engel, mevcut fonksiyonel genomik araçlarının eksikliğidir. Burada zayıf elektrikli balıklarda endojen DNA onarım mekanizmaları kullanan CRISPR/Cas9 mutagenezinin icrası için tam bir protokol sunacağız. Bu protokolün hem mormyrid türü Brienomyrus brachyistius hem de gymnotiform Brakihypopomus gauderio'da CRISPR/Cas9 kullanarak indels ve nokta mutasyonlarını hedef alarak eşit derecede etkili olduğunu gösteriyoruz. sodyum kanal gen scn4aa. Bu protokol kullanılarak, her iki türden de embriyolar elde edildi ve scn4aa sodyum kanalının ilk eksonlarında öngörülen mutasyonların mevcut olduğunu doğrulamak için genotiplendi. Nakavt başarı fenotip enjekte edilmemiş boyut eşleşen kontroller ile karşılaştırıldığında azaltılmış elektrik organı deşarj genlikleri gösteren kayıtları ile doğrulandı.

Introduction

Omurgalıların evrimsel tarihinde elektroresepsiyon ve elektrogenez değişmiştir. Teleost balık iki soy, osteoglossiformes ve siluriformes, paralel olarak elektroresepsiyon gelişti, ve teleostların beş lineages (gymnotiformes, mormyrids, ve cins Astroscopus, Malapterurus, ve Synodontis) paralel olarak gelişen elektrogenez. Ortak bir genetik mimari1,2,3paylaşan bu bağımsız olarak türetilmiş fenotipler, yakınsama çarpıcı bir derecesi vardır.

Bu belki de en iyi gymnotiforms ve mormyrids, üretmek ve zayıf elektrik alanları tespit ve zayıf elektrikli balık denir iki tür zengin teleost clades, sayısız yakınsak özellikleri ile örneklenir. 50 yıl içinde zayıf elektrik balık çevrelerini algılamak ve iletişim kurmak için elektrik kullanımı keşfinden bu yana4, bilim adamlarının büyüyen bir toplulukgelişme1,5 evrimi içine muazzam anlayışlar kazanmıştır ,6, sistemleri ve devrelerinörolojik 7,8,9,10, hücresel fizyoloji11,12, ekoloji ve enerji13 ,14,15,16,17, davranış18,19, ve makroevrim3,20,21 .

Daha yakın zamanda, elektrik balıkları için genomik, transkripsiyonik ve proteomik kaynakların çoğalması olmuştur1,22,23,24,25,26, 27,28. Bu kaynakların kullanımı zaten bu türlerde genotip ve fenotip arasındaki bağlantı ile ilgili önemli anlayışlar üretti1,2,3,28,29 ,30. Zayıf elektrikli balıkların henotik verileri ile genomik verilerin entegre edilmesinin önündeki en büyük engel, fonksiyonel genomik aletlerin mevcut eksikliğidir31.

Bu araçlardan biri, Cas9 endondüraz (CRISPR/Cas9, CRISPR) tekniği ile eşleştirilmiş son zamanlarda geliştirilen Kümelenmiş Düzenli Aralıklı Kısa Palindromik Tekrarlar'dır. CRISPR/Cas9 hem model32,33,34 hem de model olmayanorganizmalarda 35,36,37 hem de yaygın kullanıma girmiş bir genom düzenleme aracıdır. CRISPR/Cas9 teknolojisi, temel moleküler biyoloji yeteneğine sahip bir laboratuvarın klonlamayan bir yöntemi kullanarak düşük maliyetle kısa kılavuz RNA (sgRNA) adı verilen genlere özgü probları kolayca üretebileceği bir noktaya gelmiştir38. CRISPR morpholinos39,40, transkripsiyon aktivatör benzeri efektör nükleazlar (TALENs) ve çinko parmak çekirdekleri (ZFNs) gibi diğer nakavt / nakavt stratejileri, üzerinde avantajları vardır ve pahalı ve her hedef gen için üretmek için zaman alıcı.

CRISPR/Cas9 sistemi, genomun belirli bir bölgesini hedef alarak, sgRNA dizisi tarafından yönlendirilerek ve çift iplikli bir kopmaya neden olarak gen nakavtları oluşturmak için işlev görür. Çift iplikli kopma hücre tarafından tespit edilir ve homolog olmayan son birleştirme (NHEJ) yolu kullanılarak tercihen endojen DNA onarım mekanizmalarını tetikler. Bu yol son derece hata yatkındır: onarım işlemi sırasında, DNA molekülü genellikle çift iplikli mola yerinde eklemeler veya silmeler (indels) dahil edecektir. Bu indels ya (1) açık okuma çerçevesi vardiya, (2) erken stop codon ekleme veya (3) gen ürünün kritik birincil yapısında vardiya nedeniyle fonksiyon kaybına neden olabilir. Bu protokolde, zayıf elektrikli balık türlerinde NHEJ'yi kullanarak hedef genlerdeki nokta mutasyonlarını hedeflemek için CRISPR/Cas9 düzenlemesini kullanıyoruz. Diğer tekniklere göre daha basit ve daha verimli olsa da, bu mutagenez yönteminin genetik mozaisizme atfedilen F0'dabir dizi fenotipik şiddeti ile sonuçlanması beklenmektedir, bu da genetik mozailiğe atfedilir41,42,43 ,44.

Organizmaların Seçimi
Zayıf elektrikli balıkların karşılaştırmalı genomikleri üzerinde gelecekteki çalışmaları kolaylaştırmak amacıyla, protokol gelişimi için hem gymnotiforms hem de mormyrids için temsili bir tür seçilmelidir. Uruguay'ın Montevideo kentinde düzenlenen 2016 Elektrikli Balık toplantısı nın ardından, laboratuvarda yetiştirilebilecek ve genomik kaynaklara sahip türleri kullanmak için topluluk konusunda fikir birliği sağlandı. Gymnotiform Brakihipopomus gauderio ve mormyrid Brienomyrus brachyistius bu kriterlere uygun türler olarak seçildi. Her iki türde de üreme koşullarını tetiklemek ve sürdürmek için doğal ipuçları esaret altında taklit etmek kolaydır. B. gauderio, Güney Amerika'dan bir gymnotiform türler, düşük hayvancılık gereksinimleri avantajı vardır: balık nispeten küçük (4 L) tanklarda nispeten yüksek yoğunlukta tutulabilir. B. gauderio da esir koşullar altında hızlı nesil cirosuvardır. Laboratuvar koşullarında, B. gauderio yaklaşık 4 ay içinde yumurtadan yetişkine gelişebilir.

B. Brachyistius, Batı-Orta Afrika mormyrid balık bir tür, kolayca esaret içinde ürerler. B. brachyistius akvaryum ticareti yoluyla kolayca kullanılabilir, yaygın birçok çalışmada kullanılmıştır, ve şimdi genomik kaynakların bir dizi mevcuttur. Yaşam döngüleri laboratuvar koşullarına bağlı olarak 1−3 yıl sürer. Hayvancılık gereksinimleri bu tür için biraz daha yoğundur ve üreme sırasındaki saldırganlıkları nedeniyle orta büyüklükte tanklara (50−100 L) ihtiyaç vardır.

Diğer elektrikli balık türlerini inceleyen laboratuvarlar, türler yetiştirilebildiği ve tek hücreli embriyoların toplanıp yetişkinliğe kadar yetiştirilebildiği sürece bu protokolü kolayca uyarlayabilmeli. Konut, larva yetiştiriciliği ve in vitro fertilizasyon (IVF) oranları diğer türler ile birlikte büyük olasılıkla değişecektir; ancak, bu protokol diğer zayıf elektrikli balıkların üreme girişimleri için bir başlangıç noktası olarak kullanılabilir.

Kavram Kanıtı için İdeal Bir Gen Hedefi: scn4aa
Zayıf elektrikli mormyrid ve gymnotiform balık elektrik organı olarak adlandırılan özel bir organ, boşaltarak elektrik alanları (elektrogenez) oluşturmak. Elektrik organ deşarjları (EODs) elektrosit adı verilen elektrik organ hücrelerinde eylem potansiyellerinin eşzamanlı üretimi sonucu. EOD'ler, balığın çevresinin yüksek çözünürlüklü elektriksel görüntülerini oluşturmak için derideki bir dizi elektroreseptör tarafından tespit edilir45. Zayıf elektrikli balıklar da kendi conspecifics 'EOD dalga formları özellikleri tespit yeteneğine sahiptir18 yanı sıra deşarj oranları46, EODs kuş şarkısı veya kurbağa benzer bir sosyal iletişim sinyali olarak ek olarak çalışmasına izin vokalizasyon47.

Hem mormyrid ve gymnotiform zayıf elektrikli balık elektrositlerde eylem potansiyel nesil bir ana bileşeni voltaj kapılı sodyum kanalı NaV1.42. Elektrik olmayan teleosts iki paralogus gen kopyaları ifade, scn4aa ve scn4ab, voltaj kapılı sodyum kanalı NaV1.430için kodlama . Hem gymnotiform ve mormyrid zayıf elektrikli balık soyları, scn4aa hızla gelişti ve kinetik özelliklerini etkileyen çok sayıda amino asit ikameleri uğramıştır48. En önemlisi, scn4aa elektrik organı2,3her iki soy da bölümlere ayrılmıştır . Elektrik organına scn4aa nispeten sınırlı ifade, yanı sıra EODs üretiminde ki kilit rolü, CRISPR / Cas9 nakavt deneyleri için ideal bir hedef yapar, minimal zararlı pleiotropic etkileri olduğu gibi. Zayıf elektrikli balıklar larva elektrik organlarını 6−8 gün sonra döllenme (DPF) boşaltmaya başladıklarından, scn4aa'nın hedeflenmesi embriyo mikroenjeksiyonunu takiben hızlı fenotipleme için idealdir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Burada açıklanan tüm yöntemler Michigan State Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Komitesi (IACUC) tarafından onaylanmıştır.

1. SGRNA Hedeflerinin Seçilmesi

NOT: Adım 1.1'de sgRNA'ların manuel tasarımı için bir protokol sağlanmıştır. Bu scn4aa hedef seçimi için kullanılmıştır. EFISHGENOMICS web portalı kullanılarak bu işlemi kolaylaştırmak için ek bir protokol (adım 1.2) sağlanmaktadır. Kullanıcıların özel hedefler için sgRNA'lar tasarımında başarı sağlamak için birkaç otomatik 'denetim' içeren protokol 1.2'yi seçmeleri önerilir.

  1. Tasarım sgRNA hedefleri.
    1. sgRNA kılavuz oligoları oluşturmak için en iyisi ekson 1 veya diğer 5' eksonları hedeflemektir. 5' UTR hedeflenebilir; ancak, 5' kodlama dizisini hedeflemek en iyisidir. Genomik bilgi kullanımı tercih edilir, ancak transkripsiyon verileri kullanılarak başarılı sgRNA'lar geliştirmek mümkündür. Intron/ekon sınırları (genomik veri) veya ekson/ekon sınırlarının ek açıklamaları tercih edilir.
    2. 1.1'den aday genomik diziler 5'-N(18)-NGG-3' desenine uyan putatif hedef dizileri aranır. Bu otomatik olarak masaüstü sıra analiz yazılımı, özel komut dosyaları veya dizilerin manuel denetim yoluyla yapılabilir.
    3. Diziler, hedefteki etkinlik için Doench ve ark.49 yöntemi kullanılarak önceliklendirilebilir. Ayrıca, hedef dizileri off-target bağlayıcı için genomik / transkripsiyonel veritabanları karşı blast arama tarafından değerlendirilebilir.
    4. Hedef sırasını çevreleyen standart PCR astarlarının oluşturulabilmesini sağlayın. Astarlar kesme alanının her iki yanından en az 20 bp olmalıdır (NGG dizisinin yukarısında ki üç baz). İdeal olarak, PCR ürün 150−200 baz çiftleri (bp) olmalıdır.
    5. Aşağıdaki şablonu kullanarak yukarıdaki kriterleri karşılayan tasarım oligomerleri, sabit oligomer (1.1.6): 5'-TAATACGACTTATAGG-N18'e annelik için bir T7 promotörü (N18'in5' 'i) ve tamamlayıcı bir bölge (N18'in3'ü) içerir. -GTTTTAGAGCTAGAAATAGCAAG-3'
      NOT: N18 dizisi NGG protospacer bitişik motif (PAM) dizisini içermez. Bunu oligomere eklemeyin.
    6. Tüm sgRNA'ları, sgRNA hedeflerini (adım 1.1.5) ve PCR astarlarını (adım 1.1.4) oligonükleotid üretim hizmetinden standart tuzsuz oligomerler olarak sentezlemek için kullanılacak sabit oligomeri(Tablo 1)sipariş edin. Oligomerler ve PCR astarlar standart tuzsuz oligomerler olarak sipariş edilebilir, ek arıtma gereklidir.
  2. sgRNA hedeflerinin otomatik tasarımını gerçekleştirin.
    1. Genomik verileri kullanarak, bir hedef gen seçin. Bunun yerine ekson/intron sınırları bilindiğinde transkripsiyon verileri kullanılabilir. Hedefler EFISHGENOMICS portalı (http://efishgenomics.integrativebiology.msu.edu) kullanılarak belirlenebilir. İdeal hedef exon 1 içinde olacak; ancak, diğer 5 'exons ve 5 ' UTR düşünülebilir.
    2. Hedef sıra belirlendikten sonra, serbestçe kullanılabilir EFISHGENOMICS CRISPR web aracını (http://efishgenomics.integrativebiology.msu.edu/crispr_tool/) yükleyin. Bu web aracı hedef nesil50,51için CRISPOR algoritması özelleştirilmiş bir sürümünü kullanır.
    3. Adım 1için kutuya, sıranın adını girin ve hedefin sırasını uygun kutuya girin.
  3. Dizinin türetdiği uygun genomu seçin. Şu anda, genomik veriler B. brachyistius ve B. gauderioiçin kullanılabilir. Genom dizileri bu aracın kullanımı için gerekli değildir, ancak olası istenmeyen hedef dışı etkileri değerlendirmede yararlıdır.
  4. Uygun PAM'i seçin. 20 bp-NGG PAM önerilir, ancak cas9 proteinine bağlı olarak aralarından seçim yapabileceğiniz birkaç ek PAM motifi vardır.
  5. Önerilen kılavuz dizileri ile genomdaki hedef dizinin konumu ile birlikte bir rapor oluşturulacaktır. Düşük tahmin edilen hedef dışı efektlere, yüksek özgüllük puanlarına ve yüksek verimlilik puanlarına sahip üç hedef seçin. En yüksek puanlama kılavuzu dizileri sol tarafta yeşil ile vurgulanır. Mümkünse sarı ve kırmızı vurgulu kılavuz dizilerinden kaçınılmalıdır.
  6. Seçili hedef dizilere tıkladığınızda kapsamlı bir CRISPOR raporu oluşturur. Bu raporlardan elde edilen temel bilgiler "Üst üste binen oligonükleotidlerden T7 in vitro ekspresyonu" içindir. Bu rapordan, aşağıdaki bilgileri ayıklayın: önerilen sgRNA oligos, hedef site için PCR astarlar ve tüm sgRNA'ları sentezlemek için kullanılacak sabit bir oligomer.
  7. Seçilen oligomerleri (adım 1.6) oligonükleotid üretim hizmetinden sipariş edin. Oligomerler ve PCR astarlar standart tuzsuz oligomerler olarak sipariş edilebilir, ek arıtma gereklidir.

2. sgRNA oluşturma

  1. PCR tüpünde anneal oligomerler: 1 μL 100 μM sabit oligomer, 1 μL 100 μM sgRNA özgü oligomer ve 8 μL nükleaziçermeyen H2O ekleyin
  2. Anneal oligomerler bir termocycler ile aşağıdaki program: 5 dakika için 95 °C'de ısı, -2 °C/s'de 85 °C'ye kadar serin, 0,1 °C/s'de 25 °C'ye kadar serin ve 4 °C'de tutun.
  3. SGRNA şablonu oluşturmak için, 2.5 μL dNTP karışımı (10 mM), 2 μL 10x tampon, 0.5 l T4 DNA polimeraz ve 5 μL çekirdeksiz H2O adım 2.2'den annealed oligomerlara ekleyin. 12 °C'de 20 dk kuluçka.
  4. PCR'yi kullanarak şablonu üreticinin talimatlarına göre temizleyin şablonu arındırın.
  5. 20-30 μL'de elute. Konsantrasyon ve saflığı tahmin etmek için bir spektrofotometre kullanın. Şablon 100-200 ng/μL ve 1.8-1.9 A260/280olmalıdır.
  6. 1-5 μL çalıştırarak bir agarose jel ile doğrulayın. Baskın bant 120 bp olmalıdır. Temsilsonuçları için Şekil 1A'ya bakın.
  7. Jel onaylı sgRNA şablonu -20 °C (uzun vadeli) veya 4 °C (kısa süreli, 1-4 hafta) olarak saklayın.
  8. Oda sıcaklığında 8 μL dNTP karışımı (eşit hacimlerde dA, dT, dG, dC), 2 μL 10x tampon (oda sıcaklığı), 2 μL T7 RNA polimeraz, 100−200 ng sgRNA şablonu ile 1,5 mL mikrosantrifüj tüpüne ekleyerek T7 RNA transkripsiyon kitini kullanarak transkripsiyonu ve nükleaz içermeyen H2O ile 20°L toplam hacim. Alt tabakadan toplamak için döndürün. 37 °C'de 2-4 saat kuluçka.
  9. 1 μL DNase ekleyin ve 37 °C'de 15 dakika daha kuluçkaya yatırın.
    1. SgRNA'yı 1 μL glikojen, 30 μL nükleaz içermeyen H2O, 30 μL 5 M amonyum asetat ve 180 μL 100 EtOH ekleyerek temizleyin. İyice karıştırın ve en az 20 dk -80 °C'de (donana kadar) veya -20 °C'de bir gecede kuluçkaya yatırın. Maksimum hızda 15 dakika 4 °C'de santrifüj.
  10. Peleti rahatsız etmeden süpernatant'ı çıkarın ve atın ve -20 °C'de soğutulmuş 1 mL RNase içermeyen %70 EtOH ile yıkayın. 4 °C'de maksimum hızda 5 dakika daha döndürün.
  11. Peleti bozmadan süpernatant'ı çıkarın ve atın ve 5 dakika boyunca peleti havayla kurutun.
  12. 30 μL'lik nükleaz içermeyen H2O'da yeniden askıya alın ve UV spektroskopisi (minimum verim 200 ng/μL) kullanılarak saflık ve verimi belirleyin.
  13. RNase içermeyen jel üzerinde sgRNA varlığını doğrulayın. SgRNA ikincil yapıya bağlı olarak 50 ile 150 bp arasında iki bant olarak görünür (Şekil 1B).
  14. Aliquot içine 3 μL ve saklamak -80 °C.

3. İn Vitro Kesme Verimliliğini Doğrulayın

  1. Ticari bir DNA çıkarma kiti kullanarak hedef türlerden genomik DNA ayıklayın. Ventral yüzgeç kupürleri balık kurban etmek zorunda kalmadan kullanılabilir, dokular rejenere çünkü.
  2. Standart PCR kullanarak 1.6 ve 1.7 adımlarında açıklandığı gibi tasarlanan astarları kullanarak hedef DNA bölgesini güçlendirin. Jel elektroforez ile ürünü doğrulayın. Uygun bölgenin yükseltilmesini sağlamak için parçanın sıralanması önerilmektedir, ancak gerekli değildir. scn4aa şablonu için temsil sonuçları Şekil 2'degösterilmiştir.
  3. PCR parçasını kurulmuş bir laboratuvar veya şirket protokolü yle temizleyin.
  4. Güçlendirilmiş DNA'yı -20 °C'de saklayın. Donma-çözülme döngülerini azaltmak için onu aliquots'a ayırmayı düşünün.
  5. Her bileşenin gerekli miktarlarını ve hacimlerini belirleyin. Varsa negatif kontroller (sgRNA veya Cas9 hariç) ve pozitif kontrol (daha önce test edilmiş bir sgRNA ve varsa pcr amplifiye DNA'sını açıklayan) ve sgRNA konsantrasyon serisini kullanmayı düşünün.
  6. Oda sıcaklığında bir PCR tüpünde belirtilen sırada reaksiyon karışımını ayarlayın, en iyi sonuçlar için sgRNA ve Cas9 proteinini ekleyerek: 50-100 ng hedef DNA PCR ürünü, 1 0x tampon 3, 1 0x BSA 10x BSA (0.1 g/mL) 10x BSA 1μL , 50-200 ng Cas9 proteini (1 mg/mL, 150 ng önerilen) ve 30-200 ng sgRNA (100 ng önerilir).
    1. Cas9 proteinini inaktive etmek için reaksiyonu 37 °C'de 1 saat, 65 °C'de 10 dakika kuluçkaya yatırın.
    2. Pozitif ve negatif kontrollerle birlikte numunenin tamamını %2-3 oranında agarose jel (beklenen bant boyutları 30-200 bp arasında) çalıştırın. Başarılı dekolte bazı PCR ürün gösterebilir ama aynı zamanda iki küçük bantları olacaktır. Temsil sonuçları Şekil 2'degösterilmiştir.

4. Embriyo Edinme

NOT: Zayıf elektrikli balık embriyoları elde etmek zor olabilir. Su kalitesinin dikkatli bir şekilde izlenmesi, balık bakımı için yeterli zaman ve düzenli beslenme başarılı bir üreme programının anahtarıdır. Balıklar ilk olarak protokol adım 4.1 açıklandığı gibi üreme52 için birkaç hafta şartlandırılmış olmalıdır. Bunu takiben, doğal yumurtlama davranışında (4.3) kullanılmak üzere doğal gametogenezi (4.2) artıran bir protokol sunulmuştur( 4.3), tam zamanlı embriyo elde etmek için yakın zamanda geliştirilen in vitro tekniği (4.4). Protokol 4.3, B. brachyistius ve B. gauderioiçin eşit derecede etkilidir ve protokol 4.4 B. gauderio'daüstündür.

  1. Klima
    1. B. brachyistius'u çiftlerde/küçük gruplarda (100-150 L tank) veya çok büyük tanklarda (yaklaşık 475 L tankta 2 erkek ve 5-6 kadın) ıslah koşullarında çok agresif hale geldiklerinde saklayın. Barınak olarak kullanılacak balık başına en az 1-2 PVC tüp olmalıdır(Şekil 3A,B).
    2. B. gauderio çok daha yüksek yoğunlukta yetiştirilebilir. 100 L'lik bir tankta (2 erkek ve 6 kadın) en fazla sekiz kişi saklayın. Barınak olarak kullanılacak balık başına en az 1 PVC tüp olmalıdır. Karışık iplik ekleme zenginleştirme ve gizleme lekeleri artırır. Yetişkinlerin tüplere doğal olarak yumurtlabilmeleri için tankın üst lerine delinmiş 1 cm çapında delikli 50 mL santrifüj tüp ekleyin(Şekil 3C).
    3. Üreme mevsiminde, dondurulmuş kan solucanları ile desteklenen günlük taze blackworms balık beslemek. Gıda vitamin ve takviyeleri ile zenginleştirilmiş olabilir, istenirse.
    4. Ev balıkları normalde nispeten yüksek iletkenlikte (300-600 μS), pH dengeli bir çözeltide. Üreme mevsiminde, gonad recrudescence ve yumurtlama neden 1-3 hafta boyunca en az yarısı iletkenlik düşürmek. Ters ozmoz (RO) suyunun günlük ilaveleri ile iletkenlik azalır, iletkenlik düşük olduğunda pH'a yakın dikkat edin (pH <6).
    5. Üreme koşulları yaklaşık 3−5 ay süreyle saklanabilir ve yumurta üretimi zaman içinde kapalı dır. Bu süreden sonra, 1-3 hafta boyunca yavaş yavaş yüksek iletkenlik balık dönmek. Tekrar üreme koşullarına maruz kalmadan önce yüksek iletkenlik başka bir 3 ay tutun.
  2. Yumurtlama ajanı (SGnRHa + Domperidone) enjeksiyonları kullanın.
    1. Gravid görünen üreme koşullarında dişi balıkları tanımlayın (Şekil 4). B. gauderio'da dişi, sadece havalandırmaya kadar kaudal olan gonadları şişmiş olacak. B. brachyistius dişiler şişmiş karınları olacak ve derin gövdeli görünür (Şekil 4A). Erkeklerde genellikle sperm üreten bir sorun yoktur. Ancak toplanan sperm hacminin daha büyük olması nedeniyle daha büyük erkekler tercih edilir.
      NOT: Yumurtlama ajan gamet olgunlaşması kolaylaştırır ve yumurtlama koordine ticari bir hormon karışımıdır. Balık geçmişte yumurtlama maddesi enjekte edilmişse, enjeksiyonlar arasında >4 hafta dinlenme ve bol miktarda beslenmeye izin verin. Birkaç yumurta ve bol miktarda sperm sağlamak için en az 2 erkek ve 4-5 dişi enjekte etmenizi öneririz.
    2. MS-222 (0.4 g/3 L) birkaç dakika için balık anestezi, balık duruşunu korumak mümkün değildir kadar, hareketsiz, ama operküler hareketi devam ediyor (Evre II53).
    3. Yumurtlama maddesi miktarını hesaplamak için balığı (g) tartın, (0,5 μL/ g) + 0,5 μL. Ekstra 0,5 μL pipetleme hataları için hesaplar.
    4. Bir PCR tüpiçinde 4x hacimli tampona (1x PBS veya DPBS) yumurtlama aracısını ekleyin ve iyice karıştırın. Çözüm bulutlu olacak. Bu termoplastik üzerine yumurtlama ajan dağıtmak ve daha sonra hesaplanan dozu ölçmek için bir pipet kullanmak yardımcı olur. Yumurtlama ajan viskoz, bu yüzden tüm dozu dağıtmak ve pipetleme ile dikkatli olun emin olun.
    5. Pipet termoplastik üzerine enjeksiyon çözeltisi ve hassas cam şırınga içine çizmek, hava kabarcıkları kaçınarak. Biz 28 G, 19-25 mm uzunluğunda, yontucu iğne öneririz.
    6. Pürüzsüz bir oranda dorsal gövde kas içine çözelti enjekte edin. İğne 2-4 s s oturup sonra çıkarın. Hemen iyileşme için tatlı sistem suya balık koyun.
    7. Yaklaşık 24 saat sonra embriyoların toplanması için hazırlayın (bkz. 4.3 veya 4.4). Tek hücreli mikroenjeksiyon için gerekenler de dahil olmak üzere gerekli tüm malzemeleri toplayın (bkz. bölüm 5).
  3. Doğal yumurtlama yoluyla embriyo elde edin.
    1. Büyük bir 450 L tanklarda ev yumurtlama ajan enjekte yetişkin (4.2). En etkili seks oranları genellikle 1-2 erkek ve 3-4 kadın yeterli gizleme yerleri PVC tüpler yapılmış ve yumurta tüketimini önlemek için tank alt koyu mermer substrat olmuştur. Mermerler genellikle b. brachyistius için B. gauderiodaha önemlidir , hangi yarıklar veya 50 mL santrifüj tüpler yukarıda açıklandığı gibi onların yapışkan yumurta yatırmak için tercih.
    2. Normal laboratuvar çalışma saatleri ne gece yumurtlama maç için ters ışık döngüsü nde balık yerleştirin. Hazır tüketici sınıfı güvenlik sistemi kullanarak, uzaktan bağlanmış bir bilgisayardan kaynaklanan rahatsızlığı en aza indirmek için kızılötesi aydınlatma kullanarak balıkları izleyin(Şekil 3).
    3. Balık spontan karanlık fotoperiod sırasında yumurtlama ajan enjeksiyon sonrası yaklaşık 24 saat yumurtlamak olacaktır.
    4. Yumurtlama başladığında, yumurtlama davranışı oluşurken saatlik yumurta toplamak. B. brachyistius olarak, taze yumurtlanan yumurta zararını en aza indirmek için ince bir pamuk örgü ağı üzerinde küçük çaplı bir sifon kullanarak yumurta toplamak. 50 mL santrifüj tüpler veya tank substrat B. gauderio yumurta toplamak. Düşük yoğunluklu kırmızı ışıkta bir kafa lambası kullanarak balık yumurtlama için en az rahatsızlık ile verimli çalışın. İlk bölünme yaklaşık 1 saat sonrası döllenme (HPF) meydana geldiğinden, yumurtanın büyük bir kısmı tek hücreli mikroenjeksiyon için uygun olacaktır.
    5. Hemen mikroenjeksiyona devam edin (bkz. bölüm 5).
  4. B. gauderioin vitro fertilizasyon için erkekler sıkmak .
    1. Zebrafish Book54:10 mM HEPES, 80 mM KCl, 45 mM NaCl, 45 mM sodyum asetat, 0.4 mM CaCl2ve 0.2 mM MgCl2'deaçıklandığı gibi sperm genişletici çözeltisini (SES) hazırlayın.
      1. 1 M NaOH ile pH'ı 7,7'ye ayarlamak için ddH2O'yı kullanın.
      2. Buzdolabında saklayın.
      3. Kullanmadan önce 0,22 μm'lik bir filtreden süzün.
    2. MS-222 (0.4 g/3 L) birkaç dakika için balık anestezi, balık duruşunu korumak mümkün değildir kadar, hareketsiz, ama operküler hareketi devam ediyor (Evre II53). 500 μL SES aliquots'u buza yerleştirin.
    3. Kuru eller ve balık iyice, özellikle baş ve havalandırma etrafında. MS-222 ıslatılmış, nemli kağıt havluyla kaplı polistiren köpük/sünger tutucuya ventral tarafı yukarı, sola (sağ elli bireyler için) yerleştirin. Baş mümkün olduğunca tablo ile paralel olmalıdır.
      NOT: Adımlar 4.4.4-4.4.6 mümkün olduğunca çabuk yapılmalıdır ve balık sadece 30-60 s su dışında olmalıdır.
    4. Kaudal istikamete basınç uygulayın ve konadların üzerinde havalandırmaya doğru hafif çehreler sıkın. Balık atıkları atabilir. Herhangi bir atık dışarı atılırsa hassas bir görev silme ile havalandırma temizlemek için dikkatli olun. Sperm ile atık toplamayın. Erkeğin büyüklüğüne bağlı olarak 10-60 μL yaygındır.
    5. Bir ucu ile bir mikropipet kullanarak, 50 μL artışlarla erkekten sıkılır gibi dikkatle sperm toplamak. Spermleri doğrudan buz üzerinde 500 μL SES aliquots içine yerleştirin. Diğer sıkıyor ise sperm toplama da başka bir araştırmacı yardımcı olması yararlı olabilir. Sperm en kısa sürede kullanılmalıdır, ancak en az 1 saat canlı kalır.
    6. Toplandıktan hemen sonra, kurtarma için tatlı sistem suyuna balık koyun. Balık sadece 30-60 s su dışında olmalıdır.
  5. B. gauderioin vitro fertilizasyon için diş islik sıkmak .
    1. MS-222 (0.4 g/3 L) birkaç dakika için balık anestezi, balık duruşunu korumak mümkün değildir kadar, hareketsiz, ama operküler hareketi devam ediyor (Evre II53). Politetetrafloroethene sayfasını iş istasyonuna yerleştirin.
      NOT: Bölüm 4.5.1-4.5.5 mümkün olduğunca çabuk yapılmalı ve balık lar sadece 30-60 s'lik süreyle sudan çıkmalı.
    2. Kuru eller, aletler, politetrafloroethene levha, ve balık iyice, özellikle baş ve havalandırma etrafında. Baş ön (sağ elini kullanan kişiler için) bakan yan yerleştirin.
    3. Kaudal istikamete basınç uygulayın ve konadların üzerinde havalandırmaya doğru hafif çehreler sıkın. Balık atıkları atabilir. Herhangi bir atık dışarı atılırsa hassas bir görev silme ile havalandırma temizlemek için dikkatli olun. Balığın büyüklüğüne bağlı olarak 20-150 yumurta yaygındır. Bir politetrafloroethene kaplı spatula / aracı kullanarak cloaca sıkılır gibi dikkatle yumurta toplamak. Hızlı bir şekilde küçük bir Petri çanak ve kapak yumurta taşıyın. Bu işlem sırasında yumurtaların kuru kaldığından emin olun. Alternatif olarak, sıktıktan sonra yumurta kütlesine küçük bir Petri kabının tabanına veya dişiden atılırken politetrafloroethene levhaya dokunun.
    4. Toplandıktan hemen sonra, kurtarma için tatlı sistem suyuna balık koyun.
  6. B. gauderioin vitro fertilizasyon için yumurta döllenme gerçekleştirin.
    1. SES'e 100 μL'lik iyi karıştırılmış sperm ekleyin (bkz. adım 4.4) doğrudan yumurta kütlesinin üzerine.
    2. 1 mL sistem suyu ekleyin (0,22 m filtreden süzülür) ve 30-60 s boyunca iyice karıştırın.
    3. Ek bir 1-2 mL sistem suyu ekleyin (Petri kabında biraz yer bırakın) ve kuvözde yerleştirin. Petri kabında ivf rekor süresi ve 29 °C kuluçka makinesine geçin. Gelişimin ilerlemesini kontrol etmek için 50 dk'lık bir zamanlayıcı ayarlayın (örneğin, hayvan direğinde tek hücreoluşumu, bkz. Şekil 6). Bu süre zarfında, mikroenjeksiyon için malzemeler hazırlayın.

5. Tek Hücreli Mikroenjeksiyon

  1. Yumurtlama maddesi enjeksiyonlarından (adım 4.2) veya doğal yumurtlama (adım 4.3) öncesinde mikroenjeksiyon iğnelerini çekin. Bir filaman (O.D. 1.0 mm, I.D. 0.58 mm, 10 cm uzunluğunda) ve mikroenjeksiyon iğneleri çekmek için bir iğne çekmecesi ile borosilikat cam kılcal kullanın. Planlanan tedavi enjeksiyonu başına 2-4 iğne hazırlayın.
    NOT: Filament ile backloading iğneler tercih edilir, çünkü filament ucuna doğru çözelti fitil ve kabarcıklar ortadan kaldırır. Ancak filamentsiz iğneler kullanılabilir ve ön yüklemenin sonuç üzerinde hiçbir etkisi olmamalıdır. İğnenin uzun ama sağlam konik olması gerekir. İğne çekme programını başlangıç noktası olarak aşağıdaki özelliklere sahip olarak kullanın: ısı = 500; Çekme = 70; Hız = 70; ve Zaman = 100. Temsili iğne morfolojileri Şekil 5A'dagösterilmiştir.
  2. Enjeksiyon çözeltisi hazırlayın ve iğne hazırlayın.
    1. PCR tüpüne 0,9 l sgRNA ve 0,9 μL Cas9 enzimi (1 mg/mL) ila %10 00 veya %100 fenol kırmızısı (sırasıyla %1 ve %10 son fenol kırmızısı konsantrasyonu için) ekleyin. İyi bir şekilde karıştırın ve sgRNA ve Cas9'un karmaşık hale getirmek için 2−5 dk buz üzerinde oturun. Enjeksiyon çözeltisinde sgRNA, Cas9 ve fenol kırmızısının son konsantrasyonunu hesaplayın.
      NOT: Yukarıdaki tarifi kullanarak iğne tıkanma veya kesme verimliliği ile ilgili sorunlar varsa, Cas9 stabilize etmek ve iğne tıkanması önlemek için 1x son konsantrasyon tuz / tampon karışımı kullanmak yararlı olabilir.
    2. 2 μL'lik çözeltiyi mikroenjeksiyon iğnesine geri yüklemek için bir mikroyükleyici pipet ucu kullanın. Sıvıyı ucuna mümkün olduğunca yakın bir şekilde dışarı at.
    3. İğneyi mikromanipülatöre yükleyin ve basınç ayarlarını ayarlayın (775 pi, 0.1−0.2 s ve 8-12 pcile başlayın).
    4. Kapsam altında, bir çift ince çifenlik kullanarak iğne ucunu yontmuş bir açıyla kırın. İğnekoucu sertlik başlar yere doğru kırın. En iyisi ucu na yakın kırmak, enjeksiyon çözeltisinin boyutunu test etmek ve gerekirse daha fazla kırmaktır. İğnenin deliği sert bir konik tutarken mümkün olduğunca küçük kalmalıdır (Şekil 5A).
    5. Enjeksiyon çözeltisinin boyutunu ölçmek için mineral yağ ve bir mikrometre kullanın. 1-2 nL genellikle kullanılır; 0,1 mm çap 0,5 nL'dir.
    6. İğne ucu veya basınç ayarlarını ayarlayarak teknik özellikler dahilinde bir enjeksiyon hacmi elde edin.
  3. Gelişen zigotları belirleyin ve enjeksiyon aşamasını hazırlayın. Enjeksiyon aşamasını ayarlayın. 100 mm çapında petri kabı alın. Ters üst altında alt ve yer ters çevirin. Ters üst içine bir cam mikroskop slayt yerleştirin. Mikromanipülatörünüzün kapsama nasıl monte edildiä ine bagıda, ters tabandan eklenen yükseklik gereksiz olabilir.
    1. Gelişmekte olan yumurta bakmak ve ivf sonra 50-60 dk tahmin döllenmiş zigot belirlemek. Hayvan direği oluşmaya başlayacak ve sarısı/hayvan hücresi arabirimi etrafında küçük yağ damlacıkları fazlalığı olacaktır (Şekil 6).
    2. Plastik bir transfer pipeti kullanarak mümkün olduğunca az su ile 10-20 yumurta toplayın (yumurta geçmesine izin vermek için biraz ucu kesin) ve slayt kenarına yerleştirin. Su kaydırak altında kötü olacak ve kenarına karşı yumurta çekin.
    3. Hassas bir görev silme kullanın ve fazla suyu çıkarmak ve yumurtaların sakaya sıkıca yapışmasını sağlamak için kaydırağa hafifçe basın. Enjeksiyon sırasında yumurta hareketini önlemek için az ayakta nem korurken yumurta nemli tutmak için yeterli su olmalıdır.
  4. Doğrudan tek bir hücreye enjekte edin.
    1. Yumurtaları slayta dikey olarak, yaklaşan iğneye dik olarak hizala (Şekil 5B).
    2. Mikromanipülörü kullanarak iğneyi korrion'a doğru yerleştirin. Kabaca 45° açıyla iğneyi korrion'a ve sonra da tek hücreye yerleştirin. Bu sarısı ile tek bir hücre girmek için yararlı olabilir. Hem enjeksiyon aşamasının serbest elle hem de mikromanipülatörle taşınması enjeksiyon işlemi üzerinde daha fazla kontrol sağlayabilir(Şekil 5B).
    3. Tek hücreye sgRNA/Cas9/phenol kırmızı solüsyonu enjekte edin. İğneyi dikkatlice çıkarın. Tüm yumurtalar enjekte edilene kadar bir sonraki yumurtaya devam edin ve 5.4.1-5.4.3 adımlarını tekrarlayın.
    4. İnce forceps ile enjeksiyon sırasında kırık herhangi bir yumurta çıkarın. Yeni bir 100 mm çapında Petri kabına yumurtaları enjeksiyon aşamasından yavaşça çıkarmak için fışkırtmalı şişede 0,22 m filtrelenmiş sistem suyu kullanın.
    5. Tüm yumurtalar enjekte edilene veya iki hücreli evreye gelişene kadar 5.3.3-5.4.6 adımlarını tekrarlayın. Döllenme oranları ve enjeksiyon başarısını belirlemek için enjeksiyonsuz kontrol olarak yaklaşık 20 döllenmiş yumurta yı bir kenara ayırın emin olun. Daha büyük debriyajlar için, iki hücreli evreye gelişmiş enjekte edilmemiş embriyolar ve döllenmiş yumurtaları bir kenara bırakan daha küçük debriyajlar için kullanılır.
    6. Ayrıca, genomda bulunmayan bir genin karşıbir sgRNA ile karmaşık Cas9 ile 15-25 embriyo enjekte ederek bir sgRNA / enjeksiyon kontrolü düşünün. GFP geni yabani tip embriyolar için önerilir. Her Petri kabında yumurta, ebeveyn, IVF saati ve tarih sayısını kaydedin. Enjekte edilmemiş olarak sgRNA hedef veya etiket ekleyin. 29 °C'lik bir kuluçka makinesine geçin.

6. Hayvancılık

  1. Yumurtalar ala.
    1. Enjeksiyonları takiben yumurta canlılığını 4-6 saat kontrol edin.
    2. Ölü yumurta ların yanı sıra döllenmemiş yumurtaların sayısını kaydedin. Döllenmemiş yumurtalar sekiz hücreli evrede duracaktır ve hayvan kutbundaki hücrelerin rozet desenine sahiptir(Şekil 6). Ölü yumurta sayısına ve sudaki yumurta enkaz miktarına bağlı olarak, suyun en az %50-80'ini çıkarın ve filtrelenmiş sistem suyu ile değiştirin. Bir hücresel enkaz filmi veya biyofilm oluşursa Petri kabının alt ovmak için yararlı olabilir.
    3. Önümüzdeki 2-3 gün boyunca yumurtaları günlük 1-2x kontrol edin. Yumurtalar her kontrol edide 6.1.2-6.1.3 adımlarını tekrarlayın.
    4. 2−3 gün sonra larvalar yumurtadan çıkar. Yumurtadan çıkarken tüm yumurta kovanlarını çıkarın. Nazik pipetleme yarı yumurtadan edilmiş larvaların serbest edilmesine yardımcı olabilir.
  2. Larvabakımı.
    1. Yumurtaları günlük 1−2x kontrol edin. Larvalar her kontrol edide 6.1.2-6.1.3 adımlarını tekrarlayın.
    2. 6-14 DPF itibaren, larvalar sirke yılan balığı yem. Sirke yılan balıkları çanak canlı kalacak, çünkü gıda hafif bir fazlalık iyidir. Çanak kontrol ve temizlenir her zaman sirke yılan balığı ekleyin.
    3. 11-14 DPF itibaren, sirke yılan balığı ek olarak larva başına 5-10 taze yumurtadan Artemia ekleyin. Bu süre zarfında larvalar ücretsiz yüzme Artemiayemek öğreneceksiniz.
    4. 15 DPF'de larvaları akan su, filtrasyon ve havalandırma lı bir tankta yumurta bardaklarına (bkz. bölüm 6.2.5) taşıyın. Fincan başına en fazla 25 embriyo olmamalıdır. Yumurta bardak altında bir örgü örgü ile plastik bardak vardır. Bir 100 mm Petri çanak üst / alt mesh üzerinden düşen gıda durdurmak için yumurta fincan altına eklenebilir. Yumurta bardak ları, ayrık grupları korurken, balığın su kalitesi nedeniyle daha büyük bir su hacminde barındırılmasına olanak sağlar. 15-18 gün lerinden itibaren larva başına hem sirke yılan balıkları hem de 15−30 taze yumurtadan çıkan Artemia eklemeye devam edin. Temiz Petri çanak parçası günlük ve ölü Artemiakitleleri kaldırmak için bir pipet kullanın.
    5. Gün 18-30 itibaren, sadece taze yumurtadan Artemiabeslemek . Balık büyüdükçe ve kuyruk ısırma görülürse beslenme miktarını artırın.
    6. Yaklaşık 30 gün sonra, 10 L (2,5 galon) tanklar, tank başına yaklaşık 25 kişi balık taşıyın. Filtrasyon, havalandırma ve saklanma yerleri olduğundan emin olun. Silindirik biyofiltrasyon ortamı nı ve küçük çaplı PVC tüpleri göz önünde bulundurun.
    7. Yaklaşık 30-45 günden itibaren taze yumurtadan çıkan Artemia ve blackworms yem. Tank için standart temizlik ve su değişikliklerini koruyun (örneğin, 1 haftada en az ~%10-%20 su değişimi).
    8. ~45 DPF'den sonra, ~60 DPF'ye kadar sadece blackworms ile besleyin.
    9. ~ 60 DPF sonra, 40 L (10 galon) tankları yaklaşık 15 balık kohortlar hareket ve yetişkin hayvancılık prosedürleri başlar. Yerleri gizlemek için PVC tüpler ve bir iplik "paspas" (bir mantar etrafında birbirine bağlanmış kahverengi iplik kütlesi) ekleyin(Şekil 3C). Balıklar, gübrelemeden yaklaşık 3−4 ay sonra üreme boyutuna (10−12 cm) yaklaşmalıdır.

7. Yetişkin Yetiştiriciliği

  1. Bir sonraki beslemede az miktarda kara solucan ın bulunması için balıkları her gün yeterli miktarda kara solucanla besleyin. Bu reklam libitum besleme maksimal büyüme sağlar.
  2. Haftada birkaç kez, bu kan solucanları ile beslenen blackworm takviyesi için yararlı olabilir.
  3. Her 2-4 haftada bir temiz tanklar %20-30 su değişimi ile. İplik paspasbiyofilm / yosun dolu alırsa, RO su altında temiz ovmak.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

SGRNA hedef bölgeleri Bölüm 1'de açıklandığı gibi Hem B. gauderio hem de B. brachyistius'ta scn4aa'nın eksex 1'inde tanımlanmıştır. SGRNA'lar Bölüm 2'de açıklandığı şekilde oluşturuldu. Başarılı sgRNA seçimi ve sentezinden sonra(Şekil 1),in vitro dekolte test edildi (Şekil 2). İn vitro kesim gösteren sgRNA'lar daha sonra tek hücreli mikroenjeksiyonlar için seçildi.

Erişkin balıklar üremeiçin şartlandırıldı (Bölüm 4.1), daha sonra bir yumurtlama ajanı (Bölüm 4.2) enjekte edildi ve daha sonra Ivf için sıkıştırılmış(B. gauderio)Bölüm 4.4'te açıklandığı gibi veya doğal olarak yumurtlamalarına izin verildi(B. brachyistius) Bölüm 4.3'te açıklanmıştır. Bu çabalar her iki türde de mikroenjeksiyon için tek hücreli embriyolar ortaya çıkar. Bölüm 5'te açıklandığı gibi, scn4aa sgRNA/Cas9/phenol kırmızı kompleksinin 1.5−2.0 nL'si (65-190 ng/uL sgRNA, 450 ng/uL Cas9, %1−10 fenol kırmızısı, son konsantrasyonlar) tek hücreli aşamada enjekte edildi. Aynı debriyajdan gelen yumurtalar enjekte edilmemiş kontroller olarak kullanıldı. Tüm embriyolara Bölüm 6'da açıklandığı gibi iyi bir şekilde bilgili olarak verildi. Tüp bebek takibinde yumurtaların %40-90'ı döllendi ve embriyoların %70-90'ı enjeksiyon dan sonra yumurtadan çıktı.

Balıkların yaklaşık %75'i 6−11 DPF'ye kadar hayatta kaldı ve daha sonra fenotiplendi. Larva balıkları, Sylgard immobilize Ag/Cl kayıt elektrotları ile daha büyük bir kap içine gömülü 35 mm Petri kabına yerleştirilmiştir(Şekil 7A). Embriyo hareketi sistem suyu ile yapılan ve embriyoya uyacak şekilde kesilen %3'lük agarose kalıpları kullanılarak kısıtlanmıştır(Şekil 7B). Aynı kayıt odası her iki tür için de kullanılmış ve aynı agarose kalıbı tür karşılaştırmaları arasında kullanılmıştır. Embriyolar 60 s için kaydedildi, bu da yüzlerce EOD'yi yakalamak için yeterli. Karşılaştırma için yaş ve boyut eşleştirmeli enjekte edilmemiş denetimler seçildi. Şu anda, hayatta kalan embriyoların %10-30'u genlik EOD'de azalmıştır. Belirgin morfolojik defektleri olmayan EOD genliğinde azalma gösteren ve enjekte edilmemiş tüm embriyoları kontrol eden embriyolar DNA ekstraksiyonu ve scn4aa hedef bölgesinin sonraki PCR'si için sindirilmiştir. Genellikle fenotip penetrans bir dizi vardı, bazı bireyler diğerlerinden daha EOD genlik daha güçlü bir azalma sahip.

PCR temizliği ve klonlama sonra, her embriyo 30 + klonlar Sanger sıralama için seçildi. CRISPR/Cas9 indüklenen mutasyonlar B. gauderio (Şekil 8A,B) ve B. brakiistius (Şekil 9A,B) güçlü EOD genlik redüksiyonu olan bireylerde saptandı (Şekil 8C ve Şekil 9C , sırasıyla), enjekte edilmemiş kontrollerin yalnızca referans genotiplere sahip olduğu yer. Doğrulanmış mutantlar ("CRISPR") ve yaş/boyut uyumlu enjekte edilmemiş kontroller arasında EOD genliği görselleştirilmesi hem scn4aa mutant B. brachyistius (Şekil 10A) ve B. gauderio (Şekil 10B ) embriyoların eOD genliği kontrollere göre anlamlı olarak daha düşüktü (p < 2.2 x 10-16, Welch iki örnekli t-testi). Scn4aa CRISPR / Cas9 hedefleme hem B. brachyistius ve B. gauderio başarılı oldu ve her iki tür de larva / erken elektrosit deşarj scn4aa implicate.

Figure 1
Şekil 1: sgRNA şablon sentezi ve transkripsiyon. (A) SgRNA şablon sentezinin gel görüntüsü. Etiketler miyod (MYO2, MYO1) için farklı sgRNA'lara ve scn4aa (S1−S3) için üç sgRNA'ya karşılık gelir. Oligomerları tavladıktan sonra ~ 120 bp şablonu üretilir. (B) B. gauderio (bg2017) için üç sgRNA için sgRNA transkripsiyonunun gel görüntüsü (bg2017) ve B. brachyistius için iki (bb2016, 2017). SgRNA ikincil yapıya bağlı olarak iki bant olarak görünür ve dsDNA merdiveni kullanırken 50−150 bp arasında olacaktır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Başarılı (sg1) ve başarısız (sg2) in vitro CRISPR tahlillerinin temsili jel görüntüsü. CRISPR bileşenleri olmadan eşdeğer bir şablon miktarı scn4aa şeridinde gösterilir. Kesmenin gerçekleştiğini gösteren sg1'deki yinelenen bantlara dikkat edin. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Zayıf elektrikli balıklar için damızlık tank kurulumları. (A) Yumurtlama davranışının kablosuz video izleme için tipik kurulum şeması. Üç ticari cctv kameralar (Swann, Inc) kızılötesi ışık üretme yeteneğine sahip su üst hedefleniyor ve bir dijital video kaydedici bağlı (DVR). Video, ağa bağlı bir bilgisayardan (PC) bitişik bir odada yumurtlama davranışı için gerçek zamanlı olarak izlenir. (B) B. brachyistiusböyle bir kurulum ile yakalanan yumurtlama davranışı . (C) PVC gizleme tüpleri ve iplik paspaslar ile B. gauderio için tipik bir üreme kurulum. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Üreme erkek ve dişiler. (A) B. brachyistius ve (B) B. gauderio. Her iki tür de cinsel olarak dimorfiktir ve cinsel açıdan olgunlaştığında görsel olarak kolayca ayırt edilebilirler. Her iki dişi de bu fotoğraflarda yer çekimi ne kadar dır, karakteristik olarak şişmiş karınları olgun yumurtalarla doludur. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 5
Şekil 5: Mikroenjeksiyon. (A) Uygun bir mikroenjeksiyon hacmi sağlamak için cam kılcal iğne uçları kırılmalıdır. Soldaki uç kırılmamış. Orta ve sağ uçları yumurta chorion delmek için biraz açılı bir bevel ile kırılır. (B) Yumurtalar cam bir kaydıra doğru dizilir (enjeksiyonun teslimini görselleştirmek için izleyici olarak %1-10 fenol kırmızısı eklenir) ve cam kılcal iğneler enjekte edilir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 6
Şekil 6: Gelişim aşamaları. (A) B. gauderio ve (B) B. brachyistius. Tüm yumurtaların döllendiği varsayılır ve gelişimi 24 HPF'ye kadar izlenir. 12−24 HPF embriyoları canlı yumurtalarda görülebilir, aksi takdirde yumurta bozulması sergiler. Döllenmeden bağımsız olarak yumurta aktivasyonunda çeşitli bölünmeler meydana gelmekte gibi görünün. Döllenmemiş yumurtalar, döllenmiş yumurtalarda çok daha simetrik olan alışılmadık dekolte desenleri sergilerler. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 7
Şekil 7: Bu çalışmada kullanılan larva kayıt odasının fotoğrafı. (A) Elektrotlar Sylguard içinde gömülü ama 35mm çanak içine bir embriyo içeren içine genişletmek 3% agarose kalıp ile sınırlı. (B) Agarose nedeniyle embriyonun sınırlı hareketini vurgulayan daha yüksek büyütme görüntüsü. Embriyo boyutu değiştikçe çıkarılabilir agarose parçaları dikkat edin. B. gauderio embriyo pozitif elektrot karşı karşıya. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 8
Şekil 8: B. gauderio'daCRISPR/Cas9 indüklenen mutasyonlar. (A) Tek bir scn4aa'da Cas9 kaynaklı mutasyonların genomik DNA'sından 32 klon dizisi F0B. gauderio embriyoyu (11 DPF) hedefledi. Referans sırası gri olarak vurgulanan sgRNA hedef sitesi, kırmızı ile vurgulanan protospacer-bitişik motif (PAM) dizisi ve "|" ile işaretlenmiş Cas9 kesme alanı ile altı çizilir. Beklenen vahşi tür dizisinden değişiklik verilir ve her dizi için klon sayısı parantez içinde verilir. (Kısaltmalar: + = ekleme, - = silme, ± = indel) CRISPR ilişkili olmayan dizi benzerliklerine karşı kalın lıklar vardır. Şekil Jao ve ark.60modellenmiştir. (B) Amino asit dizisi scn4aa knockdown B. gauderio gelen sekanslı klonlar tahmin (A). Yabani tip dizisinden Cas9'a bağlı değişiklikler kırmızı ile vurgulanır ve nükleotitkaynaklı değişim numarası verilir. (C) Beş boyutlu larvalardan 22 saniyelik elektrik kayıtları, hepsi aynı kayıt odasında 6 DPF kaydedilmiştir. Kazanç ayarları tüm izlemeler için aynıdır. Kırmızı daki izler doğrulanmış mutasyonları olan B. gauderio larvalarından (Şekil 8A'dagösterilen bir birey , yukarıda B), siyah takibe ait izler enjekte edilmemiş B. gauderio larvalarındandır. Genel olarak, CRISPR/Cas9 scn4aa düzenlemesi EOD genliğinde bir azalma gösterdi, ancak etkisi heterojendi. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 9
Şekil 9: B. brachyistius'taCRISPR/Cas9 indüklenen mutasyonlar. (A) Tek bir scn4aa'da Cas9 kaynaklı mutasyonların genomik DNA'sından 42 klon dizisi F0B. brachyistius embriyosu (11 DPF) hedeflenmiştir. Referans sırası gri olarak vurgulanan sgRNA hedef sitesi, kırmızı ile vurgulanan protospacer-bitişik motif (PAM) dizisi ve "|" ile işaretlenmiş Cas9 kesme alanı ile altı çizilir. Beklenen vahşi tür dizisinden değişiklik verilir ve her dizi için klon sayısı parantez içinde verilir. (Kısaltmalar: + = ekleme, - = silme, ± = indel) CRISPR ilişkili olmayan dizi benzerliklerine karşı kalın lıklar vardır. Şekil Jao ve ark.60modellenmiştir. (B) Amino asit dizisi scn4aa knockdown B. brachyistius gelen sıralı klonlar tahmin (A). Yabani tip dizisinden Cas9'a bağlı değişiklikler kırmızı ile vurgulanır ve nükleotit indüklenen değişim numarası verilir. (C) Dört boyutla eşleşen larvalardan on saniyelik elektrik kayıtları, hepsi aynı kayıt odasında 10 DPF kaydedilmiştir. Kazanç ayarları tüm izlemeler için aynıdır. Kırmızı daki izler B. brachyistius larvalarından dır ve doğrulanmış mutasyonlar (yukarıda A, B'de gösterilen bir kişi), siyah takibe ait izler enjekte edilmemiş B. brachyistius larvalarındandır. Genel olarak, CRISPR/Cas9 scn4aa düzenlemesi EOD genliğinde bir azalma gösterdi, ancak etkisi heterojendi. Ters EOD'ler kayıt sırasında yönünü değiştiren balıklardan dır. Buna rağmen deneysel balıklar ile kontroller arasında fark yoktur. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 10
Şekil 10: CRISPR ve enjekte edilmemiş boyut/yaş eşleşen kardeşlerin ortalama EOD genliği kutu çizimleri. (A) 10 DPF'de B. brachyistius larvalarının EOD genliği. 100 kazanç la kaydedilen CRISPR n = 56 Iki kişiden 56 EOD, enjekte edilmemiş n = 114 EODs üç kişiden. (B) 6 DPF'de B. gauderio larvalarının EOD genliği. 500 kazanç la kaydedilen CRISPR n = 34 Iki kişiden 34 EOD, enjekte edilmemiş n = 148 EODs üç kişiden. CRISPR balıkgenliği enjekte edilmemiş kontrollerden (p < 2.2 x 10-16, Welch iki örnekli t-testi) önemli ölçüde daha azdı. Tüm bireyler Şekil 7'deaçıklanan kayıt odası ile kaydedildi. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Açıklama Sıra
Sabit oliomer 5'-AAAAGCACCGACTCGGTGCCACTTTTTTCAAGTTGATAACGGACTCCTTATTTAACTTGC TATTTCTAGCTCTAAAAC-3'
Hedef oliomer omurgası (GG-N18, PAM yok) 5'-TAATACGACTCACTATAGG-N18-GTTTTAGAGCTAGAAATAGCAAG-3'
Hedef oliomer omurgası (N20, PAM yok) 5'-TAATACGACTCACTATAG-N20-GTTTTAGAGCTAGAAATAGCAAG-3'
Brienomyrus brachyistius
scn4aa Bb sgRNA hedef (N18, PAM ile): 5'-TCTTCCGCCCCTTCACCACGG-3'
Scn4aa Bb sgRNA oligomer (GG-N18): 5'-TAATACGACTCACTATAGG TCTTCCGCCCCTTCACCA GTTTTAGAGCTAGAAATAGCAAG-3'
scn4aa Bb PCR astar (218 bp)
Scn4aa_bb_exon1_F: 5'-ATGGCCGGCCTTCTCAATAA-3'
Scn4aa_bb_exon1_R: 5'-TCTTCCAGGGGAATATTCATAAACT-3'
Brakihipopomus gauderio
Scn4aa Bg sgRNA hedef (N17, PAM ile): 5'- CAAGAAGGATGTAGTGGAGG-3'
Scn4aa Bg sgRNA oligomer (GG-N17): 5'-TAATACGACTCACTATAGG CAAGAAGGATGTAGTGG GTTTAGAGCTAGAAATAGCAAG-3'
Scn4aa Bg PCR astar çifti (204 bp)
scn4aa_bg_exon1_F: 5'-CGCCTTGTCCCTCCTTCAG-3'
scn4aa_bg_exon1_R: 5'-ATCTTCAGGTGGCTCTCCAT-3'

Tablo 1: Protokol için gerekli oligonükleotidler.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Zayıf elektrikli balıkların fenotipik zenginliği, genomik kaynakların yakın zamanda çoğalması ile birlikte, zayıf elektrikli balık modelinde fonksiyonel genomik araçlara yönelik güçlü bir ihtiyacı motive eder. Bu sistem, laboratuvarda kolayca tutulan paralel balık soylarında çok sayıda fenotipik özelliğin yakınsak evrimi nedeniyle özellikle çekicidir.

Burada açıklanan protokol, CRISPR/Cas9 tekniğinin elektrogenez ve elektroalımı paralel olarak evrimleşen zayıf elektrikli balıkların soylarında etkinliğini göstermektedir ve bu nedenle bu modelin söz konuşması için önemli bir adım teşkil eder. ileride, phenotik evrimin karşılaştırmalı genomik çalışmalarında yer almaktadır.

Bu basit metodolojik yaklaşım, zebra balığı için yaygın olarak kullanılan Gagnon protokolü38'intemel benimsenmesini takiben sadece temel moleküler biyoloji becerileri ve eğitimi gerektirir. Teknoloji ilerledikçe, sgRNA üretimi için daha fazla ticari kitin yanı sıra kılavuz RNA'ları sentezleyebilen şirketlerin daha fazla ticari kitleri olduğunu ve bu protokolü moleküler biyoloji deneyimi ve ekipmanı olmayan laboratuvarlar için daha erişilebilir hale getirdiğini belirtmekte fayda var. Öncelikle yüksek mutagenez veriminin enjekte edilen larvaların doğrudan fenotiplemesine izin verdiğini not ediyoruz. Ancak, nadir değildir ve literatür 41 ,42,43,44ile tutarlı olan phenotipik mozaik, önemli bir ölçüde gibi görünüyor. Örneğin, bu scn4aa çalışmasında, mutasyon taşıyan bazı bireyler nispeten sessiz olan diğerlerine göre çok daha büyük genlik EODs sergiledi(Şekil 7, Şekil 8). Bu mutasyonlardan kaç tanesinin germline taşındığı henüz bilinmemektedir. Yakın gelecekte yapılacak çalışmalar istikrarlı mutant hatları oluşturmaya yönelik olacak.

Nakavtlar için NHEJ yolunu nhej kullanımı CRISPR/Cas9 gen düzenleme birkaç potansiyel uygulamalardan sadece biridir: burada özetlenen yöntemler daha gelişmiş uygulamalar için bir atlama taşı55,56. Gelecekteki çabalar, sgRNA/Cas9 kompleksi ile birlikte enjekte edilen DNA donör şablonları tasarlamayı amaçlamalıdır. Bu basit modifikasyon, endojen şablon tabanlı onarım mekanizmalarından (yani homoloji yönelimli onarım veya HDR) yararlanır ve kesin vuruşlara izin verir. HDR NHEJ yaklaşımlarından daha düşük bir verimlilikte meydana gelmesine rağmen, etkinliğini artırmak için ilerleme yapılmıştır57,58. Bu düşük verimlilik, DNA donör şablonu/CRISPR/Cas9 yapısının tasarımını optimize etmek, endojen onarım mekanizmalarını daha verimli hale getirmek ve embriyo üretimini artırmak için çaba gerektirir (aşağıya bakın). Bu verimlilik sorunu çözülebiliyorsa, knockins floresan etiketleri eklemek için kullanılabilir, gen ürünün mutasyona uğramış bir form ifade, ya da değiştirici veya arttırıcı dizileri.

Bu tekniğin arkasındaki moleküler biyoloji oldukça basit olmakla birlikte, hayvancılık gereksinimleri önemli, ama aşılmaz değildir. B. gauderio yaygın olarak kullanılabilir ve bir yıl içinde bir koloni olması için herhangi bir araştırma programı için yeterince hızlı bir şekilde doğurmak. Buna karşılık, B. brachyistius yavaş gelişir, ve anatomik özellikleri şimdiye kadar başarısız IVF girişimleri kanıtlamıştır. Campylomormyrus59 gibi diğer, daha büyük türler bu yaklaşıma daha elverişli olabilir. B. brachyistiusiçin, tüm enjekte embriyolar önemli ölçüde daha fazla emek yoğun doğal yumurtlama yaklaşımı kullanılarak toplandı. B. brachyistius IVF verimliliği artırmak için gelecekteki çabalar yukarıda açıklanan verimlilik sorunları için embriyoların daha yüksek bir verim sağlayacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Yazarlar Monica Lucas, Katherine Shaw, Ryan Taylor, Jared Thompson, Nicole Robichaud ve Hope Healey'in balık yetiştiriciliği, veri toplama ve erken protokol geliştirme konusunda yardımcı olmak için gösterdiği kahramanca çabaları kabul etmektedirler. Ayrıca üç yorumcuya da makaleye verdikleri öneriler için teşekkür ederiz. Biz nihai ürün yorumlarını ele sonra daha kaliteli olduğuna inanıyoruz. Bu çalışma Ulusal Bilim Vakfı #1644965 ve JRG #1455405 ve Doğa Bilimleri ve Mühendislik Araştırma Konseyi DG hibe VLS desteği ile finanse edilmiştir.

Materials

Name Company Catalog Number Comments
20 mg/mL RNA grade Glycogen Thermo Scientific R0551
50 bp DNA ladder NEB N3236L
Borosilicate glass capillary with filament Sutter Instrument BF100-58-10 (O.D. 1.0 mm, I.D. 0.58 mm, 10 cm length)
Cas9 protein with NLS; 1 mg/mL PNA Biology CP01
Dneasy Blood & Tissue Kit Qiagen 69506
Eppendorf FemptoJet 4i Microinjector Fisher Scientific E5252000021
Eppendorf Microloader Pipette Tips Fisher Scientific 10289651
Hamilton syringe Fisher Scientific 14-824-654 referred to as "precision glass syringe" in the protocol
Kimwipe Fisher Scientific 06-666 referred to as "delicate task wipe" in the protocol
MEGAscript T7 Transcription Kit Invitrogen AM1334
NEBuffer 3 NEB B7003S used for in vitro cleavage assay
OneTaq DNA kit NEB M0480L
Ovaprim Syndel USA https://www.syndel.com/ovaprim-ovammmlu010.html referred to as "spawning agent" in the protocol
Parafilm Fisher Scientific S37440 referred to as "thermoplastic" in the protocol
Pipette puller WPI SU-P97 sutter brand
QIAquick PCR Purification Kit Qiagen 28106
Reusable needle- requires customization Fisher Scientific 7803-02 Customize to 0.7 inches long; point style 4 and angle 25
T4 DNA polymerase NEB M0203L Use with the 10x NEB buffer that is included
Teflon coated tools bonefolder.com T-SPATULA4PIECE referred to as "polytetrafluoroethene" in the protocol

DOWNLOAD MATERIALS LIST

References

  1. Gallant, J. R., et al. Genomic basis for the convergent evolution of electric organs. Science. 344, (6191), 1522-1525 (2014).
  2. Zakon, H. H., Lu, Y., Zwickl, D. J., Hillis, D. M. Sodium channel genes and the evolution of diversity in communication signals of electric fishes: convergent molecular evolution. Proceedings of the National Academy of Sciences of the United States of America. 103, (10), 3675-3680 (2006).
  3. Arnegard, M. E., Zwickl, D. J., Lu, Y., Zakon, H. H. Old gene duplication facilitates origin and diversification of an innovative communication system--twice. Proceedings of the National Academy of Sciences of the United States of America. 107, 22172-22177 (2010).
  4. Lissmann, H. W. Continuous electrical signals from the tail of a fish. Gymnarchus niloticus Cuv. Nature. 167, (4240), 201-202 (1951).
  5. Cuellar, H., Kim, J. A., Unguez, G. A. Evidence of post-transcriptional regulation in the maintenance of a partial muscle phenotype by electrogenic cells of S. macrurus. FASEB Journal. 20, (14), 2540 (2006).
  6. Modrell, M. S., Baker, C. V. Evolution of electrosensory ampullary organs: conservation of Eya4 expression during lateral line development in jawed vertebrates. Evolution & Development. 14, (3), 277-285 (2012).
  7. Hopkins, C. D. Design features for electric communication. Journal of Experimental Biology. 202, Pt 10 1217-1228 (1999).
  8. Kawasaki, M. Sensory hyperacuity in the jamming avoidance response of weakly electric fish. Current Opinion in Neurobiology. 7, (4), 473-479 (1997).
  9. Bell, C. C., Han, V. Z., Sugawara, Y., Grant, K. Synaptic plasticity in a cerebellum-like structure depends on temporal order. Nature. 387, (6630), 278-281 (1997).
  10. Heiligenberg, W. Neural Nets in Electric Fish. (1991).
  11. Ban, Y., Smith, B. E., Markham, M. R. A highly polarized excitable cell separates sodium channels from sodium-activated potassium channels by more than a millimeter. Journal of Neurophysiology. 114, (1), 520-530 (2015).
  12. Markham, M. R., Kaczmarek, L. K., Zakon, H. H. A sodium-activated potassium channel supports high-frequency firing and reduces energetic costs during rapid modulations of action potential amplitude. Journal of Neurophysiology. 109, (7), 1713-1723 (2013).
  13. Gavassa, S., Stoddard, P. K. Food restriction promotes signaling effort in response to social challenge in a short-lived electric fish. Hormones and Behavior. 62, (4), 381-388 (2012).
  14. Sinnett, P. M., Markham, M. R. Food deprivation reduces and leptin increases the amplitude of an active sensory and communication signal in a weakly electric fish. Hormones and Behavior. 71, 31-40 (2015).
  15. Salazar, V. L., Stoddard, P. K. Sex differences in energetic costs explain sexual dimorphism in the circadian rhythm modulation of the electrocommunication signal of the gymnotiform fish Brachyhypopomus pinnicaudatus. Journal of Experimental Biology. 211, Pt 6 1012-1020 (2008).
  16. Lewis, J. E., Gilmour, K. M., Moorhead, M. J., Perry, S. F., Markham, M. R. Action potential energetics at the organismal level reveal a trade-off in efficiency at high firing rates. Journal of Neuroscience. 34, (1), 197-201 (2014).
  17. Salazar, V. L., Krahe, R., Lewis, J. E. The energetics of electric organ discharge generation in gymnotiform weakly electric fish. Journal of Experimental Biology. 216, (13), 2459-2468 (2013).
  18. Hopkins, C. D., Bass, A. Temporal coding of species recognition signals in an electric fish. Science. 212, (4490), 85-87 (1981).
  19. Arnegard, M. E., Jackson, B. S., Hopkins, C. D. Time-domain signal divergence and discrimination without receptor modification in sympatric morphs of electric fishes. The Journal of Experimental Biology. 209, Pt 11 2182-2198 (2006).
  20. Sullivan, J. P., Lavoue, S., Arnegard, M. E., Hopkins, C. D. AFLPs resolve phylogeny and reveal mitochondrial introgression within a species flock of African electric fish (Mormyroidea: Teleostei). Evolution. 58, (4), 825-841 (2004).
  21. Crampton, W. G. R. Effects of anoxia on the distribution, respiratory strategies and electric signal diversity of gymnotiform fishes. Journal of Fish Biology. 53, 307-330 (1998).
  22. Pinch, M., Guth, R., Samanta, M. P., Chaidez, A., Unguez, G. A. The myogenic electric organ of Sternopygus macrurus: a non-contractile tissue with a skeletal muscle transcriptome. PeerJ. 4, 1828 (2016).
  23. Lamanna, F., Kirschbaum, F., Waurick, I., Dieterich, C., Tiedemann, R. Cross-tissue and cross-species analysis of gene expression in skeletal muscle and electric organ of African weakly-electric fish (Teleostei; Mormyridae). BMC Genomics. 16, 668 (2015).
  24. Traeger, L. L., et al. Unique patterns of transcript and miRNA expression in the South American strong voltage electric eel (Electrophorus electricus). BMC Genomics. 16, 243 (2015).
  25. Salisbury, J. P., et al. The central nervous system transcriptome of the weakly electric brown ghost knifefish (Apteronotus leptorhynchus): de novo assembly, annotation, and proteomics validation. BMC Genomics. 16, 166 (2015).
  26. Lamanna, F., Kirschbaum, F., Tiedemann, R. De novo assembly and characterization of the skeletal muscle and electric organ transcriptomes of the African weakly electric fish Campylomormyrus compressirostris (Mormyridae, Teleostei). Molecular Ecology Resources. 14, (6), 1222-1230 (2014).
  27. Mate, S. E., Brown, K. J., Hoffman, E. P. Integrated genomics and proteomics of the Torpedo californica electric organ: concordance with the mammalian neuromuscular junction. Skeletal Muscle. 1, (1), 20 (2011).
  28. Swapna, I., et al. Electrostatic Tuning of a Potassium Channel in Electric Fish. bioRxiv. (2017).
  29. Futuyma, Evolution. Third Edition. Sinauer Associates Inc. (2013).
  30. Thompson, A., Vo, D., Comfort, C., Zakon, H. H. Expression Evolution Facilitated the Convergent Neofunctionalization of a Sodium Channel Gene. Molecular Biology and Evolution. 31, (8), 1941-1955 (2014).
  31. Pitchers, W. R., Constantinou, S. J., Losilla, M., Gallant, J. R. Electric fish genomics: Progress, prospects, and new tools for neuroethology. Journal of Physiology Paris. (2016).
  32. Liang, X., et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. Journal of Biotechnology. 208, 44-53 (2015).
  33. Jung, C. J., et al. Efficient gene targeting in mouse zygotes mediated by CRISPR/Cas9-protein. Transgenic Research. 26, (2), 263-277 (2017).
  34. Liu, K., Petree, C., Requena, T., Varshney, P., Varshney, G. K. Expanding the CRISPR Toolbox in Zebrafish for Studying Development and Disease. Frontiers in Cell and Developmental Biology. 7, (13), (2019).
  35. Zu, Y., et al. Biallelic editing of a lamprey genome using the CRISPR/Cas9 system. Scientific Reports. 6, 23496 (2016).
  36. Crispo, M., et al. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes. PLoS One. 10, (8), 0136690 (2015).
  37. Sun, D., Guo, Z., Liu, Y., Zhang, Y. Progress and Prospects of CRISPR/Cas Systems in Insects and Other Arthropods. Frontiers in Physiology. 8, 608 (2017).
  38. Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 9, (5), 98186 (2014).
  39. Kok, F. O., et al. Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish. Developmental Cell. 32, (1), 97-108 (2015).
  40. Morcos, P. A., Vincent, A. C., Moulton, J. D. Gene Editing Versus Morphants. Zebrafish. 12, (5), 319 (2015).
  41. Mehravar, M., Shirazi, A., Nazari, M., Banan, M. Mosaicism in CRISPR/Cas9-mediated genome editing. Developmental Biology. 445, (2), 156-162 (2019).
  42. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  43. Singh, P., Schimenti, J. C., Bolcun-Filas, E. A Mouse Geneticist's Practical Guide to CRISPR Applications. Genetics. 199, (1), 1-15 (2015).
  44. Mianné, J., et al. Analyzing the outcome of CRISPR-aided genome editing in embryos: screening, genotyping and quality control. Methods. 121-122, 68-76 (2017).
  45. van der Emde, G. Encyclopedia of Animal Behavior. Breed, M. D., Moore, J. 1, Academic Press. 16-23 (2010).
  46. Carlson, B. A. Encyclopedia of Neuroscience. Binder, M. D., Hirokawa, N., Windhorst, U., Hirsch, M. C. Springer. 4039-4044 (2009).
  47. Hopkins, C. D. Neruoethology of Electric Communication. Annual Reviews of Neuroscience. 11, 497-535 (1988).
  48. Arnegard, M., Zwickl, D., Lu, Y., Zakon, H. H. Old gene duplication facilitates origin and diversification of an innovative communication system- twice. Proceedings of the National Academy of Sciences of the United States of America. 107, (51), 22172-22177 (2010).
  49. Doench, J. G., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  50. Concordet, J. P., Haeussler, M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Resarch. 46, 242-245 (2018).
  51. Haeussler, M., et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology. 17, (1), 148 (2016).
  52. Kirschbaum, F. Environmental factors control the periodical reproduction of tropical electric fish. Experientia. 31, (10), 1159-1160 (1975).
  53. Iwama, G. K., McGeer, J. C., Pawluk, M. P. The effects of five fish anaesthetics on acid-base balance, hematocrit, cortisol and adrenaline in rainbow trout. Canadian Journal of Zoology. 67, 2065-2073 (1989).
  54. Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th ed. Univ. of Oregon Press. (2000).
  55. Barrangou, R., Doudna, J. A. Applications of CRISPR technologies in research and beyond. Nature Biotechnology. 34, (9), 933-941 (2016).
  56. Adli, M. The CRISPR tool kit for genome editing and beyond. Nature Communications. 9, (1), 1911 (2018).
  57. Maruyama, T., et al. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nature Biotechnology. 33, (5), 538-542 (2015).
  58. Liu, M., et al. Methodologies for Improving HDR Efficiency. Frontiers in Genetics. 9, 691 (2018).
  59. Kirschbaum, F., et al. Intragenus (Campylomormyrus) and intergenus hybrids in mormyrid fish: Physiological and histological investigations of the electric organ ontogeny. Journal of Physiology Paris. 110, 3 Pt B 281-301 (2016).
  60. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Science of the United States of America. 110, (34), 13904-13909 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics