Trasformazione della radice di pomodoro seguita da inoculazione con Ralstonia Solanacearum per un'analisi genetica diretta della malattia batterica di Wilt

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, presentiamo un metodo versatile per la trasformazione della radice di pomodoro seguito da inoculazione con Ralstonia solanacearum per eseguire un'analisi genetica semplice per lo studio della malattia dell'avvizzimento batterico.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum è un devastante patogeno vascolare portato sul suolo che può infettare una vasta gamma di specie vegetali, causando un'importante minaccia per l'agricoltura. Tuttavia, il modello ralstonia è notevolmente sottoesplorato rispetto ad altri modelli che coinvolgono patogeni vegetali batterici, come le siringhe Pseudomonas in Arabidopsis. La ricerca mirata a comprendere l'interazione tra Ralstonia e piante da coltura è essenziale per sviluppare soluzioni sostenibili per combattere le malattie dell'avvistamento batterico, ma è attualmente ostacolata dalla mancanza di semplici analisi sperimentali per caratterizzare i diversi componenti dell'interazione nelle piante ospiti native. In questo scenario, abbiamo sviluppato un metodo per eseguire l'analisi genetica dell'infezione da Ralstonia del pomodoro, un ospite naturale di Ralstonia. Questo metodo si basa sulla trasformazione mediata di radici di pomodoro agrobacterium rhizogenes,seguita dall'inoculazione del suolo ralstonia delle piante risultanti, contenente radici trasformate che esprimono il costrutto di interesse. La versatilità dell'analisi della trasformazione della radice consente di eseguire la sovraespressione genica o il silenziamento genico mediato dall'RNAi. Come prova di concetto, abbiamo usato questo metodo per dimostrare che il silenziamento mediato dall'RNAi di SlCESA6 nelle radici di pomodoro ha conferito resistenza a Ralstonia. Qui, descriviamo questo metodo in dettaglio, consentendo agli approcci genetici di comprendere la malattia dell'avvizzimento batterico in un tempo relativamente breve e con piccoli requisiti di attrezzature e spazio di crescita delle piante.

Introduction

Ralstonia solanacearum, l'agente causale della malattia dell'avvistamento batterico, è un devastante patogeno vascolare del suolo con una distribuzione mondiale che può infettare una vasta gamma di specie vegetali, tra cui patate, pomodoro, tabacco, banana, pepe e melanzane, tra gli altri1,2. Le perdite di rendimento causate da Ralstonia possono raggiungere l'80-90% della produzione di pomodoro, patate o banane, a seconda della cultivar, del clima, del suolo e di altri fattori3. Tuttavia, il modello Ralstonia è notevolmente poco esplorato rispetto ad altri modelli che coinvolgono patogeni vegetali batterici, come Pseudomonas siringae o Xanthomonas spp. Inoltre, la maggior parte degli studi sulle interazioni pianta-microbo si concentra sulla pianta modello Arabidopsis thaliana. Anche se la ricerca che utilizza questi modelli ha ampiamente contribuito alla nostra comprensione delle interazioni piante-batteri, non affrontano l'attuale necessità di comprendere queste interazioni nelle piante da coltura. La ricerca mirata a comprendere l'interazione tra Ralstonia e piante da coltura è essenziale per sviluppare soluzioni sostenibili per combattere le malattie dell'avvistamento batterico, ma è attualmente ostacolata dalla mancanza di semplici analisi sperimentali per caratterizzare i diversi componenti dell'interazione. In particolare, il pomodoro, un ospite naturale per Ralstonia, è la seconda coltura vegetale più importante al mondo ed è colpita da una pletora di malattie4, tra cui la malattia di avvizzimento batterico. In questo lavoro, abbiamo sviluppato un metodo semplice per eseguire l'analisi genetica dell'infezione da Ralstonia del pomodoro. Questo metodo si basa sulla trasformazione mediata agrobacterium rhizogenesdelle radici di pomodoro, utilizzando la fluorescenza DsRed come marcatore di selezione5, seguita dall'inoculazione del suolo di Ralstonia delle piante risultanti, contenente radici trasformate che esprimono il costrutto di interesse. La versatilità dell'analisi della trasformazione della radice consente di eseguire la sovraespressione genica o il silenziamento genico mediato dall'RNAi.

Una potenziale limitazione di questo metodo consiste nella crescita residua di radici non trasformate. Ciò è particolarmente importante nei casi in cui il plasmico usato manca di un gene reporter che consenta la selezione delle radici trasformate. Per risolvere questo problema, abbiamo sviluppato un metodo alternativo basato sulla selezione degli antibiotici, che inibisce la crescita di radici non trasformate, consentendo la crescita di radici trasformate sane resistenti agli antibiotici. Poiché A. i rizogeni non inducono la trasformazione dei germogli, sono suscettibili all'antibiotico e, pertanto, dovrebbero essere tenuti separati dal mezzo contenente antibiotici.

Anche se la resistenza alle piante contro Ralstonia non è ben compresa, diversi rapporti hanno associato alterazioni della parete cellulare a una maggiore resistenza all'appassimento batterico6,7,8,9.9 È stato suggerito che queste alterazioni della parete cellulare influenzano lo sviluppo vascolare, un aspetto essenziale per lo stile di vita di Ralstonia all'interno della pianta10. Le mutazioni nei geni che codificano la cellulosa sintetizzano CESA4, CESA7 e CESA8 in Arabidopsis thaliana hanno dimostrato di compromettere l'integrità della parete cellulare secondaria, causando una maggiore resistenza a Ralstonia, che sembra essere collegato alla segnalazione ABA8. Therefore, as a proof of concept for our method, we performed RNAi-mediated gene silencing of SlCESA6 (Solyc02g072240), a secondary cell-wall cellulose synthase, and ortholog of AtCESA8 (At4g18780). La successiva inoculazione del suolo con Ralstonia ha mostrato che il silenziamento di SlCESA6 ha migliorato la resistenza di SlCESA6 ai sintomi dell'avvizzimento batterico, suggerendo che la resistenza mediata dalla parete cellulare a Ralstonia è probabilmente conservata nel pomodoro e convalidando il nostro metodo per effettuare analisi genetiche della resistenza batterica delle wilt nelle radici del pomodoro. Qui, descriviamo questo metodo in dettaglio, consentendo agli approcci genetici di comprendere la malattia dell'avvizzimento batterico in un tempo relativamente breve e con piccoli requisiti di attrezzature e spazio di crescita delle piante.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTA: Parti importanti di questo metodo riguardano la movimentazione di materiali vegetali in vitro, e quindi è importante mantenere le condizioni sterili durante tutte queste procedure, compresa la visualizzazione della fluorescenza DsRed. Durante tutto il processo di trasformazione, le piantine di pomodoro crescono a 25-28 gradi centigradi e 16 h/8 h luce/scuro (130 fotoni mol m-2s-1 luce). Le piastre sono sigillate con nastro microporo per facilitare lo scambio di gas e la traspirazione.

1. Preparazione di piante di pomodoro e agrobacterium rhizogenes

  1. Sterilizzare i semi di pomodoro (Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) con 5% (v/v) ipoclorito di sodio per 5 min. Lavare 4-5 volte con acqua distillata sterile e mantenere i semi che tremano lentamente in acqua sterile durante la notte per facilitare la germinazione.
  2. Trasferire i semi di pomodoro su mezzi a mezza resistenza Murashige e Skoog (1/2 MS) senza saccarosio (2,21 g/L MS, 8% w/v agar). Mantenere i semi al buio a 25-28 gradi centigradi per tre giorni(Figura 1A).
    NOTA: Per ogni costrutto sono di solito necessari circa 40 semi.
  3. Autoclave 8,5 cm2 fogli filtro quadrati. Posizionare le carte filtro quadrate all'interno di 9 cm2 piatti di petri quadrati contenenti 1/2 MS medio (posizionare la carta sulla parte superiore dell'agar) e posizionare sei semi di pomodoro germinati su ogni piatto (Figura 1B). Sigillare la piastra con il nastro microporo e incubare i semi germinati a 25-28 gradi centigradi per 3-4 giorni.
  4. Coltivare l'Agrobacterium rhizogenes MSU440 in solido LB medio (con antibiotici appropriati) a 28 s C due giorni prima della trasformazione dell'impianto.
    NOTA: A. rhizogenes è fornito dal Dr. Juan Antonio L'pez Rèez, EE-CSIC, Granada, Spagna. Nell'esperimento descritto in questo articolo, sono stati utilizzati A. rhizogenes contenenti pK7GWIWG2_II-RedRoot::CESA6 o un vettore vuoto, come controllo. pK7GWIWG2_II-RedRoot contiene un gene reporter, DsRed, guidato dal promotore dell'Arabidopsis thaliana ubiquitin (pAtUBQ10) e conferisce resistenza alla spettronomina (50 g/mL). È possibile utilizzare altri vettori per la sovraespressione genica, come riportato primadi 5. In questo lavoro, l'amplificazione del frammento specifico per il silenziamento SlCESA6 è stata ottenuta mediante la trascrizione inversa (RT) PCR utilizzando L'RNA isolato dal pomodoro (S. lycopersicum cv. Moneymaker) e migate nel vettore p-ENTR/D-TOPO (Tabella 1). Successivamente, il frammento SlCESA6-RNAi è stato clonato nel vettore binario pK7GWIWG2_II-RedRoot.

2. Trasformazione e selezione delle piante

  1. Utilizzando un bisturi sterile, tagliare il radicle e il fondo dell'ipocotil delle piantine di pomodoro (Figura 1C,D).
  2. Raccogliere la biomassa di A. rhizogenes dalla superficie del mezzo LB utilizzando punte di plastica o una lama del bisturi e immergere con cura le piantine di pomodoro tagliate nella biomassa batterica (Figura 1E).
  3. Dopo l'inoculazione con A. rhizogenes, coprire le piantine di pomodoro con una carta filtrante semi-circolare di 2 cm x 4 cm (Figura 1F), al fine di mantenere un'elevata umidità e facilitare la sopravvivenza e il nuovo sviluppo delle radici.
  4. Conservare le piantine di pomodoro trasformate per 6-7 giorni. Quindi, utilizzare un bisturi sterile per tagliare le nuove radici pelose emergenti (Figura 1G,H; a questo passo, le radici non sono ancora trasformate) e consentire alle piantine di produrre nuove radici pelose.
  5. Una volta che la seconda generazione di nuove radici pelose appaiono (Figura 1I), rimuovere la carta da filtro sulla parte superiore delle piantine, e sigillare la piastra con nastro remarica.
    NOTA: A questo punto, la presenza del marcatore fluorescente DsRed nel vettore di trasformazione consente di visualizzare l'efficienza di trasformazione nelle nuove radici.
  6. Per visualizzare la fluorescenza DsRed, utilizzare uno stereomicroscopio o qualsiasi altra apparecchiatura per l'imaging in vivo dell'impianto (Figura 1J). Contrassegnare le radici trasformate (fluorescenza rossa) positive e rimuovere le radici negative non trasformate (nessuna fluorescenza rossa) utilizzando un bisturi sterile.
  7. Trasferire le piantine che mostrano la fluorescenza rossa su una nuova piastra contenente un mezzo 1/2 MS, al fine di facilitare lo sviluppo della radice trasformata come radice principale (Figura 1K). Mantenere le piantine che non mostrano fluorescenza rossa nella stessa piastra per controllare l'emergere di radici fluorescenti (Figura 1L) nei punti temporali successivi.
  8. Metodo alternativo basato sulla selezione degli antibiotici
    1. Alternativa al passaggio 2.5, preparare piatti quadrati riempiti a metà cm2 contenenti mezzo 1/2 MS con l'antibiotico appropriato. Inclinare le piastre di circa 5 gradi durante il processo di preparazione per generare uno spazio vuoto senza mezzo (Figura 2A ), permettendo ai germoglidicrescere evitando il contatto con l'antibiotico.
    2. Alternativa al passaggio 2.6, dopo aver tagliato le prime radici pelose non trasformate (passaggio 2.4), trasferire le piantine senza radici nelle piastre semipiene utilizzando carta filtrante con le dimensioni appropriate (Figura 2B).
      NOTA: Come controllo positivo, si raccomanda di trasformare diverse piantine con un plasmide contenente la stessa resistenza agli antibiotici e un gene reporter (in questo protocollo, pK7GWIWG2_II-RedRoot; kanamycin 50 g/mL).
    3. In alternativa al passaggio 2.7, lascia che le piantine sviluppino nuove radici pelose e taglino quelle radici che non sono a diretto contatto con la superficie delle carte sandwich del filtro, poiché queste radici possono evitare la selezione antibiotica.
      NOTA: A causa dell'effetto antibiotico, lo sviluppo delle radici può essere più lento rispetto alle piastre senza antibiotici. Nuove radici pelose trasformate appaiono entro 14-18 giorni dopo il trasferimento delle piantine senza radici alle piastre semi-piene (passaggio 2.8.2) (Figura 2C-E).
  9. Coprire le piantine con una carta filtrante semicerchio di 2 cm x 4 cm, sigillare la piastra e incubare le piantine per farle sviluppare nuove radici pelose.
    NOTA: Non è necessario eliminare l'A. rhizogenes usando antibiotici. La carta filtrante sopra il mezzo MS e la mancanza di saccarosio inibiscono la diffusione degli A. rhizogenes sulla piastra5.
  10. Da cinque a sette giorni dopo la prima selezione radice, ripetere il processo di selezione per selezionare nuove radici trasformate e rimuovere le radici non trasformate. Trasferire le piantine contenenti radici trasformate in una nuova piastra contenente un mezzo MS 1/2.

3. Trasferire in vasi di inoculazione

  1. Preparare i vasi di inoculazione dove la superficie delle radici sarà esposta all'inoculum batterico: immergere i vasi di inoculazione con acqua, versare l'acqua in eccesso e metterli in un vassoio di piantagione di plastica. Trasferire le piantine selezionate con radici trasformate in vasi di inoculazione utilizzando una pinzetta (Figura 3A).
  2. Coprire il vassoio con un involucro di plastica o un coperchio trasparente e tenerli a 25-28 gradi centigradi e 65% di umidità (16 h/8 h luce/scuro; 130 fotoni mol m-2s-1 luce), per mantenere un alto livello di umidità Figura 3B). Rimuovere il coperchio dopo cinque o sei giorni.
    NOTA: Le piante di pomodoro trasformate sono pronte per l'inoculazione da due a tre settimane dopo il trasferimento a suolo (Figura 3C). Durante la crescita del suolo, le piante di pomodoro possono produrre nuove radici che non vengono trasformate. Per determinare l'estensione di questo fenomeno, la fluorescenza rossa è stata visualizzata nelle radici delle piante di pomodoro trasformate di 3 settimane. La maggior parte delle radici (80%-100%) ha mostrato fluorescenza rossa, indicando che sono effettivamente trasformati (Figura 3D,E).

4. Inoculazione inzuppata del suolo

  1. Coltivare R. solancearum (ceppo GMI1000 in questo protocollo) in phi mezzo liquido (Tabella 211) in uno shaker orbitale (200 rpm) a 28 gradi centigradi fino alla fase stazionaria.
  2. Determinare i numeri batterici misurando la densità ottica della coltura batterica a 600 nm (OD600). Diluire la coltura batterica con acqua a un OD600 di 0,1 (in condizioni utilizzate qui, questo corrisponde a circa 108 unità formanti colonie [CFU]/mL).
  3. Mettere in un vassoio di inoculazione i vasi di inoculazione di 16-20 contenenti piante di pomodoro trasformate in un vassoio di inoculazione (29 cm x 20 cm; Figura 4A).
  4. Versare nel vassoio contenente i vasi di inoculazione di 300 mL (15 mL per pianta) di inoculo batterico (OD600 di 0,1). Lasciarli in ammollo nell'inoculum per 20 min (Figura 4B).
  5. Preparare un nuovo vassoio con uno strato di terriccio da vaso. Spostate i vasi inoculati nel nuovo vassoio (Figura 4C) e collocate i vassoi in una camera di crescita con un'umidità del 75%, 26-28 gradi centigradi e un fotoperiodo di 12 h luce e 12 h di oscurità (130 - fotoni m-2s-1 luce).

5. Determinazione dei parametri di infezione e analisi statistica

  1. Punteggio sintomi della malattia come descritto in precedenza12,13, utilizzando una scala che va da 0 (nessun sintomo) a 4 (completa appassimento) (Figura 4D-H), ogni giorno dopo l'inoculazione di Ralstonia per due settimane.
    NOTA: i dati dell'indice della malattia vengono raccolti dalla stessa unità sperimentale (ogni pianta) nel tempo.

6. Analisi dell'espressione genica

NOTA: l'espressione del transgene o del silenziamento del gene bersaglio può essere determinata da RT-PCR o da RT-PCR quantitativo (qRT-PCR).

  1. Raccogliere campioni ed estrarre L'RNA da una parte rappresentativa del sistema radicale trasformato (per valutare l'effetto sul gene bersaglio) e foglie (come controllo interno).
  2. Sintetizzare cDNA utilizzando 1 g di RNA totale trattato con DNase.
  3. Analizzare l'espressione genica dei geni bersaglio da qRT-PCR. Calcolare i livelli di trascrizione relativi utilizzando il metodo 2-zCT 14, utilizzando SlEF-1 come gene di pulizia15.
    NOTA: le sequenze di primer sono elencate nella Tabella 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figura 5 mostra lo sviluppo dei sintomi della malattia delle piante di pomodoro con radici trasformate con un vettore vuoto (EV) e di piante con radici trasformate con un costrutto RNAi destinato a SlCESA6 (Solyc02g072240). I dati dell'indice della malattia (Figura 5A) vengono raccolti dalla stessa unità sperimentale (ogni impianto) nel tempo secondo una scala arbitraria da 0 a 4 e non seguono una distribuzione gaussiana, escludendo l'uso di test standard per i dati parametrici. Inoltre, c'è una variazione intrinseca da pianta a pianta in questo tipo di esperimenti, a causa della colonizzazione e delle dinamiche di infezione. Qui di seguito abbiamo considerato diversi metodi per la rappresentazione e l'analisi statistica dei sintomi associati all'infezione da Ralstonia.

Come approccio standard, è stato utilizzato un test non parametrico a due code U Mann-Whitney per confrontare sia le curve di controllo (EV) che di slCESA6-RNAi. In base a questa analisi, la differenza tra i mediani di entrambe le curve sembra non essere significativa (P - 0,16).

È anche possibile quantificare l'area sotto la curva di avanzamento della malattia (AUDPC), che consente di combinare più osservazioni dei progressi della malattia in un unico valore. L'AUDPC ha mostrato un valore più elevato per gli impianti di controllo (EV; 28,75 x 4,75) rispetto agli impianti SlCESA6-RNAi (21,01 x 4,74), indicando che le piante silenziate SlCES6sono più resistenti all'infezione da Ralstonia rispetto agli impianti di controllo (Figura 5B).

Gli intervalli di confidenza (CI) offrono un modo per stimare, con alta probabilità, un intervallo di valori in cui viene trovato il valore della popolazione (o parametro) di una determinata variabile. Come illustrato nella Figura 5C, l'area del 95% CI per il controllo (EV) e le curve di infezione SlCESA6-RNAi stimano una maggiore probabilità di resistenza quando SlCESA6 viene silenziato.

I valori dell'indice della malattia possono essere trasformati in dati binari, considerando un indice della malattia inferiore a 2 corrispondente a "0" e un indice della malattia uguale o superiore a 2 corrispondente a "1"12. Questo permette la rappresentazione di una curva di sopravvivenza dopo l'inoculazione di Ralstonia. Questa trasformazione si basa sull'osservazione che, una volta che le piante iniziano a sviluppare sintomi chiari (indice di malattia di 2), sono considerati come "infetti" e moriranno come conseguenza di questa infezione. Le differenze nel tasso di sopravvivenza tra eV e SlCESA6-RNAi piante non erano statisticamente significative secondo un test statistico Gehan-Breslow-Wilcoxon (P - 0.13) (Figura 5D).

Oltre all'esecuzione di analisi statistiche e, indipendentemente dai valori P ottenuti, vale la pena interpretare questi dati in base alla riproducibilità delle tendenze osservate all'interno di diverse repliche (Figura supplementare 1). In linea con questa nozione, un numero crescente di scienziati ha recentemente commentato i rischi di un uso eccessivo di soglie statistiche rigorose (come lo standard P - 0,05)16.

L'espressione di SlCESA6 è stata analizzata in due radici trasformate selezionate casualmente prima della fase di inoculazione, dimostrando che la maggiore resistenza a Ralstonia è correlata all'espressione ridotta di SlCESA6 (Figura 5E). Utilizzando questo metodo, è possibile ottenere un tasso di trasformazione del 35-40% dopo due cicli di selezione (Figura 5F). Questo valore può essere aumentato eseguendo ulteriori turni di selezione5.

Figure 1
Figura 1: Preparazione, trasformazione e selezione dell'impianto. (A) Germinazione dei semi di pomodoro in mezzi di SM a mezza resistenza (1/2). (B) Semi di pomodoro germinati posti su carta da filtro sdraiati su un piatto contenente mezzo 1/2 MS. Piantine di pomodoro prima (C) e dopo (D) taglio il radicolo e il fondo dell'ipocotil. (E) Trasformazione della piede di pomodoro immergendosi nella biomassa batterica. (F) Piantine di pomodoro trasformate ricoperte di carta da filtro per mantenere l'umidità. Emersione (G) e rimozione (H) di nuove radici pelose (non trasformate). (I) Radici trasformate. (J) Selezione delle radici pelose di pomodoro trasformate mediante la visualizzazione della fluorescenza DsRed. Le frecce rosse indicano radici trasformate positive che esprimono fluorescenza DsRed. (K) Sviluppo delle radici trasformate come radici principali. (L) Visualizzazione della fluorescenza DsRed in radici mature trasformate. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Metodo alternativo basato sulla selezione degli antibiotici. (A) Piastra quadrata mezza riempita contenente mezzo 1/2 MS. (B) Piantine tagliate su carta da filtro che giace su un mezzo 1/2 MS con antibiotico, dopo la rimozione delle prime radici pelose non trasformate. (C) Radici coperte da carta da filtro aggiuntiva. (D) Pomodoro ha trasformato le radici coltivate su un mezzo 1/2 MS con antibiotico. (E) Le piantine trasformate con pK7GWIWG2_II-RedRoot (kanamycin 50 g/mL), che esprimono DsRed, come controllo positivo. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Trasferimento del pomodoro trasformato in vasi di inoculazione. (A) Pomodori trasformati nella radice trasferiti in pentole di inoculazione completamente imbevute. (B) Pomodori trasformati in pentole di inoculazione ricoperte da un coperchio di plastica per mantenere un alto livello di umidità. (C) Pomodori a radice di due-tre settimane, dopo il trasferimento in vasi di inoculazione, pronti per essere inoculati. (D) Le piante di pomodoro di tre settimane dopo la rimozione del suolo. (E) DsRed fluorescenza nelle radici di piante di pomodoro trasformate di 3 settimane. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Inoculazione del suolo-drenching di Ralstonia. (A) Materiali necessari per l'inoculazione di R. solanacearum GMI1000. (B) Drenching del suolo di pomodori trasformati in vasi di inoculazione con R. solanacearum GMI1000 inoculum. (C) Pomodori inoculati posti su uno strato di terriccio da vaso. (D-H) I sintomi della malattia di Ralstonia si adattano da 0 (senza sintomi) a 4 (completa appassimento). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: Il silenziamento SlCESA6 aumenta la resistenza al consolanacearum. (A) Sintomi di malattia di SlCESA6mediati con RNAi - silenziato (CESA6-RNAi) e vettore vuoto (EV) trasformati dalla radice di pomodoro su piante di inoculazione con R. solanacearum. I valori corrispondono ai mezzi : SE di otto piante. (( B) Area sotto la curva di avanzamento della malattia delle piante indicate nel pannello A. (C) 95% di confidenza Intervallo di piante indicate nel pannello A. (D) Percentuale di piante sopravvissute mostrato nel pannello A. (E) Analisi dell'espressione genica da qRT-PCR di SlCESA6-silenziato(CESA6i) e di piante di pomodoro Trasformate dalla radice EV nelle radici (1,2) e riprese (S). I valori corrispondono ai mezzi di tre repliche tecniche di tre repliche tecniche. (F) Tasso di trasformazione delle piante di pomodoro Trasformate nella radice di EV e CESA6-RNAi di due esperimenti indipendenti. I valori corrispondono al mezzo : SE, dopo due cicli di selezione. Fare clic qui per visualizzare una versione più grande di questa figura.

Nome primer Sequenza Primer (5'-3')
EF-1-F GGTGGCGAGCATTTTGA
EF-1-R CGAGCCAACCATGGAAAACACA
qCESA6-F GATCTGGTTCGCTTTCTCGT
qCESA6-R TCCCTCTCTCTCTACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGTTAG
CESA6-RNAi-R TTTGAGACTTGGCACTGGA

Tabella 1: sequenze di primer.

Ingredienti Per 1 L
Bacto peptone 10 g
Estratto di lievito 1 g
Acidi Casamino 1 g

Tabella 2: Phi (sezione) composizione media.

Figura supplementare 1: Riproducibilità del risultato mostrato nella figura 5A. Sintomi di malattia di SlCESA6-silenziatoda RNAi (CESA6-RNAi) e piante di pomodoro trasformate dalla radice di EV al momento dell'inoculazione con R. solanacearum. I valori corrispondono ai mezzi : SE di otto piante. L'analisi dell'espressione genica è stata eseguita da qRT-PCR di slCESA6-silenziate(CESA6i) e EV (Empty Vector) che si trasformano le radici (1,2) e sparano (S). I valori corrispondono ai mezzi di tre repliche tecniche di tre repliche tecniche. Clicca qui per scaricare questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il Ralstonia solanacearum rappresenta una minaccia importante per l'agricoltura; tuttavia, la sua interazione con ospiti naturali di importanza agricola è ancora poco compresa rispetto ad altri patogeni batterici, specialmente nelle specie vegetali delle colture. Nella maggior parte dei casi, l'analisi genetica è ostacolata dal tempo e dalle spese necessarie per modificare geneticamente le piante ospiti. Per risolvere questo problema e facilitare l'analisi genetica dell'infezione da R. solanacearum nel pomodoro, abbiamo sviluppato un metodoFigure 1semplice basato sull'Agrobacterium rhizogenes- trasformazione mediata delle radici di pomodoro ( Figura 1 ), seguito da inoculazione del suolo -drenching (Figura 3). Le radici trasformate vengono selezionate utilizzando un reporter fluorescente (DsRed in questo protocollo) (Figura 1). Inoltre, abbiamo anche sviluppato un metodo alternativo basato sulla selezione degli antibiotici che non danneggi la parte aerea non trasformata (Figura 2).

Il protocollo di trasformazione si basa su quello descritto da Ho-Plàgaro etal. 5, con diverse modifiche. La versatilità di questo metodo consente più saggi aggiuntivi in radici trasformate, come quelle di analizzare la fisiologia vegetale, la risposta ai trattamenti chimici e/o le risposte a diversi stress biotici e abiotici.

Dopo aver trasferito le piante trasformate nel suolo, abbiamo considerato la possibilità che le piante possano sviluppare nuove radici che potrebbero non essere trasformate. Abbiamo esplorato questa possibilità osservando la fluorescenza da DsRed nel sistema radicale delle piante trasformate due settimane dopo averle trasferite nel suolo (prima dell'inoculazione di Ralstonia). I risultati hanno mostrato fluorescenza rossa nella maggior parte delle radici (Figura 3D).

Il trasferimento di T-DNA da parte dell'Agrobacterium è integrato nel genoma ospite in modo casuale e, pertanto, questo metodo genera una popolazione eterogenea di piante di pomodoro con diverso livello di espressione del gene bersaglio. L'infezione da R. solanacearum provoca normalmente la morte delle piante, che, successivamente, ostacola la raccolta di campioni di radici dopo l'esperimento per analizzare l'espressione genica di ogni pianta. Per analizzare il livello di espressione del gene bersaglio durante gli esperimenti, selezioniamo da due a tre piante trasformate dalla radice prima della fase di inoculazione, come campione rappresentativo della popolazione che verrà inoculata. La figura 5 mostra che la riduzione dei sintomi della malattia nelle piante di pomodoro è correlata all'efficienza del silenziamento SlCESA6 prima della fase di inoculazione. Pertanto, e nonostante le limitazioni del protocollo, i nostri risultati rappresentativi dimostrano chiaramente che questo metodo è un potente strumento per studiare i geni candidati coinvolti nella resistenza o nella suscettibilità al R. solanacearum nel pomodoro. The example shown in this article allowed us to determine that knocking-down SlCESA6, a secondary cell wall-related cellulose synthase, enhances resistance to infection by R. solanacearum, resembling previous observations using its ortholog AtCESA8 (At4g18780) from Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Ringraziamo tutti i membri del laboratorio Macho per le discussioni utili, Alvaro Lopez-Garcoa per la consulenza statistica e Xinyu Jian per l'assistenza tecnica e amministrativa durante questo lavoro. Ringraziamo la struttura centrale di PSC Cell Biology per assistenza con l'imaging a fluorescenza Questo lavoro è stato sostenuto dal Programma di Ricerca Sulla Priorità Strategica dell'Accademia Cinese delle Scienze (grant XDB27040204), lo Shanghai Center for Plant Stress Biology (Cinese Academy of Sciences) e il programma cinese 1000 Talents.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics