זיהוי של וירוס הכשל החיסוני האנושי 1 (HIV-1) Antisense חלבון (ASP) תעתיקים בחולים על ידי סטרנד ספציפי-PCR

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

הסיכות ולולאות של RNA יכולות לתפקד כצבעי יסוד לתמלול הפוכה (RT) בהיעדר התחל העצמי הספציפי ברצף, הפרעה למחקר של התעתיקים החופפים של התמלילים. פיתחנו טכניקה מסוגל לזהות את ה-RNA ספציפי סטרנד, ואנחנו השתמשנו בו כדי ללמוד HIV-1 antisense חלבון ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ב retroviruses, שעתוק החושים שתוארו בנגיף החיסוני האנושי סוג 1 (HIV-1) ו-T-lymphotropic וירוס 1 (HTLV-1). ב-HIV -1, החלבון antisense של ASP גן ממוקם על סטרנד שלילי של env, במסגרת הקריאה -2, הפורש את הצומת gp120/gp41. בכיוון ההגיון, הקצה של 3 מסגרת הקריאה של ASP חופף עם V4 של אזורים gp120-משתנים ומספר V5. המחקר של ה-RNA ASP סוכלה על ידי תופעה המכונה RT-self-הטרמה, לפיו מבנים משניים RNA יש את היכולת הממשלה RT בהעדר של פריימר ספציפי, יצירת cDNAs לא ספציפי. השימוש המשולב בשילוב עם כדורי היסוד הפוכים ביולוגית בתגובת RT, יחד עם האהדה לטיהור של cDNA על streptavidin מצופה חרוזים מגנטיים, אפשרה לנו באופן סלקטיבי להגביר את ה-RNA של ASP בתאים CD4 + T נגזר מאנשים נגועים ב-HIV-1. השיטה שלנו היא בעלות נמוכה יחסית, פשוט לבצע, מאוד אמין, ובקלות להיות מתוכדל. במובן זה, הוא מייצג כלי רב עוצמה לחקר שעתוק החושים לא רק ב-HIV-1 אלא גם במערכות ביולוגיות אחרות.

Introduction

החלבון antisense (ASP) הגן הוא מסגרת קריאה פתוחה (ORF) הממוקם על סטרנד שלילי של הנגיף החיסוני האנושי סוג 1 (HIV-1) המעטפה (env) גן, הפורש את הצומת gp120/gp411. במהלך 30 השנים האחרונות, מספר דיווחים הראו כי הגן HIV ASP הוא אכן מועתק ותורגם2,3,4,5,6,7,8,9. למרות התעתיקים של ASP antisense כבר מאופיין באופן מלא בתוך מבחנה, עד לאחרונה מידע על הייצור בפועל של ה-RNA של ASP בחולים עדיין חסר.

הרצף של ASP הוא הפוך ומשלים ל-env. זה מייצג מכשול גדול כאשר מנסים לזהות תעתיקים של ASP. שיטת הפוך סטנדרטית לתגובת שרשרת פולימראז (RT-PCR) שיטות משתמשות גנטית ספציפית אנטי הגיון לסנתז DNAs משלימה (cDNAs) של הקוטביות הימנית. גישה זו, לעומת זאת, אינה מאפשרת לקבוע את הכיוון (תחושה או אנטי-היגיון) של תבנית ה-RNA הראשונית, מכיוון שסיכות או לולאות של RNA יכולות להיות מראש בשני הכיוונים בהעדר התחל10, תופעה הידועה כ-RT-הטרמה עצמית. רוב החוקרים ASP הבעיה של RT הטרמה עצמית באמצעות תחל מתויג עם רצפים שאינם קשורים ל-HIV-111,12. אסטרטגיה זו, עם זאת, אינה מבטלת את התרחשות התופעה, ועלולה לגרום לנשיאה פוטנציאלית של cDNAs שאינו ספציפי ל-PCR11.

פיתחנו לאחרונה הרומן מיוחד סטרנד-PCR שיטת המחקר של RNA antisense ואנחנו השתמשנו בו עבור הזיהוי של ה-RNA ASP בקבוצה של שישה חולים נגועים באיידס, כפי שמוצג בטבלה 1. ההליך המתואר להלן פורסם בעבר על ידי אנטוניו Mancarella ואח '13. בפרוטוקול שלנו, אנו נמנעים מהפקת cDNAs לא ספציפי באמצעות גישה כפולה. ראשית, אנו מסלקים מבנים משניים של RNA על ידי שימוש ב-RNA בטמפרטורה גבוהה (94 ° c), ושנית, אנו הפוכה להפוך את ה-RNA של ASP באמצעות פריימר ביולוגי ברמה של ASP ואהדה-לטהר את התוצאה cDNA. על-ידי גישה זו, אנו מסוגלים להגביר רק את היעד שלנו cdna, מאז מוצרי RT אחרים שאינם ספציפיים מנועים או שנוצר (הטמפרטורה הגבוהה דנטורציה של RNA) או נמחק לפני ה-PCR (טיהור האהדה).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

מחקר זה אושר על ידי מועצת הסקירה המוסדית של אוניברסיטת מרכז אשפוז ודוייס (CHUV).

1. זיהום של דם היקפי תאים ברורים (PBMCs) עם HIV-1HXB2 זן

  1. יום 1: גירוי PBMCs
    1. לבודד PBMCs מעיל באפי תורם בריא.
    2. לספור ולהשעות מחדש PBMCs בריכוז של 1x106/mL בשנת מלאה רוזוול פארק הזיכרון המכון (RPMI) 1640 בינוני המכיל 10% סרום העוברי (fbs) ו 1% פניצילין/סטרפטומיצין (R-10), עם תוספת של 50 U/ml של interleukin-2 (IL-2) ו 3 μg/ml פיטופפניטין (PHA).
    3. Pipet למעלה ולמטה ולפצל את התאים ב 2 6-טוב צלחות (3 מ ל של השעיית תא/טוב).
    4. דגירה עבור 3 ימים ב 37 ° צ' ו 5% CO2.
  2. יום 3: זיהום PBMCs
    הערה: השתמש באחת משתי הלוחיות כמו בשלב 1.1.3 כפקד שלילי (אל תדביק תאים אלה).
    התראה: בצע את ההליך כולו במעבדה III ברמת בטיחות (P3).
    1. PBMCs בריכה מצלחת אחת לתוך שפופרת בז 50 mL וצנטריפוגה ב 300 x g עבור 10 דקות.
    2. להיפטר supernatant ולהשעות מחדש את התאים ב 2.2 mL של R-10 המכיל 20 U/mL של IL-2 ו-2 μg/mL polybrene.
    3. הפשרת מבחנות המכילה את נגיף ה-HIV-1HXB2 ולהוסיף 1.8 mL של השעיה ויראלי (0.376 Ng/μl) אל התאים.
    4. מודרת התאים 2 h ב 37 ° c, בעדינות מתערבל את הצינור כל 30 דקות.
    5. צנטריפוגה את התאים ב 300 x g עבור 10 דקות.
    6. בטל את הסופרנטאנט והשהה מחדש את התאים ב-1x106/ml ב-R-10 המכיל IL-2 (50 U/ml).
    7. העבר את ההשעיה התא לצלחת 24-באר בריכוז של 1 מ ל/ובכן ו דגירה עבור 5 ימים ב 37 ° צ' ו 5% CO2.
    8. קציר 1 גם כל יום ולהעביר את התאים 1.5 mL שפופרת (מתויג עם יום של זיהום).
      הערה: לפני צנטריפוגה, העברת 150 μL של השעיית התא לצינור cy try זרם עבור PBMCs בקרת איכות זיהום (ראה שלב 1.3)
    9. צנטריפוגה את הצינורות ב 400 x g עבור 10 דקות ולהיפטר supernatant.
    10. הקפא את כדורי התא בשעה-80 ° צ' עד השימוש.
  3. זיהום PBMCs: בקרת איכות
    1. עבור כל יום של זיהום, לאסוף 150 μL של הנגועים PBMCs ולהעביר אותם לתוך הצינור cy, לנסות לזרום.
    2. הוסף 1 מ ל של מלוחים מאגור פוספט (PBS) ו צנטריפוגה ב 400 x g עבור 5 דקות.
    3. להיפטר supernatant ולהוסיף 50 μL של PBS המכיל 1 μL של אקווה חיים/צבע מת (בעבר מדולל 1:10 עם PBS).
    4. מודקון ב 4 ° צ' עבור 15 דקות.
    5. הוסף 1 mL של PBS, צנטריפוגה ב 400 x g עבור 5 דקות, ולהיפטר supernatant.
    6. הוסף 250 μL של הפתרון קיבעון/החדירות ו-דגירה של 20 דקות בטמפרטורת החדר בחושך.
    7. להוסיף 1 מ ל של 1x סלסול/לשטוף מאגר (מניות 10x פתרון המכיל הן fbs ו סאפונין מדולל 1:10) ו צנטריפוגה ב 400 x g עבור 5 דקות.
    8. להיפטר supernatant ולהוסיף 50 μL של PBS המכיל HIV מחסום p24 fluorescein isothiocyanate (FITC)-נוגדן מצומדת (מדולל 1:10).
    9. דגירה של 20 דקות בטמפרטורת החדר בחושך.
    10. הוסף 1 mL של PBS, צנטריפוגה ב 400 x g עבור 5 דקות, ולמחוק את supernatant.
    11. הוסף 150 μl של x cellfix (מניות 10x פתרון המכיל 10% פורמלדהיד, 3.55% מתנול, 0.93% נתרן אזיד מדולל 1:10) ולנתח תאים על ידי הזרמת cytometry.

2. גירוי של CD4 + תאים אנושיים עם אנטי CD3/CD28 נוגדנים

  1. בודד CD4 + T תאים מתוך PBMCs של שני חולים נגועים ב-HIV-1 ותורמים בריאים.
  2. להכין אנטי CD3/CD28 נוגדן לערבב על ידי דילול anti-CD3 (1:100) ו anti-CD28 (1:50) ב-PBS.
  3. מעיל 48-צלחת לוח על-ידי הוספת 200 μL של שילוב נוגדן לכל טוב למספר מתאים של בארות ו-דגירה ב 37 ° צ' עבור 2 h.
  4. משף את פתרון הנוגדן ולהוסיף 1 מ"ל של CD4 + T תאים ב-1x106/mL כדי ANTI-CD3/CD28 מצופה נוגדן בארות.
    הערה: להמריץ CD4 + T תאים עד 5 ימים.

3. תמלול הפוך

הערה: כדי להשיג מטופל ספציפי התחל, הספק DNA מבודדים מתאי CD4 + T מכל מטופל היה מוגבר באמצעות HIV-1HXB2 פאן ASP תחל. באמצעות הרצף הפנימי. של התחל הפאן-ASP כל התחל והבדיקות המשמשות במחקר זה מפורטות בטבלה 2.

  1. בידוד ה-RNA הכולל מתאים
    1. לכמת RNA ולחסל זיהום DNA על ידי טיפול בדגימות עם DNase.
    2. בצע תגובות RT באמצעי אחסון של 50 μL. העברה 0.1-1 μg של ה-RNA הכולל למספר מתאים של בארות של הצלחת 96-היטב PCR. הכינו את תערובת ה-RNA על ידי הוספת המרכיבים הבאים ל-RNA:
      5 μL של ביוטילנטי לאחור (20 μM)
      2.5 μL של דיאוקסינוקלאוטיד triphosphates (dNTPs) (10 ממ)
      25 μL של דיאטילפירוקרבונט (מתחת למים)-מטופלים מזוקקים (dH2O).
      הכינו את הפקדים האנדוגניים על ידי הוספת 5 μL של nuclease-מים ללא תשלום במקום פריימר הפוכה ASP ביולוגי.
    3. מניחים את הצלחת 96 היטב ה-PCR לתוך הציקלונינר וחום תערובת RNA ל 94 ° צ' עבור 5 דקות.
    4. מיד לצנן את תערובת RNA במים קר לפחות 1 דקות.
    5. הכינו את תערובת הריאקציה על ידי הוספת הרכיבים הבאים לצינור 1.5 mL (חשב את המספר הכולל של דגימות ועוד 1):
      10 μL של מאגר של 5x RT
      2.5 μL של 0.1 M של 1, 4-dithioitol (DTT)
      2.5 μL של RNase out (40 יחידות/μL)
      2.5 μL של אנזים RT (200 יחידות/μL)
    6. העברת 17.5 μL של תערובת זו לכל אחת מבארות המכילות RNA. הכינו את הבקרות האחרות המחליפים את ההמרה הפוכה עם 2.5 μL של מים ללא השכרה.
    7. מערבבים בעדינות את הצלחת ב 55 ° c עבור 60 דקות באמצעות הציקלייט.
    8. הפוך את התגובות על ידי חימום ב 70 ° c עבור 15 דקות.

4. טיהור אהדה של cDNA של ASP ביולוגיים

הערה: לא לטהר את התגובות RT-מינוס.

  1. להכין 1 L של 2x כביסה/כריכה מאגר המכיל 10 מ"מ-HCl (pH 7.5), 1 מ"מ מדיום חומצה (EDTA) ו 2 M הנאל. סנן את הפתרון.
    1. הכן 50 mL של מאגר כביסה/איגוד של 1x באמצעות מים בכיתות PCR.
    2. עבור כל תגובה, להשתמש 10 μL של חרוזים מגנטיים streptavidin מעלה. בהתבסס על מספר התגובות, להעביר נפח מתאים של חרוזים לצינור 1.5 mL.
    3. שטוף את החרוזים על ידי הוספת נפח שווה של מאגר כביסה/כריכה של 2x ו מערבולת עבור 15 s.
    4. מניחים את הצינור לתוך מתלה הפרדה מגנטית ו דגירה עבור 3 דקות בטמפרטורת החדר.
    5. הסר בזהירות את supernatant מבלי להפריע את החרוזים ולהוסיף את אותו נפח של כביסה/כריכת מאגר 2x כאמצעי האחסון הראשוני של חרוזים.
    6. מערבולת עבור 30 s ולהעביר 10 μL של הבולם חרוזים למספר מתאים של 1.5 mL.
    7. מניחים את הצינורות במתלה הפרדה מגנטית ו דגירה עבור 3 דקות בטמפרטורת החדר.
    8. מחק את הסופרנטאנט והוסף 50 μL של מאגר כביסה/כריכה של 2x.
    9. הוסף 50 μL של cDNA biotinylated לצינורות המתאימים המכילים את החרוזים.
    10. דגירה של 30 דקות בטמפרטורת החדר מסתובבת בעדינות.
    11. הפרד את החרוזים מן הסופרנטנט על ידי מתלה הפרדה מגנט עבור 3 דקות בטמפרטורת החדר.
    12. שטוף את החרוזים על ידי הוספת 200 μL של מאגר כביסה/כריכה של 1x. מניחים את הצינורות בארון הפרדה של מגנט במשך 3 דקות בטמפרטורת החדר וזורקים את הסופרנטאנט. . אני חוזר פעמיים
    13. השהה מחדש את החרוזים ב -10 μL של מים בכיתות PCR.

5. התקן PCR

הערה: מטרת ה-PCR הסטנדרטי היא להגביר את כל ה-ORF של הגן של ASP. מוצרי הגברה לאחר מכן משובטת לתוך pCR 2.1 פלאמיד כדי לפתח עקומות סטנדרטיות עבור כימות ASP RNA על ידי PCR בזמן אמת (ראה הפסקה בזמן אמת PCR).

  1. בצע בדיקות סטנדרטי בנפח כולל של 50 μL. הכן נפח מתאים של התמהיל הראשי של ה-PCR (מספר הדגימות ועוד 1). עבור כל דוגמה, הוסף את הרכיבים הבאים לשפופרת 1.5 mL:
    1 μL של 10 שירותי התחל ASP (קדימה ואחורה)
    1 μL של 10 ממ מ מסוג Dntps
    מגנזיום כלוריד (MgCl2) (ריכוז תלוי בשימוש התחל)
    dH2O לנפח הסופי של 49 μl
    1. מערבבים היטב, במהירות לסובב את התוכן ולהעביר 49 μL/טוב של התמהיל הראשי של ה-PCR לצלחת 96-היטב PCR.
    2. בזהירות מערבולת צינורות המכילים את החרוזים המשמשים עבור האהדה של ASP cDNA לטיהור עבור 15 s.
    3. הוסף 1 μL של חרוזים לתוך הבארות המתאימות ולהפעיל את ה-PCR באמצעות התוכנית הבאה: 95 ° c עבור 2 דקות, 40 מחזורים של 95 ° צ' עבור 30 s, 55 ° c עבור 30, ו 68 ° צ' עבור 40 s, אז 68 ° c עבור 7 דקות.
    4. הפרד בין מוצרי ה-PCR ל-1% מעלה ג'ל, חותכים את הלהקות ומשובטים את המוצרים המגבונים לתוך pCR 2.1 פלמיד.
    5. רצף ולנתח את הרצפים של כל שיבוט.

6. בזמן אמת כמותי PCR (qPCR)

הערה: פיתוח תחל וזונדים ספציפיים למטופלים באמצעות הגישה המתוארת בשלב 3 "תמלול הפוך". עבור התקני qPCR כוללים הדלקות של ASP בעקומות סטנדרטיות. פלמידים המכילים מוסיף מטופלים ספציפיים מפותחים כאמור בהערה בתחילת שלב 5 "ה-PCR הסטנדרטי".

  1. הכן את העקומה הסטנדרטית באמצעות 1:10 מדלל סדרתי של ASP, החל מ -3 x 106 עותקים/μl עד 3 עותקים/μl.
    1. הסיבוב הראשון PCR (pre-amp). לבצע תגובות בנפח כולל של 25 μL. הכנת נפח מתאים של התמהיל הראשי של ה-PCR (מספר דגימות ועוד 1). עבור כל דוגמה, הוסף את הרכיבים הבאים לשפופרת 1.5 mL:
      0.5 μl של שילוב של ASP או של עטפה פריימר (ריכוז סופי 0.2 μm כל אחד) (קדימה ואחורה)
      0.5 μL של שילוב dNTPs (ריכוז סופי 0.2 mM כל אחד)
      MgCl2 (הריכוז תלוי בזוגות הפריימר)
      dH2O עד כמות אחרונה של 24 μl
    2. העבר 24 μL של שילוב מאסטר של ה-PCR למספר מתאים של בארות של לוחית ה-PCR ב96.
    3. מערבולת בזהירות את הצינורות המכילים את החרוזים עם cDNA עבור 15 s.
    4. הוסף 1 μL של חרוזים לבארות המתאימות. עשה את אותו הדבר. לדילול הפלזמה
    5. הפעל את ה-PCR באמצעות האלגוריתם הבא: דנטורציה עבור 2 דקות ב-95 ° צ'; 30 s ב 95 ° צ', 30 s ב 55 ° צ', 40 s ב 68 ° c עבור 18 מחזורים; הארכה ב 68 ° c עבור 7 דקות.
    6. לדלל את הסיבוב הראשון בדיקות תגובות 1:5 עם המים PCR כיתה.
    7. . הסיבוב השני של ה-pcr לבצע תגובות בנפח כולל של 20 μL. הכנת נפח מתאים של התמהיל הראשי של ה-PCR (מספר דגימות ועוד 1). עבור כל דוגמה, הוסף את הרכיבים הבאים לשפופרת 1.5 mL:
      1.8 μL 10 מיקרומטר (קדימה ואחורה)
      1 μL of בדיקה של 5 μM
      6.2 μL של dH2O
    8. העברה 19 μL של מיקס מאסטר qPCR לתוך מספר מתאים של בארות של 96-ובכן qPCR לוחית ולהוסיף 1 μL של התגובות ה-PCR העגול הראשון מדולל לבארות המקביל. עשה את אותו הדבר. עבור הדילול הפלסטי
    9. הפעל את ה-qPCR עם האלגוריתם הבא: דנטורציה עבור 10 דקות ב-95 ° צ'; 15 ס ב 95 ° c, 1 דקות ב 60 ° צ' עבור 40 מחזורים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

טמפ גבוהה רנ א מצמידים לטיהור אהדה של cDNA biotinylated מונע הגברה של מוצרי ASP שאינם ספציפיים במהלך ה-PCR ב-PBMCs נגוע מבחנה בתאי CD4 + T מבודדים מהחולים. RT הטרמה עצמית הוכח להתרחש במהלך שעתוק לאחור של antisense rnas10,14,15,16,17. כדי למנוע תופעה זו, פיתחנו גישה מקורית באמצעות הטכניקה שתוארה במקור על ידי השוד ואח '10. ההליך שלנו כרוך בטמפרטורה גבוהה הדנטורציה של ה-RNA לפני RT ושימוש בצבעי היסוד biotinylated לבצע RT, ואחריו אהדה-טיהור של cDNAs ביולוגי על streptavidin מצופה חרוזים מגנטיים13. CDNAs המתקבל על ידי שיטה זו ניתן להשתמש עבור יישומי במטה, כולל ה-PCR הסטנדרטי או qPCR.

התנאים הניסיוניים עבור שעתוק antisense נבדקו לראשונה ב PBMCs מתורם בריא אחד נגוע בתוך מבחנה עם HIV-1HXB2, רצף הייחוס עבור HIV-1 תת-סוג B (כל המטופלים שלנו נגועים בבודד של סוג משנה זה). טבלה 2 מראה את רצפי התחל והבדיקות המשמשות במחקר זה. תגובות ה-RT הראשונית שלנו נעשו באמצעות שימוש רגיל, לא biotinylated antisense (ASP R1) והביא את הגברה מוצלחת של ASP (הזוג ASP F1-R1 פריימר) (איור 1A, נתיבים 1-3). עם זאת, על ידי גישה זו, אנו גם הוגדל להקה של אותו משקל מולקולרי בתחל-מינוס בקרת תגובות RT (נתיבים 4-6). חוסר האות המלא בפקדים השליליים שלנו (נתיבים 7-8) הצביע על כך שהתבנית הלא ספציפית הגיעה מתגובת ה-RT ולא מזיהום של דגימות.

כדי לעקוף את הבעיה שנוצרה על ידי הטרמה עצמית, החלטנו להשתמש בשיטה שתוארה בעבר על ידי haist et al.10, שבו המתאר הספציפי האנטי הגיוני מתויג עם ביוטין כך התוצאה המתקבלת cdna המקבילה לכיוון antisense ניתן לטהר לפני ה-PCR ו הוגדל סלקטיבי. על-ידי גישה זו, הצלחנו להגביר את רצף ה-ASP (איור 1B, נתיבים 1-3) עם זיהום מופחת מאוד מן cdna לא ספציפי בקרת פריימר-מינוס (איור 1b, נתיבים 4-6).

אופטימיזציה של שיטה זו הושגה על ידי דנטורציה מלאה של ה-RNA לפני RT ב 94 ° c, ואחריו קירור מיידי על מי קר. כפי שמוצג באיור 2א, B, להקת ASP מוגברת באופן יעיל, בעוד שהמוצרים הלא ספציפיים נעלמו.

ב -RNA מזוהה בתאי CD4 + T מחולים עם וויראמיה לזיהוי ובהעדר טיפול, בעקבות גירוי עם anti-CD3/CD28. ה-RNA של ASP היה בלתי ניתן לזיהוי בתאי PBMCs או בלתי ממריצים CD4 + T תאים מבודדים מ-HIV חולים (נתונים לא מוצגים). עם זאת, זה יכול להיות מזוהה בקלות CD4 תאים מבודדים שלושה HIV-חיוביים נושאים, MP135, MP140, ו MP148 (שולחן 1), בעקבות גירוי עם אנטי CD3/CD28. קינטיקה של ביטוי ה-RNA של ASP שנמדד על ידי qPCR בשלושת המטופלים האלה מוצגים באיור 3.

CD4 תאים מבודדים מהחולים שעברו אמנות עם viraemia לא ניתן לזיהוי, עשוי לייצר כמויות קטנות של ה-RNA של ASP כאשר מגורה עם anti-CD3/CD28. קוונפיקציה של הרמות ASP RNA בשני החולים האלה (MP071, MP146) על ידי qPCR מראה כי בתנאים הללו ה-RNA של ASP מזוהה ברמות נמוכות (10-15 עותקים/מיליון CD4 + T תאים) ב 3-5 ימים לאחר גירוי (איור 4). בחולה אחד עם זאת (MP069), לא ניתן להבחין ב-RNA ASP בכל נקודת זמן (נתונים לא מוצגים).

ASP ו-עטפה rnas יש דפוסי ביטוי דומים בחולה אחד שאינו מטופל עם גילוי ויסמיה (MP140). שני חולים נותחו, אחד לא מטופל (MP140) ואחד טיפל (MP146). ב MP140 אנחנו יכולים לזהות גם ASP ו-env. למרות רמות שעתוק שלהם היו שונים (איור 5A), עקומת הביטוי של שני גנים אלה לאורך זמן היה זהה, אשר יכול להיות דמיינו התוויית נתונים בקנה מידה לוגריתמי (איור 5a). בחולה MP146, אשר טופל ושיוראמיה היה מתחת לרמות של גילוי, ASP ו-עטפה היו בקושי לזיהוי ורק לאחר כמה ימים של גירוי (איור 5c).

Figure 1
איור 1: ביטוי של ה-RNA של ASP ב PBMCs מאדם אחד שלילי HIV נגוע במבחנה עם hiv-1HXB2 על ידי תקן שונה RT-PCR. (א) גילוי של ה-RNA של ASP באמצעות RT-PCR סטנדרטי. ASP הוא מוגבר מ-cDNA מסונתז בנוכחות של ASP לא biotinylated אנטי ההיגיון הייחודי של asp R1 (נתיבים 1 – 3). אותה להקה מצוי גם ב פריימר-פחות שולטת RT (נתיבים 4 – 6). (ב) ויזואליזציה של ה-RNA של ASP על ידי ביוקטילציה של הפריימר אנטי-סנס וטיהור cdna (נתיבים 1-3). להקה של עוצמה מצומצמת מזוהה עדיין בבקרה פריימר-מינוס (נתיבים 4 – 6). לא קיימים להקות בפקדים שליליים. פורסם בעבר במאמר "זיהוי של חלבון antisense (ASP) התעתיקים של אנשים הנגועים בווירוס החיסוני האנושי סוג 1 (HIV-1)", על ידי Mancarella et al.13 (J Gen virol 100 (5): 863-876. דוי: 10.1099/jgv. 0.001244). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: ה-RNA של ASP מתבטא ב-PMBCs של אדם אחד שלילי HIV לאחר זיהום עם HIV-1HXB2. (א) הלהקה ASP הוא זיהה בקלות RNA אשר כבר מלאה לחלוטין והפוך לאחור באמצעות בדיקת RT ביולוגית (ASP R1) (נתיבים 1 – 3) אך לא מטוהרים cdna מ פריימר-מינוס בקרות (נתיבים 4 – 6). (ב) אין אות המתאים ל-ASP מזוהה בפקדים RT-מינוס של RNA מ pbmcs נגוע, לא נגוע pbmcs או מים, למרות הלהקה ברורה גלוי בקרת מחסום חיובי מ-ACH-2 תאים. פורסם בעבר במאמר "זיהוי של חלבון antisense (ASP) התעתיקים של אנשים הנגועים בווירוס החיסוני האנושי סוג 1 (HIV-1)", על ידי Mancarella et al.13 (J Gen virol 100 (5): 863-876. דוי: 10.1099/jgv. 0.001244). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: בתאי anti-CD3/CD28-מגורה CD4 + T תאים מבודדים משלושה חולים לא מטופלים, ייצור ה-RNA של ASP הוא לזיהוי ופסגות בין יום 2 ו 4 לאחר גירוי. ב-MP135 ו-MP140, הביטוי של ASP מגיע ביום 4 לאחר גירוי, ואילו בMP148 הוא הגיע לשיאו ביום 2. רמות ASP מבוטאים כמו העתקים RNA/מיליון CD4 + T תאים. הנקודות בקורס הזמן מתאימות לערך הממוצע של תגובות ה-PCR. פורסם בעבר במאמר "זיהוי של חלבון antisense (ASP) התעתיקים של אנשים הנגועים בווירוס החיסוני האנושי סוג 1 (HIV-1)", על ידי Mancarella et al.13 (J Gen virol 100 (5): 863-876. דוי: 10.1099/jgv. 0.001244). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: בשני חולים aviremic שעברו אמנות, ASP הוא בקושי ניתן לזיהוי רק אחרי כמה ימים של גירוי. בשני המטופלים שלנו, לא ניתן לזהות את ASP ביום 0. ב-החולה MP071, רמות נמוכות של ASP ניתן לזהות ביום 3, בעוד החולה MP146, היינו צריכים לחכות עד היום 5 כדי לראות כמה רמות של RNA. רמות ASP מבוטאים כמו העתקים RNA/מיליון CD4 + T תאים. הנקודות בקורס הזמן מתאימות לערך הממוצע של תגובות ה-PCR. פורסם בעבר במאמר "זיהוי של חלבון antisense (ASP) התעתיקים של אנשים הנגועים בווירוס החיסוני האנושי סוג 1 (HIV-1)", על ידי Mancarella et al.13 (J Gen virol 100 (5): 863-876. דוי: 10.1099/jgv. 0.001244). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: ביטוי של ASP ו-עטפה ב anti-CD3/CD28-גירוי CD4 + T תאים מטופלים (MP146) ו מטופלים (MP140) חולים. (א) בחולה ללא טיפול (MP140), עטפה מתבטא ברמות גבוהות יותר מ-ASP; (ב) אותם נתונים המותווים בסרגל לוגריתמי מראים כי ביטוי ASP ו-עטפה מאופיין בפרופיל דומה מעבר לזמן; (ג) ביטוי קינטיקה של ASP ו-עטפה בחולה אחד עם וויראמיה בלתי ניתנת לגילוי ושעברו אמנות (MP146). פורסם בעבר במאמר "זיהוי של חלבון antisense (ASP) התעתיקים של אנשים הנגועים בווירוס החיסוני האנושי סוג 1 (HIV-1)", על ידי Mancarella et al.13 (J Gen virol 100 (5): 863-876. דוי: 10.1099/jgv. 0.001244). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

מזהה מטופל גיל סקס שלב הידבקות באיידס קלייד עומסים ויראלי (עותקים/ml) CD4 Count (תאים/μl) מעמד האמנות
MP135 44 M C3 B 1.6 x105 176 טופל
MP140 23 M A2 B 3.6 x104 427 טופל
MP148 37 M A1 B 2.0 x104 717 טופל
MP069 42 M A1 B < 20 1309 טופלו
MP071 47 M C3 B < 20 167 טופלו
MP146 59 M C3 B < 20 385 טופלו

טבלה 1: תכונות של מטופלים. פורסם בעבר במאמר "זיהוי של חלבון antisense (ASP) התעתיקים של אנשים הנגועים בווירוס החיסוני האנושי סוג 1 (HIV-1)", על ידי Mancarella et al.13 (J Gen virol 100 (5): 863-876. דוי: 10.1099/jgv. 0.001244).

פריימר/שם בדיקה תחל רצף (5 עד 3)
ASP F1 מיכל האור
ASP R1 GAACCCAAGGAACAAAGCTC
פאן ASP F מיכל שגיא
פאן ASP R בדיקת מגנשית
ASP MP135, 146, 071 F מיכל הכהן
ASP MP135, 146, 071 R מיכאל
ASP MP135, 146, 071 בדיקה משפחה/טמרה מרכז ה, מדריך כמוסות
ASP MP140 F כמוסות מגנט
ASP MP140 R מיכל הכהן
ASP MP140 בדיקה משפחה/טמרה מיכל שטנוב
ASP MP148 F מוטי מ, שלמה
ASP MP148 R מיכל מורג
ASP MP148 בדיקה משפחה/טמרה מוזיאון האחים הגותי
ENV MP140 F מיכל הכהן
ENV MP140 R כמוסות מגנט
ENV MP140 בדיקה משפחה/טמרה מיכל שטנוב
ENV MP146 F מיכאל
ENV MP146 R מיכל הכהן
ENV MP146 בדיקה משפחה/טמרה מרכז ה, מדריך כמוסות

שולחן 2: התחל-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

בדוח זה אנו מתארים שיטת ה-RT הספציפית לסטרנד המוחלת על איתור RNA של ASP בתאים CD4 + T מבודדים מאנשים שנדבקו ב-HIV-1. התרחשות של הטרמה לא ספציפית במהלך RT הסלים את הזיהוי של התעתיקים RNA עם הקוטביות הימנית, המוביל וטעה של התוצאות. הקבוצות הקודמות פיתחו מספר אסטרטגיות שמטרתן למנוע סינתזה בלתי תלויה cDNA במהלך התגובה RT. תיוג בהילוך הפוך על 3 ' סוף עם רצפים שאינם קשורים HIV הוכיחה יעיל להשגת הגברה ספציפית סטרנד6,8,9. עם זאת, גישה זו רק מאפשר להפוך את הבלתי מוגדר באופן כוזב לגילוי DNA ולא כדי למנוע את זה, עם הסיכון של זה דולף לתוך תגובת ה-PCR, גרימת הגברה של מוצרי DNA לא ספציפיים (כלומר, עטפה במקום ASP).

ה-RT הראשונית שלנו מנסה לזהות את ה-RNA של ASP בוצעו באמצעות פריימר רגיל נגד חוש. הגברה הצליחה, כאשר הצלחנו להשיג להקות של המשקל המולקולרי הנכון, אך להקות באותו גודל היו גם הן בשלט התחל-מינוס. בהתבסס על התוצאות הללו, השתמשנו בגישה שונה, ביצוע RT עם התחל אנטי הגיוני מסוים ביולוגי, כפי שמתואר על ידי Haist ואח '.10. למרות הניסויים הראשוניים שלנו הביא ירידה דרסטית של הטרמה עצמית RT, לא יכולנו להסיר לחלוטין מוצרים לא ספציפיים של הגברה. הייג ועמיתים לעבודה מסלקים מוצרים לא ספציפיים של cDNA על ידי שטיפת החרוזים בתנאים הגבוהים ביותר10. בשיטה שלנו, הסרנו לחלוטין את המקור של הטרמה עצמית בצורה של מבנים משניים RNA באמצעות טמפרטורות דנטורציה גבוהה כדי לאפשר שימוש מלא בתבנית rna.

אנו מראים כי ASP RNA מתבטא anti-CD3/CD28-מגורה CD4 + T לימפוציטים. עם זאת, זיהוי של ASP אינו ניתן להשגה בתאים בהעדר גירוי. הנתונים שלנו הם שונים במקצת מאלה של זפאטה ועמיתים לעבודה, אשר דיווחו על הביטוי של רמות נמוכות של ASP במנוחה CD4 + תאים מבודדים מהחולים שעברו אמנות9. בהתבסס על התוצאות הללו, הם מציעים כי ASP RNA עשוי לשחק תפקיד בוויסות השהיית ה-HIV. הממצא שלנו באותו הפרט הקינטיקה של הביטוי של ASP ו-עטפה מאופיינים באותו פרופיל לא עקבי עם דגם של זפאטה9. למעשה, אם באמת ASP היה מעורב בוויסות ההשהיה, פרופיל הביטוי שלו צריך להיות הפוך לאחד שנצפה עבור עטפה18.

הבחנו גם שרמות התמלול של עטפה הן מעל 2 יומני רישום גבוהים יותר מאלה של ASP, לפחות אצל חולים בהעדר טיפול. נתונים אלה הם בהסכמה עם מחקרים על ידי לורדור ואח '8 המראים כי בתאים CD4 + העיקרי נגוע מבחנה, 3 ' שעתוק משמאל לימין והחושים הוא הרבה יותר נמוך (עד 1000-קיפול) מאשר 5 ' שעתוק ההיגיון. התוצאות שלנו מצביעות על כך ASP מתבטאת CD4 לימפוציטים נגועים ללא קשר לשלב של המחלה כל עוד תאים מגורה כראוי. בנוסף, הנתונים שלנו מדגימים כי ASP מתבטא בתאים מחולים שעברו טיפול באמנות, אם כי רמת הביטוי בתאים אלה נמוכה יותר מאשר בתאים מחולים בהעדר טיפול.

לסיכום, אנו ממליצים על שיטת ה-RT אמין-מיוחד המיועד למנוע סינתזה של cDNA בלתי תלוי. ASP ו-עטפה הם שני גנים אשר חופפים זה לזה בכיוון הפוך, תכונה שהופכת את המחקר שלהם מאוד מאתגר. הגישה שלנו, אשר מאפשר באופן סלקטיבי לכידת cDNAs הרטרושועתק מ-RNA עם קוטביות שלילית וחיובית, מייצג כלי אופטימלי ויעיל למחקר של שני גנים אלה בפרט, וגנים חופפים ההיגיון שלהם אוריינטציה באופן כללי.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים שאין ניגודי אינטרסים.

Acknowledgments

אנו מודים לפטריזיה אמגליו, אלסנדרה נוואל, קרייג פנוויק, ומתיו פרברו, שתמיד יהיו זמינים לדון בעבודתנו ובכל האנשים במעבדת האיידס Immunopathogenesis לסיוע הטכני היקר שלהם. אנחנו גם רוצים להודות לג ואהרון וודל מ VSB המשויכים Inc. שתרמו עם יצירות אמנות מעולה. לבסוף, תודות מיוחדות רבות לכל המטופלים, מבלי שהעבודה הזאת לא הייתה אפשרית. עבודה זו לא קיבלה כל מענק ספציפי משום סוכנות מימון.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics