Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Análisis específico de célula de doi: 10.3791/4214 Published: October 4, 2012

Summary

Un método para producir

Abstract

Después de la iniciación de la primordio de hoja, acumulación de biomasa es controlado principalmente por la proliferación celular y la expansión de las hojas 1. Sin embargo, la hoja de Arabidopsis es un órgano complejo compuesto de muchos tipos de células diferentes y varias estructuras. Al mismo tiempo, la hoja creciente contiene células en diferentes etapas de desarrollo, con las células más alejadas del pecíolo siendo la primera a detener la expansión y se someten a la senescencia 1. Las diferentes células dentro de la hoja, por lo tanto dividir, alargando o diferenciar, activo, estresado o muerto, y / o responder a los estímulos en los sub-conjuntos de su tipo celular en un momento dado. Esto hace que el estudio genómico de la hoja desafiante: por ejemplo en el análisis de datos de expresión de hojas enteras, las señales de redes genéticos que operan en distintas zonas de respuesta celular o tipos de células se confunden, lo que resulta en un perfil incorrecto que se generan.

Para abordar esta cuestión, sarias métodos se han descrito, que permiten los estudios de la expresión génica específica de la célula. Estos incluyen la captura de microdisección por láser (LCM) 2 o plantas que expresan GFP utilizados para la generación de protoplastos y la posterior clasificación de células activadas por fluorescencia (FACS) 3,4, el sistema descrito recientemente intacto por precipitación nuclear 5 y la inmunoprecipitación de los polisomas 6.

FACS ha sido utilizado con éxito para una serie de estudios, incluyendo el mostrar que la identidad de la célula y la distancia desde la punta de la raíz tuvo un efecto significativo en los perfiles de expresión de un gran número de genes 3,7. FACS de líneas de GFP también se han utilizado para demostrar células específicas de regulación transcripcional durante las respuestas de nitrógeno raíces y el desarrollo de raíces laterales 8, 9 estrés sal distribución de auxina en la raíz 10 y para crear un mapa de la expresión de genes de la Arabidopsis meristemo apical 11. AunqueFACS se ha utilizado anteriormente para ordenar protoplastos de Arabidopsis hoja derivados basados ​​en autofluorescencia 12,13, hasta ahora el uso de FACS en las líneas de Arabidopsis que expresan GFP en las hojas ha sido muy limitado 4. En el siguiente protocolo se describe un método para la obtención de protoplastos de Arabidopsis hoja que son compatibles con FACS mientras se minimiza el impacto del régimen de generación de protoplastos. Se demuestra el método que utiliza la línea de Arabidopsis KC464, que expresa GFP en la epidermis adaxial 14, la línea KC274, que expresa GFP en el tejido vascular 14 y la línea de Arabidopsis TP382, que expresan un doble constructo GFP ligado a una señal de localización nuclear en las células de guarda (datos no mostrados; Figura 2). Actualmente estamos utilizando este método para estudiar tanto la expresión de tipo celular específico durante el desarrollo y el estrés, así como las poblaciones celulares heterogéneas en diversas etapas de la senescencia.

Protocol

1. Generación de protoplastos

  1. Cosecha de material de hojas y se cortó en tiras de 1 mm de ancho (Figura 1) con una hoja de afeitar. Para las muestras que contienen más de una sola hoja hasta 15 hojas se pueden apilar fácilmente antes de cortar.
  2. Inmediatamente transferir las tiras de hoja en un plato de 9 cm ronda de Petri que contiene 20 ml de solución A (400 mM de manitol, 20 mM de hidrato de MES, 20 mM KCl, 10 mM CaCl 2, 2 mM de MgCl 2, 0,1% de BSA y 2,5 mM β-mercaptoetanol, pH 5,7) incluyendo enzimas protoplastos (1,2% de celulosa R-10, 0,6% de celulosa RS y 0,4% macerozima R-10) y RNasa e inhibidores de la transcripción (1 x ProtectRNA y 10 ug / ml de actinomicina D); suavemente separar las tiras de hoja y vacío infiltrado de 2 × 5 min.
  3. Place cápsula de Petri en un agitador orbital a 90 rpm a temperatura ambiente y protoplastos para 3-4 hr.
    1. Durante la incubación de las tiras de hoja deben estar separados el uno del otro, por el uso de unjuego de pinzas planas, en intervalos de media hora.
  4. Colocar un 70 micras de células colador (Fisher Scientific) en un tubo de 50 ml y suavemente, filtrar la solución a través de protoplastos. Esto eliminará las tiras de hoja, los cuales puedan ser retenidos por el tamiz mientras que permite que los protoplastos que pasar.
  5. Lavar las tiras de hoja con una solución de 4 ml de A y suavemente filtro a través del mismo tamiz.
  6. Transferir los protoplastos en tubos de fondo redondo y se centrifuga la solución de protoplastos a 300 xg durante 5 min para sedimentar los protoplastos.
  7. Suavemente aspirar la mayor cantidad del sobrenadante como sea posible sin perturbar los protoplastos.
  8. Se lavan los protoplastos con 5 ml de solución A y se centrifuga a 300 xg durante 5 min. Remover el sobrenadante
  9. Resuspender los protoplastos en un volumen apropiado de la solución A, usando una pipeta Pasteur o una punta de corte P1000.

2. FACS de protoplastos de hoja

  • Inmediatamente antes de la clasificación, se resuspenden los protoplastos utilizando una (no cortada) P1000 punta para evitar protoplastos se amontonen.
  • Transferir a un tubo de protoplastos de clasificación a través de un filtro de 50 micras Filcon (BD Biosciences) y se diluye en su caso para evitar la obstrucción de la boquilla del clasificador de células. Los protoplastos se ordenan utilizando una boquilla de 100 micras a una presión de 20 psi (vaina) y 21-21.5 psi (muestra), una frecuencia de 39,2 kHz y una tasa de sucesos de <4000 (estos valores son óptimos en un clasificador de células Influx BD (BD Biosciences). Optimización en otras máquinas de clasificación celular vez necesite una modificación en estas opciones).
  • Protoplastos GFP positivos se identifican utilizando un láser de argón de 488 nm y el trazado de la salida del paso de banda 580/30 filtro (naranja) vs el filtro 530/40 de paso de banda (verde). Protoplastos GFP positivos será en la población de alto 530/low 580, con protoplastos no-GFP en el bajo 530/580 bajo la población y muertos / protoplastos que mueren y los desechos en la población de alto 580mento (Figura 2).
    1. Al ordenar los protoplastos a partir de la que se extrajeron los ARN, los protoplastos se deben ordenar directamente en al menos 4 volúmenes de un tampón de lisis que contiene un agente reductor (por ejemplo, β-mercaptoetanol). Además, el tiempo de tipo de una sola muestra debe limitarse a 20-30 min, y un máximo de dos a tres muestras procesadas en un momento dado.
    2. Para la visualización de protoplastos según, los protoplastos se deben ordenar directamente en al menos 8 volúmenes de la solución A y posteriormente recogidas por centrifugación para concentrar los protoplastos.
  • 3. Los resultados representativos

    Este protocolo describe un método para la obtención de protoplastos a partir de hojas de Arabidopsis, que se utilizan para la clasificación de células activadas por fluorescencia (Figura 1). Generación de protoplastos en presencia de RNasa e inhibidores transcripcionales impide la f célulasrom montaje de una respuesta transcripcional. Esto tiene la consecuencia de que da lugar a muchos protoplastos muertos y moribundos, que tienen un nivel significativo de autofluorescencia. Al ordenar los protoplastos preparados con este método es por lo tanto muy común ver varias poblaciones distintas en las gráficas de las 580 nm frente a 530 nm de fluorescencia utilizados para la clasificación. Ejemplos de este, junto con las puertas de clasificación utilizados en este protocolo se muestran en la Figura 3.

    Los protoplastos se pueden clasificar en 8 volúmenes de la solución A y se recoge para la visualización para verificar el enriquecimiento. Figura 2G muestra un ejemplo de este uso de la línea de TP382, que expresa GFP en las células guardas.

    Ejemplos de los rendimientos obtenidos utilizando este método, tanto antes como después de la amplificación, se muestran en la Tabla 1. Las cantidades obtenidas son suficientes para la amplificación usando el Ovation Pico WTA Sistema (500 pg-50 ng) y por lo tanto sanálisis ubsequent por cualquiera de qPCR (Figura 4), ​​la secuenciación de próxima generación o microarrays.

    Figura 1
    Figura 1. Flujo de trabajo general para el experimento. 1) Harvest deja de interés de una línea que expresan GFP Arabidopsis. 2) rápidamente cortado en tiras de 1 ~ mm de ancho y transferirlas inmediatamente en una solución de protoplastos y vacío infiltrado. 3) Se incuba durante 3-4 horas. 4) suavemente filtrado solución de protoplastos a través de un tamiz de 70 micras, traslado a la vuelta de tubos de fondo y protoplastos pellet por centrifugación. 5) Inmediatamente antes de la clasificación, los protoplastos se resuspenden y la transferencia a un tubo de clasificación a través de un filtro de 50 micras. 6) Ordenar GFP positivas y las buenas prácticas agrarias viables protoplastos negativos. 7) Los protoplastos ahora se pueden analizar visualmente o mediante técnicas tales como la qPCR, secuenciación de próxima generación o microarrays.


    Figura 2. Las líneas KC464, KC274 y TP382 utilizados en este estudio. A) Sección transversal de una hoja KC464 que muestra la expresión de GFP en la epidermis adaxial. B) los protoplastos derivados de KC464 hojas. C) Sección transversal de una hoja KC274 que muestra la expresión de GFP en la vasculatura. D) Los protoplastos derivados de KC274 hojas. E) TP382 hoja que muestra la expresión de GFP en las células de guarda. F) los protoplastos derivados de TP382 hojas. G) Ejemplo del enriquecimiento obtenido por FACS de las células que expresan GFP guardia en el fondo complejo de células de las hojas, mostrando las buenas prácticas agrarias que contiene los protoplastos de la 530/low alta población de 580 protoplastos derivados de TP382 hojas. AF: Confocal de imágenes de microscopio; G: Imagen del microscopio de fluorescencia. Las barras de escala dentro de las imágenes son de 50 micras.

    Figura 3
    Figura 3. Típicos gráficos de puntos de FACS de adquisición de la salida de los 580/30 nm (naranja) vs 530/40 nm (verde) filtros de paso de banda (afluencia BD clasificador de células). Las puertas de clasificación se muestran en las que normalmente se utilizan durante la clasificación. A) Dot parcela de protoplastos de hoja Col-4 protoplastos derivados, en ausencia de inhibidores, que muestran una sola 530/low bajo 580 población. B) Dot parcela de WT Col-4 hoja protoplastos derivados, protoplastos en presencia de inhibidores, que muestran un cambio en la fluorescencia de 580 debido a la tensión y la coloración por los inhibidores. CE) Dot parcelas de la hoja de protoplastos derivados de las líneas KC74, KC464 y TP382, respectivamente, protoplastos en presencia de inhibidores, que muestran la GFP que contiene las poblaciones en el 530/low alta 580 poblaciones. Los porcentajes de los acontecimientos en las buenas prácticas agrarias (alta 530/low 580) poblaciones se dan. Haga clic aquí para ampliar la cifra .

    e_content "fo: keep-together.within-page =" always "> Figura 4
    Figura 4. Expresión de GFP en las fracciones de población representativas cerradas como se muestra en la Figura 3. Dos repeticiones biológica se obtuvieron para cada tipo de fracción, amplificado utilizando el Ovation Pico WTA Sistema y qPCR utilizando GFP cebadores específicos (Tabla 2) se realizó a continuación. Los valores mostrados son los más altos (rojo), el más bajo (verde) y el promedio de los valores relativos. La población fue de 580 alto en este caso se partió en dos, bajo 530/low 580 y alto 530/low 580, para que una réplica biológica sólo se estudió lo que sólo el valor único. ACT2 (At3g18780) fue utilizado como un estándar para todas las muestras. Hoja: hoja entera. Unsorted: protoplastos sin clasificar. GFP1: alto 530/low 580 y Rest1: bajo 530/low 580, GFP2: 530/high alta 580 y Rest2: bajo 530/high 580, tal como se describe en la figura 3 y la inserción. Los resultados son una verificación of evaluaciones ópticas del contenido de células GFP en las fracciones ordenados (por ejemplo 2G figura). Haga clic aquí para ampliar la cifra .

    Muestra N º de hojas N º de celdas ARN rendimiento
    (Ng)
    ARN rendimiento
    (Amplificado; ng)
    Una hoja entera
    B hoja entera
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    A protoplastos Unsorted
    Protoplastos B Unsorted
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    A GFP1
    A Rest1
    15 6039 (0.39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10.783 (0,63% *)
    57.040 (7.49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18.337 (1.49% *)
    62.405 (73,49% *)
    - **
    - **
    360
    411

    Las muestras Tabla 1. Recolectados a través de FACS y se analizaron con qPCR para determinar qué fracción contenida en vivo que expresan GFP-protoplastos. También se incluyen en esta tabla es el rendimiento total de ARN en ng antes y después de la amplificación con el sistema Ovation Pico WTA (NuGen). Fracciones GFP1, GFP2, Rest1 y Rest2 son como se muestra en el inserto en la Figura 4. * El porcentaje de células de la especie de células de ejecución total se da entre paréntesis al lado del número de células en la fracción. Estos porcentajes no están correlacionadasentre sí para cada muestra como el tipo FACS tiene una duración de fracciones "resto" se detuvo antes de lo que las buenas prácticas agrarias para las fracciones por el número mucho mayor de células recolectadas de descanso. ** 50 ng utiliza como entrada para reacciones de amplificación, según el protocolo del fabricante.

    Cartilla Secuencia
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tabla 2. QPCR primers.

    Discussion

    Se ha descrito un método que permite el uso de plantas de Arabidopsis que expresan GFP en las hojas para la generación de protoplastos y células de clasificación subsiguiente usando FACS. Este método produce cantidades suficientes de ARN para ser utilizados para la amplificación y el análisis posterior por lo tanto, ya sea por qPCR o microarrays. Las fracciones según son altamente enriquecido para GFP células que contienen, como se demuestra por qPCR (Figura 2).

    Para lograr altos rendimientos de protoplastos vivos es crítico para trabajar rápidamente durante las etapas iniciales del procedimiento, hasta que las tiras de hoja de vacío han sido infiltrada con la solución de protoplastos que contienen un inhibidor. Además, cuando se generan tiras de 1 mm de hoja que es muy importante para rebanar o cortar las hojas en lugar de 'tajada' o puré de ellos, ya que esto conduce a un daño excesivo y por lo tanto un rendimiento de protoplastos inferior.

    Una diferencia fundamental entre el método descrito aquí y otro Published métodos es el uso de inhibidores de RNasa e inhibidores de la transcripción. La mayoría de los métodos se han desarrollado para las raíces de Arabidopsis, de las cuales los protoplastos se pueden generar más fácilmente. Sin embargo, cuando se trabaja con hojas, excepto mesófilo, es necesario aumentar el tiempo de generación de protoplastos. Por lo tanto, es importante incluir estos inhibidores para proteger contra los cambios en la expresión génica como resultado de la generación de tratamiento de protoplastos sí mismo (datos no mostrados). Sin embargo, la presencia de los inhibidores conduce a una incapacidad de montar una respuesta de transcripción, ya sea por conmutación o eliminar genes, que es probable que los protoplastos más vulnerables ya que esto conduce a una pérdida de plasticidad con el cual contrarrestar las tensiones de la protoplastos procedimiento.

    Se ha utilizado el método descrito aquí con éxito con un número de líneas que expresan GFP Arabidopsis. Es importante destacar que han utilizado este método con las líneas que expresan GFP GFP sea fuertemente enel núcleo, o mucho más débilmente de forma citosólica non-localized/diffuse, como es el caso con los KC464 y KC274 líneas utilizadas aquí. Ambos tipos de líneas son compatibles con el método y el rendimiento de fracciones altamente enriquecidas de GFP-expresando protoplastos (Figura 2 y 3). El método puede ser fácilmente adaptado para otros fluoróforos, aunque el fluoróforo debe ser seleccionado para fluorescencia que es significativamente diferente de la autofluorescencia de las células muertas / morir a fin de preservar la capacidad de seleccionar células vivas.

    Disclosures

    No hay conflictos de interés declarado.

    Acknowledgments

    El trabajo en el laboratorio Buchanan-Wollaston en etapa de perfiles de tipo celular y de desarrollo específico con el apoyo del proyecto AGRON-ómicas (subvención # LSHG-CT-2006 a 037.704) en el 6 º progamme Marco de la Comisión Europea. El trabajo en el laboratorio de Gifford en el perfil de tipo celular específico está soportado por un BBSRC Nueva Investigador subvención (BB/H019502/1).

    Los KC274 y KC464 líneas de Arabidopsis se obtuvieron de AAR Webb (Universidad de Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Análisis específico de célula de<em&gt; Arabidopsis</em&gt; Hojas usando citometría de flujo
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter