Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

ניתוח ספציפי של תא doi: 10.3791/4214 Published: October 4, 2012

Summary

שיטה להפקה

Abstract

לאחר תחילת primordium העלה, הצטברות ביומסה נשלטת בעיקר על ידי תרבות של תאים והתרחבות העלים 1. עם זאת, עלה ארבידופסיס הוא איבר מורכב מורכבים מסוגים רבים ושונים של תאים וכמה מבנים. במקביל, עלה הגידול מכיל תאים בשלבים שונים של פיתוח, עם תאים הרחוקים מהפטוטרת להיות הראשון לעצור את ההרחבה ולעבור הזדקנות 1. תאים שונים בתוך העלה, אפוא, חלוקה, מאריכים או מבדל; פעיל, לחוץ או מת; ו / או להגיב לגירויים בתת קבוצות של הסוג הסלולרי שלהם בכל זמן נתון. זה עושה את המחקר הגנומי של מאתגר עלה: למשל בעת ניתוח נתוני ביטוי מעלים שלמים, אותות מרשתות גנטיות הפועלות באזורים ברורים סלולריים תגובה או סוגי תאים יהיה מבולבל, וכתוצאה מפרופיל מדויק שנוצר.

לכתובת זו, שלשיטות everal כבר תאר המאפשרות לימודים של ביטוי גני התא ספציפי. אלה כוללים microdissection ליזר לכידה (LCM) 2 או צמחים המבטאים GFP משמשים למיון לאחר פלואורסצנטי הופעל תא (FACS) 3,4, המערכת השלמה שתוארה לאחרונה למשקעים גרעיניים 5 ו immunoprecipitation של 6 polysomes הדור וprotoplast.

FACS שמש בהצלחה במשך מספר מחקרים, כולל ההצגה שזהות התא והמרחק מקצה השורש הייתה השפעה משמעותית על פרופילי הביטוי של מספר רב של גנים 3,7. FACS של קווי GFP יש גם שמש כדי להדגים בקרת שעתוק תא ספציפי בתגובות חנקן שורש ופיתוח לרוחב שורש 8, מתח מלח הפצת אוקסין 9 בשורש 10 וליצור מפה של ביטוי גני meristem הקודקוד לירות ארבידופסיס 11. למרותFACS יש בעבר נהג למיין protoplasts נגזר העלה ארבידופסיס מבוסס על autofluorescence 12,13, עד כה השימוש בFACS על קווי ארבידופסיס מבטאים GFP בעלים כבר מאוד מוגבל 4. בפרוטוקול הבא אנו מתארים שיטה לקבלת protoplasts העלה ארבידופסיס התואמים FACS תוך מזעור ההשפעה של משטר דור protoplast. אנחנו מדגימים את השיטה באמצעות קו ארבידופסיס KC464, שמביע GFP באפידרמיס adaxial 14, KC274 הקו, אשר מביעים GFP ברקמת כלי הדם 14 וקו ארבידופסיס TP382, שמבטא GFP כפול לבנות צמוד לאות לוקליזציה גרעינית ב את תאי שמירה (מידע לא מוצג; איור 2). כרגע אנחנו משתמשים בשיטה זו כדי ללמוד גם ביטוי תא מסוג מסוים במהלך פיתוח ומתח, כמו גם אוכלוסיות תאים הטרוגניים בשלבים שונים של הזדקנות.

Protocol

1. Protoplast הדור

  1. חומרי קציר עלים ולחתוך לרצועות ברוחב 1 מ"מ (איור 1) עם סכין גילוח. לדגימות המכילות יותר מעלים עד 15 עלים בודדים יכולות להיערם בקלות לפני החיתוך.
  2. מייד להעביר רצועות עלים לתוך צלחת פטרי עגולה 9 סנטימטר המכיל 20 מיליליטר פתרון (400 המ"מ מניטול, מימה 20 מ"מ MES, 20 המ"מ KCl, 10 mM CaCl 2, 2 המ"מ MgCl 2, 0.1% BSA ו2.5 מ"מ β-mercaptoethanol, pH 5.7) כולל אנזימי protoplasting (צלולוזת R-10, 0.6% התאיים RS ו 0.4% macerozyme R-10 1.2%) וRNase ומעכבי תעתיק (1 × ProtectRNA ו10 מיקרוגרם / המ"ל actinomycin D); עדינות להפריד את העלים ורצועות ואקום לחדור ל2 × 5 דקות.
  3. צלחת פטרי מקום בהקפה ייקרה להגדיר עד 90 סל"ד בטמפרטורת חדר וprotoplast עבור שעות 3-4.
    1. במהלך הדגירה את רצועות עלים צריכות להיות מופרדות אחד מהשני, על ידי שימוש בסט של פינצטה השטוחה, במחצית מרווחים לפי השעה.
  4. הנח 70 מיקרומטר תא מסננת (הפישר סיינטיפיק) בצינור מ"ל 50 ועדינות לסנן פתרון protoplasting דרך. הפעולה זו תסיר את רצועות עלים, שתישארנה בידי המסננת ובמקביל לאפשר את protoplasts לעבור.
  5. שוטף את רצועות עלים עם 4 פתרון מ"ל ועדינות מסנן דרך אותה המסננת.
  6. העבירו את protoplasts לתוך צינורות תחתונים עגולים וחובצה את פתרון protoplast ב 300 XG למשך 5 דקות לגלולה את protoplasts.
  7. בעדינות לשאוב אותו במידה של supernatant ככל האפשר מבלי להפריע לprotoplasts.
  8. שטוף את protoplasts עם פתרון 5 מ"ל וצנטריפוגה XG ב 300 למשך 5 דקות. הסרת supernatant
  9. Resuspend את protoplasts בנפח מתאים לפתרון, באמצעות פיפטה פסטר או טיפ P1000 חתך.

2. FACS של Protoplasts עלים

  • מייד לפני המיון, resuspend את protoplasts באמצעות (ללא חתך) P1000 קצה להימנע protoplasts clumping יחד.
  • העברת protoplasts לצינור מיון 50 מיקרומטר filcon מסנן (BD Biosciences) ולדלל מתאימים כדי למנוע סתימת הנחיר של סדרן התא. את protoplasts מסודר באמצעות פיית מיקרומטר 100 בלחץ של 20 אטמוספרות (נדן) ו21-21.5 psi (מדגם), בתדר של 39.2 קילוהרץ ושיעור אירועים של <4000 (הגדרות אלה הן אופטימליות על סדרן תא זרם BD . אופטימיזציה (BD Biosciences) על מכונות מיון תא אחרות ייתכן שתצטרך התאמות להגדרות אלה).
  • protoplasts החיובי GFP מזוהה באמצעות 488 ננומטר ארגון ליזר והתוויית הפלט מ580 / 30 bandpass המסנן (כתום) לעומת מסנן bandpass 530/40 (ירוק). protoplasts החיובי GFP יהיה ב580 אוכלוסיית 530/low הגבוהה, עם protoplasts הלא GFP ב580 אוכלוסייה 530 הנמוכות / נמוכה ומת / protoplasts הגוסס ופסולת בגובה 580 popuרח (איור 2).
    1. בעת מיון protoplasts שממנו יהיה חילוץ רנ"א, protoplasts יש למיין ישירות לתוך לפחות 4 כרכים של חיץ תמוגה מכיל סוכן צמצום (למשל β-mercaptoethanol). בנוסף, בפעם הסוג של מדגם יחיד צריכה להיות מוגבלת ל20-30 דקות, ועד למקסימום של 2-3 דגימות מעובד בכל זמן נתון.
    2. להדמיה של protoplasts הממוין, את protoplasts יש למיין ישירות לתוך לפחות 8 כרכים של פתרון ושנאסף לאחר מכן על ידי צנטריפוגה לרכז את protoplasts.
  • 3. נציג תוצאות

    פרוטוקול זה מתאר שיטה לקבלת protoplasts מעלי ארבידופסיס, המשמשים למיון תא הופעל פלואורסצנטי (איור 1). דור Protoplast בנוכחות RNase ומעכבי תעתיק מונע f התאיםrom הרכבת תגובת תעתיק. זה עושה לי תוצאה מהוליד רב protoplasts המת והגוסס, אשר יש רמה משמעותית של autofluorescence. כשממיין את protoplasts הוכן בשיטה זו לכן זה מאוד נפוץ לראות כמה אוכלוסיות שונות בגרפים של 580 ננומטר לעומת קרינת ננומטר 530 שמש למיון. דוגמאות לכך, יחד עם שערי המיון השתמשו בפרוטוקול זה מוצגות באיור 3.

    Protoplasts ניתן למיין ל8 כרכים של פתרון ונאסף להדמיה כדי לאמת את ההעשרה. האיור 2G מראה דוגמה לכך באמצעות קו TP382, המבטא GFP בתאי השמירה.

    דוגמאות לתשואות שהשיגו בשיטה זו, היא לפני והן אחרי ההגברה, מוצגים בטבלת 1. הסכומים שהתקבלו מספיקים להגברת שימוש במערכת Ovation פיק WTA (500 pg-50 ng) ולכן זה ניתוח ubsequent ידי אחד qPCR (איור 4), רצף הדור הבא או microarray.

    איור 1
    איור 1. עבודה כוללת לניסוי. 1) הקציר מותיר ריבית מלהביע GFP קו ארבידופסיס. 2) לחתוך במהירות לתוך ~ 1 רצועות רחבות מ"מ ולהעביר באופן מיידי את אלה לפתרון והוואקום protoplasting לחדור. 3) דגירה עבור שעות 3-4. 4) בעדינות פתרון תסנין protoplast דרך מסנן מיקרומטר 70, להעביר לעגל צינורות תחתונים וprotoplasts גלולה ידי צנטריפוגה. 5) מייד לפני המיון, protoplasts resuspend והעברה לצינור מיון דרך 50 מיקרומטר מסנן. 6) protoplasts קיימא שלילי GFP מיין GFP חיובי ו. 7) Protoplasts כעת ניתן לנתח אם באופן חזותי או באמצעות טכניקות כגון qPCR, רצף הדור הבא או microarray.

    together.within עמודים = "תמיד"> איור 2
    איור 2. את KC464, KC274 וTP382 הקווים השתמשו במחקר זה. א) סעיף רוחבי של KC464 עלה מראה ביטוי של GFP באפידרמיס adaxial. B) Protoplasts נגזר מKC464 עלים. ג) סעיף רוחבי של KC274 עלה מראה ביטוי של GFP בכלי הדם. ד) Protoplasts נגזר מKC274 עלים. E) עלה TP382 מראה ביטוי של GFP בתאי השמירה. F) Protoplasts נגזר מTP382 עלים. ז) דוגמה להעשרה הושגה על ידי FACS של GFP להביע תאי שמירה ברקע המורכב של תאי עלים, מראה GFP המכיל protoplasts מ580 אוכלוסיית 530/low הגבוהה של protoplasts נגזר מTP382 עלים. AF: תמונות confocal מיקרוסקופ; G: תמונת מיקרוסקופ פלואורסצנטי. ברי קנה מידה בתוך תמונות הם 50 מיקרומטר.

    איור 3
    איור 3. FACS חלקות נקודת רכישה אופייניות של הפלט מ580 / 30 ננומטר (כתום) לעומת ננומטר 530/40 (ירוק) מסנני bandpass (סדרן תא זרם BD). את שערי המיון המוצג הם אלה משמשות בדרך כלל במיון. א) עלילת דוט של Col-4 protoplasts עלים נגזרים, protoplasted בהיעדר מעכבים, מראה 580 אוכלוסיית 530/low יחידה ונמוכה. B) עלילת דוט מWT protoplasts Col-4 עלים נגזר, protoplasted בנוכחות מעכבים, מראה שינוי ב580 פלואורסצנטי בשל לחץ וצביעה על ידי המעכבים. הספירה) דוט חלקות protoplasts נגזר עלים מKC74, KC464 וTP382 קווים, בהתאמה, protoplasted בנוכחות מעכבים, מראים GFP המכיל אוכלוסיות ב530/low הגבוה 580 אוכלוסיות. את האחוזים של האירועים בGFP (הגבוה 530/low 580) אוכלוסיות נתונים. לחץ כאן לצפייה בדמות גדולה.

    e_content "fo: לשמור-together.within עמודים =" תמיד "> איור 4
    איור 4. ביטוי של GFP בשברי האוכלוסייה המגודרים היציגים כפי שמוצג באיור 3. שתיים ביולוגיים משכפל התקבלו לכל סוג חלקיק, מוגבר באמצעות Ovation פיק WTA המערכת וqPCR באמצעות פריימרים ספציפיים GFP (טבלה 2) אז בוצע. ערכים המוצגים הם (אדום) את הערכים הגבוהים ביותר, הנמוכים ביותר (ירוק) וממוצע יחסית. 580 האוכלוסייה הגבוהה הייתה במקרה זה נחצה לשניים, נמוך 530/low 580 ו530/low גבוה 580, שללשכפל ביולוגי יחיד היה בשימוש, כך שרק הערך היחיד שהיא מוצגת. Act2 (At3g18780) שמש כתקן עבור כל המדגמים. עלים: כל עלה. לא ממוין: protoplasts לא ממוין. GFP1: 530/low גבוה 580 וRest1: 530/low הנמוך 580, GFP2: 530/high הגבוה 580 וRest2: 530/high הנמוך 580, כפי שמתואר באיור 3 והוספה. התוצאות הן אימות of הערכות אופטיות של תוכן תא ה-GFP בשברים הממוינים (למשל 2G איור). לחצו כאן לצפייה בדמות גדולה.

    מדגם מספר עלים מספר תאים RNA תשואה
    (נ"ג)
    RNA תשואה
    (מוגבר; ng)
    עלה שלם
    B עלה השלם
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    protoplasts לא ממוין
    B protoplasts Unsorted
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1
    Rest1
    15 6039 (0.39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10783 (0.63% *)
    57040 (7.49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18337 (1.49% *)
    62405 (73.49% *)
    - **
    - **
    360
    411

    לוח 1. דוגמאות שנאספו ונותחו בעזרת FACS עם qPCR כדי לקבוע איזה חלק הכיל protoplasts החי GFP להביע-. כמו כן, נכללת בטבלה זו היא מוחלטת תשואת RNA בng לפני ואחרי ההגברה עם Ovation פיק WTA המערכת (NuGEN). GFP1, GFP2, Rest1 וRest2 שברים כמוצגים בעלון באיור 4. * אחוז מהתאים של טווח סוג התא הכולל ניתן בסוגריים ליד מספר התאים בשבריר. אחוזים אלה אינם קשורים לאחד את השני לכל דגימה כסוג FACS פועל לשברים "לנוח" נעצרו מוקדם יותר לשברי GFP עקב המספר הגדול בהרבה של תאי מנוחה שנאספו. ** 50 ng משמש כקלט להגברת תגובות, לפי הפרוטוקול של היצרן.

    תחל רצף
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    לוח 2. פריימרים qPCR.

    Discussion

    כבר תארנו שיטה המאפשרת שימוש בצמחי ארבידופסיס מבטאים GFP את העלים לדור protoplast ומיון התא הבא באמצעות FACS. שיטה זו מניבה כמויות מספיקות של רנ"א שישמש להגברה ולכן לאחר ניתוח על ידי אחד או qPCR microarray. השברים הממוינים מועשרים לתאי GFP המכיל, כפי שהוכיחו qPCR (איור 2).

    כדי להשיג תשואות גבוהות של protoplasts חיות זה הוא קריטי לעבודה במהירות במהלך השלבים הראשונים של התהליך, עד שרצועות העלים היו ואקום הסתנן עם פתרון protoplast מעכב המכיל. בנוסף, בעת יצירת רצועות עלי 1 מ"מ זה מאוד חשוב לחתוך או לחתוך את העלים ולא "צ'ופ" או לכתוש אותן, כפי שזה מוביל לפגיעה מוגזמת ובכך תשואת protoplast נמוכה יותר.

    הבדל קריטי בין השיטה המתוארת כאן וpublishe האחרשיטות d היא השימוש במעכבי RNase ומעכבי תעתיק. רוב השיטות שפותחו לשורשי ארבידופסיס, שממנו ניתן להפיק protoplasts בקלות רבה יותר. עם זאת, כשעובד עם עלים, למעט mesophyll, יש צורך להגדיל את זמן דור protoplast. לכן חשוב לכלול מעכבים אלה כדי להגן מפני שינויים בביטוי גנים כתוצאה מטיפול protoplast הדור עוצמה (מידע לא מוצג). עם זאת, נוכחותם של המעכבים מובילה לחוסר יכולת לפתח תגובת שעתוק, או על ידי החלפת גנים או לבטל, העשוי להפוך את protoplasts פגיע יותר כמו זה מוביל לאובדן הגמישות שבה כדי לאזן את הלחצים של protoplasting הליך.

    יש לנו להשתמש בשיטה המתוארת כאן בהצלחה עם מספר GFP-לבטא קווי ארבידופסיס. חשוב מכך, יש לנו להשתמש בשיטה זו עם קווי GFP להביע GFP באופן חזק בהגרעין, או הרבה יותר חלש באופן cytosolic non-localized/diffuse, כפי שקורה עם KC464 וKC274 קווים המשמשים כאן. שני הסוגים של קווים תואמים את השיטה ואת תשואת שברים מועשרים ברמה גבוהה של protoplasts GFP להביע-(איור 2 ו 3). השיטה יכולה להתאים בקלות לfluorophores האחר, אם כי יש לבחור fluorophore לניאון שהוא שונה באופן משמעותי מautofluorescence של תאים מתים / למות כדי לשמר את היכולת לבחור בתאים חיים.

    Disclosures

    אין ניגודי האינטרסים הכריזו.

    Acknowledgments

    לעבוד ביוקנן-ולאסטון המעבדה על תאים מסוג מסוים והתפתחותי פרופיל במה נתמכת על ידי אגרון-OMICS הפרויקט (מענק # LSHG-CT-2006-037704) במסגרת Progamme 6 שנים לנציבות האירופיות. העבודה במעבדת גיפורד באפיון ספציפי של תאים מהסוג נתמכת על ידי BBSRC ניו חוקר מענק (BB/H019502/1).

    את KC274 וKC464 קווי ארבידופסיס התקבלו מAAR ווב (אוניברסיטת קיימברידג').

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    ניתוח ספציפי של תא<em&gt; ארבידופסיס</em&gt; עלים באמצעות מיון תא הופעל פלואורסצנטי
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter