Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Сотовые конкретного анализа doi: 10.3791/4214 Published: October 4, 2012

Summary

Способ получения

Protocol

1. Протопластов поколения

  1. Урожай материала листьев и нарезать шириной 1 мм полосы (рис. 1) с лезвием бритвы. Для образцов, содержащих более одного листа до 15 листьев может быть легко сложены перед нарезкой.
  2. Немедленно передать листа полос, на 9 см круглой чашки Петри, содержащую 20 мл раствора (400 мМ маннит, 20 мМ MES гидрат, 20 мМ KCl, 10 мМ CaCl 2, 2 мМ MgCl 2, 0,1% BSA и 2,5 мМ β-меркаптоэтанол, рН 5,7) в том числе protoplasting ферментов (1,2% целлюлозы R-10, 0,6% целлюлозы RS и 0,4% macerozyme R-10) и РНКазы и транскрипционной ингибиторов (1 × ProtectRNA и 10 мкг / мл актиномицина D); аккуратно отделить листья полосы и вакуум проникают в течение 2 × 5 мин.
  3. Место чашку Петри на орбитальном шейкере установлена ​​на 90 мин при комнатной температуре и протопластов в течение 3-4 часов.
    1. Во время инкубации листьев полоски должны быть отделены друг от друга, путем использованияНабор плоский пинцет, через каждые полчаса.
  4. Поместите 70 мкм ячейки фильтра (Fisher Scientific) в 50 мл трубки и осторожно фильтрации раствора через protoplasting. Это позволит удалить листья полосы, которая будет храниться в сито, позволяя протопластов, чтобы пройти.
  5. Промойте листья полос с 4 мл раствора и осторожно процедить через сито же.
  6. Передача протопластов в круглых труб дно и центрифуги протопластов решение при 300 мкг в течение 5 мин для осаждения протопластов.
  7. Аккуратно аспирации от, как большая часть супернатанта насколько это возможно без нарушения протопластов.
  8. Вымойте протопластов с 5 мл раствора и центрифуги при 300 мкг в течение 5 мин. Удалить супернатант
  9. Ресуспендируют протопластов в соответствующий объем раствора с помощью пипетки Пастера или отсечения P1000 чаевых.

2. FACS из листьев Протопласты

  • Непосредственно перед сортировкой, ресуспендируют протопластов использовании (без разреза) P1000 совет, чтобы избежать слипания вместе протопластов.
  • Передача протопластов к сортировке трубку, через 50 мкм фильтр filcon (BD Biosciences) и разбавить по мере необходимости, чтобы избежать засорения сопла клетки сортировщика. Протопласты сортируются с использованием 100 мкм сопла при давлении 20 фунтов (оболочка) и 21-21.5 фунтов на квадратный дюйм (образца), частота 39,2 кГц и события скорость <4000 (эти параметры являются оптимальными по мобильному сортировщик приток BD (BD Biosciences). Оптимизация на других машинах сортировки клеток, возможно, потребуется корректировка этих параметров).
  • GFP положительных протопластов определены с использованием 488 нм аргонового лазера и построения выходом из 580/30 полосовой фильтр (оранжевый) по сравнению с 530/40 полосовой фильтр (зеленый). GFP положительных протопластов будет в высокой 530/low 580 населения, с не-GFP протопластов в низких 530/580 низком населения и мертвых / умирает протопластов и мусора в высоком 580 населенаселения (рис. 2).
    1. При сортировке протопласты, из которых РНК будут извлечены, протопласты должны быть отсортированы непосредственно в меньшей мере, 4 объемов лизис буфера, содержащего восстановитель (например, β-меркаптоэтанол). Кроме того, сорт время одного образца должно быть ограничено 20-30 мин, а максимальный от двух до трех образцов обрабатываются в любой момент времени.
    2. Для визуализации отсортированы протопластов, протопласты должны быть отсортированы непосредственно в меньшей мере, 8 объемы раствора, а затем собирают центрифугированием сосредоточиться протопластов.
  • 3. Представитель Результаты

    Этот протокол описывает метод получения протопластов из листьев Arabidopsis, которые используются для флуоресценции активирован сортировки клеток (рис. 1). Протопластов поколения в присутствии РНКазы и транскрипционной ингибиторов предотвращает клетки FROM монтажа транскрипционный ответ. Это имеет следствием породив множество мертвых и умирающих протопласты, которые имеют значительный уровень автофлуоресценции. При сортировке протопластов подготовлен с помощью этого метода поэтому очень часто можно увидеть несколько различных популяций в графиках 580 нм против 530 нм флуоресценции используется для сортировки. Примеры этого, вместе с сортировкой ворота, используемые в настоящем протоколе показано на рисунке 3.

    Протопласты могут быть отсортированы в 8 томах решения и собрали для визуализации проверить обогащения. Рис 2G показан пример использования этой TP382 линии, которая выражает GFP в замыкающих клеток.

    Примеры выходы, полученные с помощью этого метода, как до, так и после усиления, приведены в таблице 1. Суммы, полученные достаточным для амплификации с использованием Ovation Pico WTA системы (500 PG-50 нг) и, следовательно, сubsequent анализа либо КПЦР (рис. 4), следующая последовательность поколения или микрочипов.

    Рисунок 1
    Рисунок 1. Общий рабочий процесс для эксперимента. 1) урожай листьев интерес GFP выражение Arabidopsis линии. 2) быстро разрезать на ~ 1 мм шириной полосы и немедленно передать их в protoplasting решения и вакуумные инфильтрата. 3) инкубируют в течение 3-4 часов. 4) Аккуратно фильтрата протопластов раствор через сито 70 мкм, трансфер в круглое дно трубы и гранул протопластов путем центрифугирования. 5) Непосредственно перед сортировкой, ресуспендируют протопластов и передачи сортировки трубку, через 50 мкм фильтр. 6) Сортировка GFP положительные и отрицательные GFP жизнеспособных протопластов. 7) Протопласты теперь могут быть проанализированы визуально или с использованием таких методов, как КПЦР, следующего поколения секвенирования или микрочипов.


    Рисунок 2. KC464, KC274 и TP382 линии, используемые в этом исследовании. A) Поперечное сечение KC464 листа показывает GFP выражение в адаксиальной эпидермиса. B) протопластов, полученных от KC464 листьев. C) Поперечное сечение KC274 листа показывает GFP выражение в сосудах. D) протопластов, полученных от KC274 листьев. E) TP382 листа показывает GFP выражение в замыкающих клеток. F) протопластов получены из TP382 листьев. G) Пример обогащения получено FACS из GFP выражение замыкающих клеток в сложном фоне листьев клетки, показывая, содержащих GFP протопластов с высокой 530/low 580 населения протопласты, полученные из TP382 листьев. AF: конфокальной микроскопии изображений; G: флуоресцентный микроскоп изображение. Шкала баров в пределах изображения 50 мкм.

    Рисунок 3
    Рисунок 3. Типичная приобретение FACS точка участков выходом из 580/30 нм (оранжевый) по сравнению с 530/40 нм (зеленый) полосового фильтра (BD приток клетки сортировщика). Сортировка ворота указаны те, которые обычно используются во время сортировки. A) Dot участок Col-4 листа, полученные протопласты, protoplasted в отсутствие ингибиторов, показывая одну низкую 530/low 580 населения. B) Dot участке от мас Col-4 листа, полученные протопласты, protoplasted в присутствии ингибиторов, показывая сдвиг в 580 флуоресценции из-за стресса и окрашивания ингибиторов. CE) Dot участков из листьев, полученные из протопластов KC74, KC464 и TP382 линий, соответственно, protoplasted в присутствии ингибиторов, показывая GFP содержащих населения в высоком 530/low 580 населения. Проценты от событий в GFP (высокая 530/low 580) населению даны. Нажмите, чтобы увеличить показатель .

    e_content "FO: Keep-together.within-страница =" Всегда "> Рисунок 4
    Рисунок 4. GFP выражение в закрытом представитель фракции населения, как показано на рисунке 3. Два биологических повторяет были получены для каждой фракции типа, усиливается использование Ovation Pico WTA системы и КПЦР использованием GFP-специфических праймеров (табл. 2) Затем был проведен. Значения показали самый высокий (красный), низкий (зеленый) и средние относительные значения. Высокая 580 населения в этом случае разделен на две части, низкий 530/low 580 и высокой 530/low 580, для которого одного биологического повторных была использована таким образом, только одно значение показано на рисунке. ACT2 (At3g18780) был использован в качестве стандарта для всех образцов. Лист: весь лист. Разное: Unsorted протопластов. GFP1: высокая 530/low 580 и Rest1: низкая 530/low 580, GFP2: высокая 530/high 580 и Rest2: низкая 530/high 580, как указано на рисунке 3 и вставки. Результаты проверки оF оптических оценки GFP содержимого ячейки в отсортированном фракций (например, 2G рисунок). Нажмите, чтобы увеличить показатель .

    Образец Количество листьев Количество клеток РНК выход
    (НГ)
    РНК выход
    (С усилителем; нг)
    Всего листа
    Всего B листьев
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Unsorted протопласты
    Unsorted B протопласты
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1
    Rest1
    15 6039 (0.39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10 783 (0,63% *)
    57 040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18 337 (1,49% *)
    62 405 (73,49% *)
    - **
    - **
    360
    411

    Таблица 1. Пробы, взятые использованием FACS и проанализированы с КПЦР чтобы определить, какая фракция содержала живые GFP-экспрессирующих протопластов. Кроме того, в этой таблице является общим выходом РНК в нг до и после усиления с Ovation Pico WTA System (NuGen). GFP1, GFP2, Rest1 и Rest2 фракции, как показано на вставке на рисунке 4. * Процент клеток от общей операции сортировки ячейки в скобках возле числа клеток во фракции. Эти показатели не коррелируют сдруг с другом для каждого образца, как рода FACS работает для фракции "отдых" были остановлены раньше, чем для GFP фракции из-за гораздо большего числа клеток, собранных отдыха. ** 50 нг использоваться как входные данные для реакции амплификации, в соответствии с протоколом производителя.

    Грунтовка Последовательность
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Таблица 2. КПЦР праймеров.

    Discussion

    Мы описали метод, который позволяет использовать Arabidopsis растений, экспрессирующих GFP в листьях для генерации протопластов и последующей сортировки клеток с использованием FACS. Этот метод дает достаточного количества РНК, которые будут использоваться для усиления и поэтому последующий анализ либо КПЦР или микрочипов. Фракции отсортированы высоко обогащенные для GFP-содержащие клетки, как показали КПЦР (рис. 2).

    Для достижения высоких урожаев живой протопластов важно работать быстро в течение первых шагов процедуры, пока листья полосы были вакуум проникли с ингибитором содержащих протопластов решение. Кроме того, при создании 1 полосы мм листа очень важно, чтобы нарезать или вырезать листья, а не «отбивную» или пюре из них, так как это приводит к чрезмерному повреждению и, следовательно, более низкую доходность протопластов.

    Существенная разница между методом, описанным здесь и другие publisheг методов является использование ингибитора РНКазы и транскрипционной ингибиторов. Большинство методов разработаны для Arabidopsis корней, от которых протопласты могут быть получены более легко. Тем не менее, при работе с листьями, за исключением мезофилла, необходимо увеличить время протопластов поколения. Поэтому важно, чтобы включить эти ингибиторы для защиты от изменения в экспрессии генов в результате лечения протопластов поколение само по себе (данные не представлены). Тем не менее, наличие ингибиторов приводит к невозможности установить транскрипции ответа, либо путем переключения генов или выключить, которая, вероятно, чтобы сделать протопластов более уязвимы, так как это приводит к потере пластичности, с которыми по борьбе с напряжениями protoplasting процедуры.

    Мы использовали метод, описанный здесь успешно число GFP-экспрессирующих Arabidopsis линий. Важно отметить, что мы использовали этот метод с GFP линий, экспрессирующих GFP либо сильно вядро, или гораздо более слабо в non-localized/diffuse цитозольного образом, как и в случае с KC464 и KC274 линии, используемые здесь. Оба типа линий совместимы с методом и получением обогащенного доли GFP-экспрессирующих протопластов (рис. 2 и 3). Этот метод может быть легко адаптирована к другим флуорофоры, хотя флуорофора должны быть выбраны для флуоресценции, что существенно отличается от аутофлюоресценции мертвых / умирающие клетки для того, чтобы сохранить возможность выбора живых клеток.

    Disclosures

    Нет конфликта интересов объявлены.

    Acknowledgments

    Работа в Бьюкенен-Волластон лаборатории по камерного типа и стадии развития конкретных профилей при поддержке Агрон-омик проекта (грант № LSHG-CT-2006-037704) в 6-й Рамочной Progamme Европейской комиссии. Работа в лаборатории Гиффорд по камерного типа конкретных профилей поддерживается BBSRC новый следователь гранта (BB/H019502/1).

    KC274 и KC464 Arabidopsis линии были получены из AAR Уэбб (Кембриджский университет).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Сотовые конкретного анализа<em&gt; Arabidopsis</em&gt; Листья Использование флуоресценции клеток, активированных Сортировка
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter