Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Zellspezifische Analyse doi: 10.3791/4214 Published: October 4, 2012

Summary

Verfahren zur Herstellung

Abstract

Nach der Initiierung des Blattes Primordium wird Biomasseakkumulation hauptsächlich durch die Zellproliferation und die Expansion in den Blättern 1 gesteuert. Jedoch ist die Arabidopsis Blatt ein komplexes Organ aus vielen verschiedenen Zelltypen und mehrere Strukturen. Gleichzeitig enthält das wachsende Blattzellen in verschiedenen Stadien der Entwicklung, die mit den Zellen am weitesten von der Blattstiel die erste zu stoppen Expandieren und durchlaufen ein Seneszenz. Verschiedene Zellen innerhalb des Blattes werden daher Dividieren, Verlängern oder Unterscheidungswert ist, wirksamen, gespannten oder tot, und / oder als Reaktion auf Reize in Teilsätze von ihren zellulären Typs zu einem bestimmten Zeitpunkt. Dies macht genomische Untersuchung des Blattes herausfordernden: zum Beispiel bei der Analyse Expressionsdaten aus ganzen Blättern, Signale von genetischen Netze in unterschiedlichen Zonen oder zellulären Antwort Zelltypen verwechselt werden, was zu einer ungenauen Profil erzeugt wird.

Um dieses Problem anzugehen, sehrere Methoden beschrieben worden, die es ermöglichen Studien von zellspezifischen Genexpression. Hierzu gehören Laser-Mikrodissektion (LCM) 2 oder GFP exprimierenden Pflanzen für Protoplasten und folgenden fluoreszenzaktivierten Zellsortierung (FACS) 3,4, das vor kurzem beschriebene INTACT System für nukleare Niederschlag 5 und Immunpräzipitation von Polysomen 6 verwendet.

FACS wurde erfolgreich für eine Reihe von Studien, einschließlich zeigt, dass die Cell-Identität und Entfernung von der Wurzelspitze eine signifikante Wirkung auf die Expression Profilen einer Vielzahl von Genen 3,7 aufwies. FACS von GFP-Linien sind auch verwendet worden, um zellspezifische Transkriptionsregulation während Wurzel Stickstoff Antworten und seitlichen Wurzelentwicklung 8, Salzstress 9 Auxin Verteilung in der Wurzel 10 zu demonstrieren und einen Genexpression Karte der Arabidopsis Sprossapikalmeristem 11 zu erstellen. ObwohlFACS benutzt worden ist, um Arabidopsis Blatt abgeleitet Protoplasten auf 12,13 Autofluoreszenz zu sortieren, hat bisher die Verwendung von FACS auf Arabidopsis-Linien, die GFP in den Blättern sehr begrenzt 4. In dem folgenden Protokoll beschreiben wir ein Verfahren zur Gewinnung von Arabidopsis Blattprotoplasten, die kompatibel sind mit FACS wobei gleichzeitig die Auswirkungen des Protoplasten Generation Regimes. Wir demonstrieren die Methode mit dem KC464 Arabidopsis-Linie, die ausdrückliche GFP in der adaxialen Epidermis 14, KC274 Linie, die ausdrückliche GFP in das Gefäßgewebe 14 und dem TP382 Arabidopsis-Linie, die Ausdruck einer doppelten GFP zu einer Kernlokalisierungssignal in Zusammenhang Konstrukt die Schließzellen (Daten nicht gezeigt; Abbildung 2). Wir sind derzeit mit dieser Methode sowohl Zelltyp-spezifische Expression während der Entwicklung und Stress, sowie heterogene Zellpopulationen in verschiedenen Phasen der Seneszenz zu studieren.

Protocol

Ein. Protoplasten-Generation

  1. Ernte Blattmaterial und schneiden Sie in 1 mm breite Streifen (Abbildung 1) mit einer Rasierklinge. Für Proben, die mehr als ein einzelnes Blatt bis zu 15 Blätter leicht vor dem Schneiden gestapelt werden.
  2. Sofortüberweisung Blatt Streifen in einen 9 cm Runde Petrischale mit 20 ml Lösung A (400 mM Mannitol, 20 mM MES Hydrat, 20 mM KCl, 10 mM CaCl 2, 2 mM MgCl 2, 0,1% BSA und 2,5 mM β-Mercaptoethanol, pH 5,7) einschließlich protoplasting Enzymen (1,2% Cellulose R-10, 0,6% Cellulose und 0,4% RS Macerozym R-10) und RNase-Inhibitoren und transkriptionelle (1 × ProtectRNA und 10 ug / ml Actinomycin D); sanft trennen die blatt Streifen und Vakuum zu infiltrieren für 2 × 5 min.
  3. Ort Petrischale auf einem Orbitalschüttler auf 90 rpm bei Raumtemperatur und Protoplasten für 3-4 Std.
    1. Während der Inkubation werden die Streifen sollten Blatt voneinander getrennt werden, unter Verwendung von aSatz von flachen Pinzette, um halb Stundentakt.
  4. Legen Sie eine 70 um Zellsieb (Fisher Scientific) in einem 50 ml-Tube und schonend filtern protoplasting Lösung durch. Dies entfernt die blatt Streifen, die durch das Sieb zurückgehalten werden, während es den Protoplasten zu durchlaufen wird.
  5. Waschen Sie die Blätter Streifen mit 4 ml Lösung A und sanft Filter durch dasselbe Sieb.
  6. Übertragen Sie die Protoplasten in Rundbodengefäße und zentrifugieren Sie die Protoplasten Lösung bei 300 xg für 5 min zur Pelletierung der Protoplasten.
  7. Sanft absaugen so viel von der Überstand wie möglich, ohne die Protoplasten.
  8. Waschen Protoplasten mit 5 ml Lösung A und Zentrifuge bei 300 × g für 5 min. Überstand entfernen
  9. Resuspendieren der Protoplasten in einem geeigneten Volumen der Lösung A unter Verwendung einer Pasteur-Pipette oder eines abgeschnittenen Spitze P1000.

2. FACS von Blattprotoplasten

  • Unmittelbar vor Sortierung, resuspendieren Protoplasten unter Verwendung eines (nicht geschnitten) P1000 Spitze um Protoplasten Verklumpen zu vermeiden.
  • Übertragen Protoplasten zu einer Sortiermaschine Röhre durch ein 50 um Filcon Filter (BD Biosciences) und verdünnter gegebenenfalls zur Vermeidung von Verstopfungen der Düse des Zellsorters. Die Protoplasten werden unter Verwendung eines sortierten Düse 100 um bei einem Druck von 20 psi (Hülle) und 21 bis 21,5 psi (Probe), einer Frequenz von 39,2 kHz und einer Ereignisrate von <4000 (diese Einstellungen sind optimal auf einem BD Influx Zellsortierer (BD Biosciences). Optimierung auf andere Zelle Sortiermaschinen müssen Anpassungen an diesen Einstellungen).
  • GFP-positive Protoplasten werden anhand einer 488 nm Argon-Laser und Plotten der Ausgabe von dem 580/30 Bandpass-Filter (orange) gegenüber dem 530/40 Bandpass-Filter (grün). GFP-positive Protoplasten werden im hohen 530/low 580 Bevölkerung, mit nicht-GFP Protoplasten im Low 530/580 niedrig Bevölkerung und tot / sterbenden Protoplasten und Schutt in die hohe 580 PopulationenVerordnung (Abbildung 2).
    1. Beim Sortieren von Protoplasten aus dem RNA extrahiert werden soll, sollte Protoplasten direkt in mindestens 4 Volumen eines Lysepuffers enthaltend ein Reduktionsmittel (z. B. β-Mercaptoethanol) aufgelöst werden. Darüber hinaus sollte die Art Zeit eines einzigen Probe auf 20-30 min und einem maximalen von zwei bis drei Proben zu einem beliebigen Zeitpunkt verarbeitet begrenzt.
    2. Zur Visualisierung von sortierten Protoplasten, sollte die Protoplasten direkt in wenigstens 8 Volumen der Lösung A und anschließend durch Zentrifugation gesammelt, um die Protoplasten zu konzentrieren sortiert werden.
  • 3. Repräsentative Ergebnisse

    Dieses Protokoll beschreibt ein Verfahren zur Gewinnung von Protoplasten aus Arabidopsis Blätter, die für fluoreszenzaktivierten Zellsortierung (Abbildung 1) verwendet werden. Protoplast Generation in Gegenwart von RNase und Transkriptions-Inhibitoren verhindert die Zellen from Montieren eines transkriptionellen Reaktion. Das hat auch zur Folge, was zu zahlreichen Toten und Sterbenden Protoplasten, die ein erhebliches Maß an Autofluoreszenz haben. Beim Sortieren der Protoplasten mit diesem Verfahren hergestellt ist es daher sehr häufig mehrere verschiedene Populationen in Graphen der 580 nm vs 530 nm Fluoreszenz für die Sortierung verwendet sehen. Beispiele hierfür zusammen mit den Sortierweichen in diesem Protokoll verwendet, sind in Abbildung 3 dargestellt.

    Protoplasten können in 8 Volumen der Lösung A sortiert und gesammelt zur Visualisierung, um die Anreicherung zu verifizieren. 2G zeigt ein Beispiel für diese Verwendung der TP382-Linie, die GFP exprimiert in den Schließzellen.

    Beispiele erzielten Ausbeuten unter Verwendung dieses Verfahrens, sowohl vor als auch nach der Verstärkung, sind in Tabelle 1 gezeigt. Die erhaltenen Mengen sind ausreichend für die Amplifikation unter Verwendung Ovation Pico WTA System (500 pg-50 ng) und daher subsequent Analyse entweder durch qPCR (Abbildung 4), Next Generation Sequencing oder Mikroarray.

    Abbildung 1
    Abbildung 1. Insgesamt Workflow für das Experiment. 1) Ernte Blätter von Interesse von einer GFP-exprimierenden Arabidopsis Linie. 2) Schnell in ~ 1 mm breite Streifen geschnitten und sofort übertragen diese in protoplasting Lösung und Vakuum zu infiltrieren. 3) für 3-4 Stunden inkubieren. 4) vorsichtig Filtrat Protoplasten Lösung durch einen 70 um-Sieb, Transfer zum unteren Rohre und Pellet Protoplasten durch Zentrifugation abzurunden. 5) Unmittelbar vor Sortierung, resuspendieren Protoplasten und Transfer zu einem Sortier-Rohr durch ein 50 um-Filter. 6) Sortieren GFP positiven und negativen GFP lebensfähige Protoplasten. 7) Die Protoplasten können nun entweder visuell analysiert werden oder unter Verwendung von Techniken wie qPCR nächsten Generation Sequenzierung oder Mikroarray.


    Abbildung 2. Die KC464, KC274 und TP382 Linien in dieser Studie verwendet. A) Transversalschnitt einer KC464 Blatt mit GFP-Expression in der adaxialen Epidermis. B) Die Protoplasten aus Blättern KC464 abgeleitet. C) Transversalschnitt einer KC274 Blatt mit GFP-Expression in dem Gefäßsystem. D) Die Protoplasten aus Blättern KC274 abgeleitet. E) TP382 Blatt mit GFP-Expression in den Schließzellen. F) Protoplasten aus Blättern TP382 abgeleitet. G) Beispiel der Anreicherung durch FACS von GFP exprimierenden Schließzellen im Komplex Hintergrund Blattzellen, zeigt GFP enthaltenden Protoplasten aus der hohen 530/low 580 Population von Protoplasten aus Blättern TP382 gewonnen wird. AF: Konfokalmikroskop Bilder; G: Fluoreszenzmikroskop Bild. Maßstabsbalken in Bilder 50 um.

    Abbildung 3
    Abbildung 3. Typische FACS-Dot-Plots Übernahme des Ausgangssignals aus den 580/30 nm (Orange) vs 530/40 nm (grün) Bandpassfiltern (BD Influx Zellsortierer). Die Sortier-Toren gezeigt, sind die in der Regel bei der Sortierung verwendet. A) Dot Grundstück von Col-4 Blatt abgeleitet Protoplasten, in Abwesenheit von Inhibitoren protoplasted, zeigt eine einzige niedrige 530/low 580 Bevölkerung. B) Dot-Plot von wt Col-4 Blatt-, Wurzel-Protoplasten in Gegenwart von Inhibitoren protoplasted, das eine Verschiebung in der 580-Fluoreszenz aufgrund von Stress und Färbung durch die Inhibitoren. CE) Dot Plots aus Blatt-, Wurzel Protoplasten aus den KC74, und KC464 TP382 Linien, die jeweils in Gegenwart von Inhibitoren protoplasted, zeigt den GFP enthaltenden Populationen im hohen 530/low 580 Populationen. Die Prozentsätze der Ereignisse in den GFP (high 530/low 580) Populationen gegeben sind. Klicken Sie hier, um größere Zahl anzuzeigen .

    e_content "fo: keep-together.within-page =" always "> Abbildung 4
    Abbildung 4. GFP-Expression in den repräsentativen Population gated Fraktionen wie in Abbildung 3 dargestellt. Zwei biologischen repliziert wurden für jede Fraktion Typs erhalten wird, amplifiziert unter Verwendung der Ovation Pico WTA System und qPCR mit GFP-spezifische Primer (Tabelle 2) wurde dann durchgeführt. Die angegebenen Werte sind die höchsten (rot), am niedrigsten (grün) und die durchschnittliche relative Werte. Die hohe Population 580 war in diesem Fall zweigeteilt, niedrige und hohe 530/low 580 530/low 580, für die eine einzige biologische Replikation so verwendet wurde nur der einzelnen Wert dargestellt ist. ACT2 (At3g18780) wurde als Standard für alle Proben verwendet. Blatt: Whole Blatt. Unsorted: Unsorted Protoplasten. GFP1: hohe 530/low 580 und REST1: niedrig 530/low 580, GFP2: hohe 530/high 580 und REST2: niedrig 530/high 580, wie in Abbildung 3 und des Einsatzes beschrieben. Die Ergebnisse sind eine Verifikation of optische Beurteilung der GFP Zellinhalt in der sortierten Fraktionen (zB 2G). Klicken Sie hier für eine größere Abbildung zu sehen .

    Probe Anzahl der Blätter Anzahl der Zellen RNA-Ausbeute
    (Ng)
    RNA-Ausbeute
    (Verstärkt; ng)
    Ganze Blatt A
    Ganze Blatt B
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Unsorted Protoplasten A
    Unsorted Protoplasten B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 A
    REST1 A
    15 6039 (0,39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    REST1 B
    15 10.783 (0,63% *)
    57.040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    REST2
    15 18.337 (1,49% *)
    62.405 (73,49% *)
    - **
    - **
    360
    411

    Tabelle 1. Proben gesammelt mittels FACS analysiert und mit qPCR zu bestimmen, welche Fraktion enthielt Live GFP-exprimierenden Protoplasten. Auch in dieser Tabelle nicht enthalten ist die gesamte RNA-Ausbeute in ng vor und nach der Verstärkung mit dem Ovation Pico WTA System (NuGen). GFP1, GFP2, REST1 und REST2 Fraktionen werden wie in dem Einsatz in 4 gezeigt. * Der Prozentsatz an Zellen der Gesamtzellzahl Sortierlauf wird in Klammern neben der Anzahl der Zellen in der Fraktion gegeben. Diese Prozentzahlen sind nicht zu korrelierendeneinander für jede Probe die FACS sortiert wird für 'Rest' Fraktionen wurden früher als GFP Fraktionen aufgrund der viel größeren Anzahl von Rest-Zellen gesammelt gestoppt. ** 50 ng als Input für Amplifikationsreaktionen verwendet, gemäß dem Protokoll des Herstellers.

    Grundierung Folge
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tabelle 2. QPCR Primer.

    Discussion

    Wir haben ein Verfahren, das die Verwendung von Arabidopsis-Pflanzen, die GFP in den Blättern für Protoplasten und folgenden Zellsortierung mittels FACS ermöglicht beschrieben. Diese Methode führt zu ausreichenden Mengen an RNA zur Amplifikation und somit die anschließende Analyse durch entweder qPCR oder Mikroarray verwendet werden. Die Fraktionen sortiert werden besonders für GFP-haltigen Zellen, wie durch qPCR (Abbildung 2) nachgewiesen angereichert.

    Um hohe Ausbeuten von Live-Protoplasten zu erreichen ist es wichtig, schnell zu arbeiten, während der ersten Schritte des Verfahrens, bis das Blatt Streifen gewesen Vakuum mit dem Inhibitor-haltigen Protoplasten Lösung infiltriert. Darüber hinaus bei der Erzeugung 1 mm Blatt Streifen ist es sehr wichtig zu schneiden oder schneiden Sie die Blätter anstatt "Chop" oder zerdrücken, da dies führt zu einer übermäßigen Schäden und damit einem niedrigeren Protoplasten Ausbeute.

    Ein entscheidender Unterschied zwischen dem hier beschriebenen Verfahren und andere Published Methoden ist die Verwendung von RNase-Inhibitoren und Transkriptions-Inhibitoren. Die meisten Methoden sind für Arabidopsis Wurzeln, aus denen Protoplasten leichter erzeugt werden können entwickelt. Bei der Arbeit mit Blättern, mit Ausnahme Mesophyll, ist es notwendig, die Protoplasten Generationszeit erhöhen. Daher ist es wichtig, diese Inhibitoren umfassen, gegen Veränderungen in der Genexpression als Ergebnis des Protoplasten Generation Behandlung selbst (Daten nicht gezeigt) zu schützen. Allerdings führt die Anwesenheit der Inhibitoren zu einer Unfähigkeit, eine Transkriptions-Reaktion montieren, entweder durch Umschalten Gene an-oder ausgeschaltet, die wahrscheinlich machen die Protoplasten anfälliger ist, da dies zu einem Verlust der Plastizität mit denen die Belastungen des Zählers protoplasting Prozedur.

    Wir haben die hier beschriebenen Verfahren erfolgreich mit einer Anzahl der GFP-exprimierenden Arabidopsis-Linien verwendet. Wichtig ist, dass wir diese Methode mit GFP exprimieren GFP entweder stark in verwendetder Kern, oder viel schwächer in einer cytosolischen non-localized/diffuse Weise, wie es der Fall mit den KC464 und KC274 Linien hier verwendet. Beide Arten von Leitungen sind mit dem Verfahren und ergeben hoch angereicherten Fraktionen von GFP-exprimierenden Protoplasten (Abbildung 2 und 3). Das Verfahren kann leicht auf andere Fluorophore angepasst werden, obwohl das Fluorophor für die Fluoreszenz, die signifikant verschieden von der Autofluoreszenz von tot / sterbenden Zellen, um die Fähigkeit, lebende Zellen auszuwählen bewahren ausgewählt werden muss.

    Disclosures

    Keine Interessenskonflikte erklärt.

    Acknowledgments

    Die Arbeit in der Buchanan-Wollaston Labor auf Zelltyp, Entwicklungsstadium spezifische Profilierung wird durch die AGRON-omics Projekt (Grant # LSHG-CT-2006 bis 037.704) in der 6. Rahmenprogramm der EU der Europäischen Kommission unterstützt. Die Arbeit in der Gifford Labor auf Zelltyp-spezifische Profilierung wird durch eine BBSRC New Investigator Grant (BB/H019502/1) unterstützt.

    Die KC274 und KC464 Arabidopsis-Linien wurden aus AAR Webb (University of Cambridge) erhalten.

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Zellspezifische Analyse<em&gt; Arabidopsis</em&gt; Blätter mit Fluorescence Activated Cell Sorting
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter