Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Hücre Özgül Analizi doi: 10.3791/4214 Published: October 4, 2012

Summary

Üretmek için bir yöntem

Abstract

Yaprak primordium'un başlangıcından sonra, biyomas birikim esas olarak hücre çoğalması ve yaprak 1 genişleme tarafından kontrol edilir. Bununla birlikte, Arabidopsis yaprağı çok farklı hücre tipleri ve çeşitli yapılar oluşan bir kompleks bir organdır. Aynı zamanda, büyüyen yaprak genişleyen durdurmak ve yaşlanması 1. geçmesi için ilk olmanın sapı en uzak hücreler, farklı gelişim aşamalarında hücreler içerir. Yaprağın içinde farklı hücreler bu nedenle bölünmesi uzayarak veya ayırıyoruz; aktif stresli veya ölü ve / veya herhangi bir zamanda kendi hücresel tip alt setleri uyaranlara yanıt. Bu yaprak zorlu genomik araştırma yapar: örneğin farklı hücresel yanıt bölgeler veya hücre tiplerinde faaliyet genetik ağların bütün yaprakları, sinyallerinden ifade verileri analiz ederken şaşırmış olacak, üretilen yanlış bir profil elde edilir.

Bu adres için, several yöntemler hücre spesifik gen ifadesi çalışmalar imkan veren tarif edilmiştir. Bu lazer yakalama mikrodiseksiyon (LCM) 2 veya protoplast nesil ve sonraki floresan aktive hücre sıralama (FACS) 3,4, nükleer yağış 5 ve polysomes 6 immünopresipitasyon için son açıklanan INTACT sistemi için kullanılan GFP ifade bitkileri bulunmaktadır.

FACS başarılı bir şekilde kök ucu hücre kimlik ve mesafe 3,7 genlerin büyük bir sayısını ifade profilleri üzerinde önemli bir etkisi olduğunu gösteren da dahil olmak üzere bir dizi çalışma için kullanıldı. GFP hatlarının FACS da kök azot yanıtları ve lateral kök gelişimi 8, tuz stresine kök 10 9 oksin dağıtımı sırasında hücre spesifik transkripsiyonel düzenleme göstermek ve Arabidopsis sürgün apikal meristem 11 bir gen ekspresyonu harita oluşturmak için kullanılır olmuştur. RağmenFACS önce otofloresans 12,13 dayalı Arabidopsis yaprak elde protoplast sıralamak için kullanılır olmuştur, yapraklarda GFP ifade Arabidopsis hatlarında FACS kadar kullanımı 4 çok sınırlı olmuştur. Aşağıdaki protokol biz protoplast nesil rejiminin etkilerini en aza FACS uyumlu Arabidopsis Yaprak protoplast elde etmek için bir yöntem açıklanmaktadır. Biz vasküler doku 14 ve TP382 Arabidopsis doğrultusunda, ifade GFP çift GFP ifade adaxial epidermisin 14 KC274 doğrultusunda, ifade GFP bir nükleer lokalizasyon sinyal bağlantılı yapıtaşıdır KC464 Arabidopsis hattı kullanarak yöntem gösterilmektedir bekçi hücreleri (veriler gösterilmemiştir; Şekil 2). Şu anda, ihtiyarlık çeşitli evrelerinde her iki hücre tipi geliştirme ve stres esnasında spesifik ifade, hem de heterojen hücre popülasyonları incelemek için bu yöntemi kullanarak.

Protocol

1. Protoplast Nesil

  1. Bir jilet ile 1 mm genişliğinde şeritler (Şekil 1) içine Hasat yaprak malzeme ve kesim. Için en fazla 15 yaprak, tek bir yaprak daha içeren örnekleri kolay kesim öncesinde yığılmış olabilir.
  2. Derhal 20 ml solüsyon içeren bir 9 cm olan yuvarlak Petri kabı içine yaprak şerit aktarma A (400 mM, mannitol, 20 mM MES hidrat, 20 mM KCI, 10 mM CaCI2, 2 mM MgCl2,% 0.1 BSA, 2.5 mM β-merkaptoetanol, protoplasting enzimler (% 1.2 selüloz R-10,% 0.6 selüloz RS ve% 0,4 'macerozyme R-10) ve RNase ve transkripsiyonel inhibitörleri (1 x ProtectRNA ve 10 ug / ml Aktinomisin D) içeren pH 5.7), yavaşça yaprak şeritler ayırmak ve 2 × 5 dk sızmak vakum.
  3. Bir orbital çalkalayıcı üzerinde yer Petri tabağına 3-4 saat boyunca oda sıcaklığında ve protoplast 90 rpm'ye ayarlayın.
    1. İnkübasyon sırasında, şeritler bir yaprak kullanılarak, her biri diğerinden ayrılması gerekiryarım saatlik aralıklarla, düz cımbız ayarlayın.
  4. 50 ml'lik bir tüp içinde 70 mikron hücre süzgecinden (Fisher Scientific) yerleştirin ve yavaşça yoluyla protoplasting çözüm filtre. Bu protoplast geçmesi için izin verirken elek tarafından muhafaza edilecektir yaprak şeritler kaldıracaktır.
  5. 4 ml solüsyon aynı elekten A ve hafifçe filtre ile yaprak şeritler yıkayın.
  6. Yuvarlak dipli tüpler içine protoplast aktarın ve pelet protoplast 5 dakika boyunca 300 xg'de protoplast çözümü santrifüj.
  7. Yavaşça protoplast bozmadan kadar süpernatant mümkün olduğunca kapalı aspire.
  8. 5 dakika boyunca 300 x g 5 ml çözelti A ve protoplastlar santrifüj ile yıkanır. Süpernatantı
  9. Pasteur pipeti veya cut-off P1000 ucunu kullanarak, çözelti A uygun bir hacim protoplast süspanse edin.

2. Yaprak protoplast FACS

  • Hemen sıralama önce, birlikte topaklanma protoplast önlemek için bir (non-cut) P1000 ucu kullanarak protoplast tekrar süspansiyon haline getirin.
  • 50 mikron filcon filtresi (BD Biosciences) ile bir sıralama tüp protoplast aktarın ve hücre sıralayıcı meme tıkanmasını önlemek için uygun sulandırmak. Protoplast 20 psi (kılıf) ve 21-21,5 psi (örnek), 39.2 kHz frekansta bir basınç ve <4000 (bu ayarlar BD Akın hücre sıralayıcı üzerinde optimal bir olay hızında 100 mikron nozul kullanılarak sıralanır Diğer hücre sıralama makinelerinde (BD Biosciences). Optimizasyon bu ayarları için ayarlamalar) gerekebilir.
  • GFP pozitif protoplast bir 488 nm argon lazer kullanarak ve 580/30 bandpass (turuncu) vs 530/40 bandpass (yeşil) çıkışı komplo tanımlanır. GFP pozitif protoplast yüksek 580 popu içinde 530 düşük / düşük 580 nüfus ve ölü / ölmekte protoplast ve enkaz olmayan GFP protoplast sahip, yüksek 530/low 580 nüfus olacaklasyon (Şekil 2).
    1. RNA ekstre olacak olan protoplast ayırma zaman, protoplast bir indirgeyici madde ihtiva eden bir lizis tamponu en az 4 hacimde (örneğin, β-merkaptoetanol) doğrudan sıralanması. Buna ek olarak, tek bir örnek sıralama zamanı 20-30 dk, ve herhangi bir zamanda işlenmiş 2-3 numune maksimum sınırlı olmalıdır.
    2. Kriteri protoplast görselleştirilmesi için, protoplast çözelti en az 8 birimleri A ve daha sonra konsantre protoplastlar için santrifüjleme ile toplanmış doğrudan sıralanması.
  • 3. Temsilcisi Sonuçlar

    Bu protokol, floresan aktive hücre tasnif (Şekil 1) için kullanılan Arabidopsis yaprağı, protoplast dan elde etmek için bir yöntem açıklanmaktadır. RNase ve transkripsiyonel inhibitörlerinin varlığında Protoplast kuşak hücreleri f önlerrom bir transkripsiyonel yanıt montaj. Bu otofloresans önemli düzeyde birçok ölü ve ölmekte protoplast, doğuran bir sonucu var. Bu yöntem ile hazırlanan protoplast sıralama zaman sıralama için kullanılan 580 nm vs 530 nm floresan grafikleri birkaç farklı toplumlarda görmek için bu nedenle çok yaygındır. Birlikte bu protokolde kullanılan cinslere ayırma kapıları ile bu örnekler Şekil 3 'de gösterilmiştir.

    Protoplast çözüm A 8 cilt halinde sıralanır ve zenginleştirme doğrulamak için görselleştirme için toplanan. Şekil 2G bekçi hücreleri GFP ifade TP382 hattı kullanarak bu bir örnek gösteriyor olabilir.

    Önce ve amplifikasyon sonrası, bu yöntem kullanılarak elde edilen verimleri örnekleri arasında Tablo 1 'de gösterilmektedir. Elde edilen miktarlar Ovation Pico WTA Sistem (500 pg-50 ng) ve bu nedenle s kullanılarak amplifikasyon için yeterlidirqPCR biri tarafından ubsequent analizi (Şekil 4), yeni nesil dizileme veya mikroarray.

    Şekil 1
    Şekil 1. Deney için genel iş akışı. 1) Hasat Arabidopsis satırı ifade eden bir GFP gelen ilgi bırakır. 2) Hızlı ~ 1 mm genişliğinde şeritler halinde kesilir ve hemen protoplasting Çözelti ve vakum sızmak içine bu transfer. 3) 3-4 saat süreyle inkübe edin. 4) 70 mikron elekten yavaşça süzülen protoplast çözümü, santrifüjle alt tüpleri ve pelet protoplast yuvarlak aktarmak. 5) Derhal sıralama önce, 50 mikron ile tekrar süspansiyon protoplast ve sıralama tüp transfer filtresi. 6) Sıralama GFP pozitif ve negatif GFP canlı protoplast. 7) protoplast şimdi ya görsel analiz veya qPCR, yeni nesil dizileme veya mikroarray gibi teknikler kullanılarak yapılabilir.


    Şekil 2. Bu çalışmada kullanılan KC464, KC274 ve TP382 hatları. Adaxial epidermiste GFP gösteren bir KC464 yaprak A) enine kesit. B) protoplast KC464 yapraklarından elde edilen. Vaskülatürde GFP tanımı gösteren bir KC274 yaprak C) enine kesit. D KC274 yapraklarından elde edilen) protoplast. E) TP382 yaprak koruma hücrelerde GFP tanımı göstermektedir. F) protoplast TP382 yapraklarından elde edilen. TP382 yapraklarından elde edilen protoplastlar yüksek 530/low 580 popülasyonundan protoplast içeren GFP gösteren yaprak hücrelerin kompleks arka koruma hücre ifade GFP FACS ile elde zenginleştirme G) Örnek. AF: Konfokal mikroskop görüntüleri, G: Floresans mikroskop görüntüsü. Görüntülerdeki Ölçek çubukları 50 mm'dir.

    Şekil 3
    Şekil 3. 580/30 nm (turuncu) vs 530/40 nm (yeşil) bant geçiren filtreler (BD Akın hücre sıralayıcı) çıktısı tipik FACS edinimi nokta araziler. Gösterilen ayırma kapıları tipik olarak eleme sırasında kullanılan olanlardır. Bir düşük 530/low 580 nüfus gösteren inhibitörleri yokluğunda protoplasted Col-4 yaprak elde protoplast, A) Dot arsa. Nedeniyle inhibitörleri tarafından gerilme ve boyama için 580 floresan bir değişim gösteren inhibitörlerinin varlığında protoplasted ağırlıkça Col-4 yaprak elde protoplast, B) Dot arsa. Yüksek 530/low 580 popülasyonlarında popülasyonlarının içeren GFP gösteren inhibitörlerinin varlığında protoplasted sırasıyla KC74, KC464 ve TP382 hatları, gelen yaprak edilen protoplast dan CE) Dot araziler. GFP (yüksek 530/low 580) toplumlarda olayların yüzdeleri verilmiştir. büyük bir rakam görmek için buraya tıklayın .

    e_content "fo: keep-together.within-page =" always "> Şekil 4,
    Şekil 4,. Şekil 3'te gösterildiği gibi temsil eden kapı popülasyon fraksiyonu olarak GFP tanımı. Çoğaltır iki biyolojik sonra yapıldı GFP-özgü primerler (Tablo 2) ile Ovation Pico WTA sistemi ve qPCR kullanılarak amplifiye, her fraksiyonda tipi için elde edilmiştir. Gösterilen değerler yüksek (kırmızı), düşük (yeşil) ve ortalama bağıl değerlerdir. Yüksek 580 nüfusu ikiye bölünmüş durumda idi, düşük 530/low 580 ve tek bir biyolojik çoğaltmak yalnızca tek bir değer gösterilir böylece kullanıldığı için yüksek 530/low 580,. ACT2 (At3g18780) tüm örnekler için standart olarak kullanılmıştır. Yaprak: Tüm yaprak. Unsorted: Unsorted protoplast. GFP1: Yüksek 530/low 580 ve Rest1: düşük 530/low 580, GFP2: Yüksek 530/high 580 ve Rest2: Şekil 3 ve insert açıklanan düşük 530/high 580,. Sonuçlar bir doğrulama o vardırkriteri fraksiyonları (örneğin Şekil 2G) GFP hücre içeriğinin f optik değerlendirmeler. büyük bir rakam görmek için buraya tıklayın .

    Örnek Yaprakların sayısı Hücre sayısı Verim RNA
    (Ng)
    Verim RNA
    (Güçlendirilmiş; ng)
    Tüm yaprak A
    Tüm yaprak B
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Unsorted protoplast A
    Unsorted protoplast B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 A
    Rest1 A
    15 6039 (0.39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10783 (% 0.63 *)
    57.040 (7.49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18337 (% 1.49 *)
    62.405 (% 73.49 *)
    - **
    - **
    360
    411

    Tablo 1. Numuneler FACS ile toplandı ve canlı GFP-ifade eden protoplast ihtiva eden oranını belirlemek için qPCR ile analiz edilmiştir. Ayrıca Ovation Pico WTA Sistemi (NuGen) ile amplifikasyon önce ve sonra ng toplam RNA'dan verim bu tabloya dahil edilmiştir. GFP1, GFP2, Rest1 ve Rest2 fraksiyonlar, Şekil 4'te elemanı gösterilmiştir. Toplam hücre tür çalışma hücrelerinin * yüzdesi fraksiyonu içinde hücrelerin sayısı yanında parantez içinde verilmektedir. Bu yüzdeler arasında ilişki bulunmamaktadırFACS sıralama 'Rest' kesirler için çalışır gibi her bir örnek için birbirlerine daha önce alınan istirahat hücreleri daha fazla sayıda nedeniyle GFP kesirler için daha durdu. Üreticinin protokole göre amplifikasyon reaksiyonları için girdi olarak kullanılan ** 50 ng.

    Astar boya Sıra
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tablo 2. QPCR astar.

    Discussion

    Biz protoplast nesil ve FACS kullanan sonraki hücre sıralama için yapraklarda GFP ifade Arabidopsis bitkilerin kullanımına izin veren bir yöntem tarif var. Bu yöntem, qPCR veya mikroarray ya tarafından amplifikasyon ve bu yüzden bir sonraki analiz için kullanılacak olan RNA, yeterli miktarlarda elde edilir. Kriteri fraksiyonlar son derece olarak qPCR (Şekil 2) ile gösterilen GFP-içeren hücreler için zenginleştirilmiştir.

    Yaprak şeritler inhibitörü içeren protoplast solüsyonu ile infiltre vakum olmuştur kadar canlı protoplast yüksek verimi elde etmek için bu prosedürün ilk adımları sırasında hızla çalışmak önemlidir. Buna ek olarak, 1 mm yaprak şerit üretirken, bu aşırı hasar ve bu nedenle daha düşük bir protoplast verim neden olarak, yapraklar yerine "kesme" püre ya da bunların dilim veya kesim için çok önemlidir.

    Yöntemi arasındaki kritik fark burada ve diğer publishe tarifd yöntem RNase inhibitörleri ve transkripsiyonel inhibitörlerinin kullanımı. Çoğu yöntemleri protoplast daha kolay elde edilebilir hangi Arabidopsis kökleri için geliştirilmiştir. Bununla birlikte, mezofil hariç, yaprakları ile çalışma zaman, protoplast üretim süresini artırmak için gereklidir. Bu nedenle, protoplast kuşak tedavinin kendisi (veriler gösterilmemiştir) bir sonucu olarak gen ekspresyonu değişikliklere karşı korumak için bu inhibitörleri dahil etmek önemlidir. Ancak, inhibitörlerin varlığı bu stresinden karşı hangi ile plastisite kaybına neden olarak protoplast daha savunmasız yapmak olasıdır kapalı genlerin veya geçiş yoluyla, bir transkripsiyon yanıt monte için bir yetersizlik yol açar prosedürü protoplasting.

    Biz, GFP-ifade eden Arabidopsis hatları bir dizi ile başarılı bir şekilde burada tarif edilen yöntem kullanılmıştır. Önemlisi, biz GFP hatları ya kuvvetli GFP ifade ile bu yöntemi kullanmışçekirdek, ya da çok daha zayıf bir non-localized/diffuse sitosolik bir şekilde, burada kullanılan KC464 ve KC274 hatları ile bir durumdur. Hatları Her iki tip yöntem ile uyumlu olan ve GFP-ifade eden protoplast arasında yüksek oranda zenginleştirilmiş fraksiyon için (Şekil 2 ve 3) elde edildi. Fluorofor ölü / ölüm hücreleri otofloresans canlı hücreleri seçmek için yeteneğimizi korumak amacıyla önemli ölçüde farklı olduğu floresans seçilmelidir rağmen metod, diğer floroforlar adapte olabilir.

    Disclosures

    Çıkar çatışması ilan etti.

    Acknowledgments

    Hücre tipine ve gelişim evrelerine özgü profil üzerine Buchanan-Wollaston laboratuarında çalışma Avrupa Komisyonu 6. Çerçeve Programı'nın en AGRON-omics projesi (hibe # LSHG-CT-2006-037704) tarafından desteklenmektedir. Hücre tipine özgü profil üzerine Gifford laboratuarda çalışmak bir BBSRC Yeni Araştırmacı hibe (BB/H019502/1) tarafından desteklenmektedir.

    KC274 ve KC464 Arabidopsis hatları AAR Webb (Cambridge University of) elde edilmiştir.

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Hücre Özgül Analizi<em&gt; Arabidopsis</em&gt; Floresans Aktif Hücre Ayırma kullanma Leaves
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter