Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

الكشف عن التعديلات الوراثية الجسدية في عينات الورم عن طريق التقاط اكسون وتسلسلها الموازي واسع

Published: October 18, 2013 doi: 10.3791/50710

Summary

وصفنا إعداد مكتبات الحمض النووي barcoded واللاحقة المستندة إلى التهجين التقاط اكسون للكشف عن الطفرات المرتبطة بالسرطان الرئيسية في عينات الورم السريرية التي المتوازية "الجيل القادم" التسلسل. استهداف تسلسل اكسون يقدم فوائد إنتاجية عالية وتكلفة منخفضة، وتغطية تسلسل عميق، وبالتالي العائد حساسية عالية للكشف عن الطفرات التردد المنخفض.

Abstract

وقد أثبتت الجهود للكشف والتحقيق الطفرات أنكجنيك مفتاح قيمة لتسهيل العلاج المناسب لمرضى السرطان. إنشاء الإنتاجية العالية، المتوازية "الجيل القادم" التسلسل ساعد على اكتشاف العديد من هذه الطفرات. لتعزيز المرافق السريرية ومتعدية لهذه التكنولوجيا، ويجب أن تكون منصات عالية الإنتاجية، وفعالة من حيث التكلفة، ومتوافقة مع البارافين الثابتة الفورمالين جزءا لا يتجزأ من (FFPE) عينات الأنسجة التي قد تسفر عن كميات صغيرة من الحمض النووي المتدهورة أو التالفة. هنا، نحن تصف إعداد مكتبات الحمض النووي barcoded والمضاعفة تليها التقاط القائم على التهجين من الإكسونات المستهدفة للكشف عن الطفرات المرتبطة بالسرطان في الأورام المجمدة والطازجة FFPE بواسطة تسلسل المتوازية. هذه الطريقة تمكن من تحديد الطفرات تسلسل، نسخ التعديلات العدد، وحدد إعادة ترتيب الهيكلية التي تنطوي على جميع الجينات المستهدفة. استهداف تسلسل اكسون يقدم روقال انه يستفيد من إنتاجية عالية وتكلفة منخفضة، وتغطية تسلسل عميق، وبالتالي منح حساسية عالية للكشف عن الطفرات التردد المنخفض.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تحديد "سائق" الأحداث الجينية في الورم المسرطنة الرئيسية وورم القامع الجينات تلعب دورا أساسيا في تشخيص وعلاج العديد من أنواع السرطان 1. وقد مكنت الجهود البحثية على نطاق واسع باستخدام المتوازية "الجيل القادم" التسلسل تحديد الكثير من هذه الجينات المرتبطة بالسرطان في السنوات الأخيرة 2. ومع ذلك، تتطلب هذه المنصات التسلسل عادة كميات كبيرة من الحمض النووي المعزولة من أنسجة الطازجة المجمدة، مما يشكل عائقا كبيرا في تشخيص وتحليل الطفرات الحمض النووي من الأنسجة الحفاظ عليها، مثل البارافين الثابتة الفورمالين جزءا لا يتجزأ من (FFPE) عينات الورم. سوف تحسين الجهود لبكفاءة وبشكل موثوق تميز المعلومات الجينية "للتنفيذ" من عينات الورم FFPE تمكين تحليل بأثر رجعي من العينات المخزنة سابقا، ومواصلة تشجيع النهج الفردي لإدارة السرطان.

تقليديا، د الجزيئيةوقد اعتمدت مختبرات iagnostic على والمنهجيات المنخفضة الإنتاجية تستغرق وقتا طويلا مثل سانجر تسلسل وPCR الوقت الحقيقي لتحديد ملامح طفرة الحمض النووي. وفي الآونة الأخيرة، تم تطوير أساليب إنتاجية أعلى باستخدام PCR المضاعفة أو الطيفي التنميط الجيني الشامل للتحقيق الطفرات الجسدية المتكررة في جينات السرطان الرئيسية 3-5. هذه النهج، ومع ذلك، وتقتصر في ذلك فقط المحددة مسبقا "نقطة ساخنة" الطفرات ويعاير، مما يجعلها غير صالحة للكشف عن الطفرات في الورم تعطيل الجينات القامع. تسلسل المتوازية يقدم العديد من المزايا أكثر من هذه الاستراتيجيات بما في ذلك القدرة على استجواب الإكسونات كامل للطفرات أمر شائع ونادر، والقدرة على الكشف عن الطبقات الإضافية من التعديلات الجيني مثل المكاسب والخسائر في عدد النسخ، وزيادة حساسية الكشف في عينات غير متجانسة 6، 7 . يمثل تسلسل الجينوم كله النهج الأكثر شمولا لاكتشاف طفرة، على الرغم من أنه أمر نسبيويتحمل تكلفة لاي مطالب الحسابية الكبيرة لتحليل البيانات والتخزين.

بالنسبة إلى التطبيقات السريرية، حيث لا يوجد سوى جزء صغير من الجينوم قد تكون ذات فائدة السريرية، كانت اثنين من الابتكارات في مجال التكنولوجيا خاصة التسلسل التحويلية. أولا، من خلال التهجين القائم على التقاط اكسون، يمكن للمرء أن عزل الحمض النووي الموافق الجينات المرتبطة بالسرطان الرئيسية للطفرة التنميط استهدافا 8. ثانيا، من خلال ربط الباركود الجزيئية (أي تسلسل الحمض النووي 6-8 النيوكليوتيدات في الطول)، يمكن للمرء أن تجمع مئات العينات في المدى التسلسل واستفادة الكاملة من قدرة متزايدة من الصكوك تسلسل المتوازية 10. عند الجمع، وهذه الابتكارات تمكين الأورام ليكون موجز لانخفاض تكلفة وأعلى إنتاجية في، مع المتطلبات الحسابية أصغر 11. علاوة على ذلك، من خلال إعادة توزيع التغطية تسلسل فقط تلك الجينات الأكثر أهمية لتطبيق معين، يمكن للمرء achieلقد بمزيد من التعمق تسلسل لأعلى حساسية الكشف عن انخفاض وتيرة الأحداث أليل.

نحن هنا وصفا لدينا IMPACT مقايسة (الطفرة التنميط المتكاملة من الأهداف المنحى السرطان)، الذي يستخدم القبض على اكسون حمامات مكتبة تسلسل barcoded بواسطة التهجين باستخدام [أليغنوكليوتيد مخصصة لالتقاط كل الإكسونات الترميز البروتين وحدد الإنترونات من 279 الجينات المرتبطة بالسرطان الرئيسية (الجدول 1 ). هذه الاستراتيجية تمكن تحديد الطفرات، indels، والتعديلات في عدد النسخ، وحدد إعادة ترتيب الهيكلية التي تنطوي على هذه الجينات 279. أسلوبنا هو متوافق مع الحمض النووي المعزولة من أنسجة سواء الطازجة المجمدة وFFPE وكذلك حرف هاء إبرة دقيقة وعينات الخلايا الأخرى.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. الحمض النووي وإعداد الكاشف

ملاحظة: يصف هذا البروتوكول تجهيز في وقت واحد وتحليل 24 عينة (على سبيل المثال 12 الورم / أزواج عادي) ولكن يمكن تكييفها لدفعات أصغر وأكبر. عينات من الحمض النووي قد تنبع من FFPE أو الأنسجة الطازجة المجمدة، عينات الخلوي، أو الدم. عادة، سيتم محة سواء الورم والأنسجة الطبيعية من نفس المريض معا من أجل التمييز الطفرات الجسدية من الأشكال الموروثة. يبدأ بروتوكول التالية استخراج الحمض النووي على الفور.

  1. قسامة 50-250 نانوغرام (250 نانوغرام مستحسن) من الحمض النووي المستخرج لكل عينة، مخففة في 1X تريس، EDTA (8.0 درجة الحموضة) العازلة إلى الحجم النهائي من 50 ميكرولتر، في Covaris أنابيب أسفل جولة منفصلة.
  2. القص الحمض النووي على الصك Covaris E220 في إعدادات القص التالية: 360 ثانية في 10 عامل واجب، 175 PIP، و 200 دورة في انفجار.
  3. ذوبان الجليد AMPure XP الخرز (الجدول 2) إلى درجة حرارة الغرفة. ذوبان الجليد كل بوffers والإنزيمات على الجليد قبل الخطوة المناسبة.

2. وحدة اصلاح النهاية - إعداد مكتبة

  1. تحضير مزيج الرئيسي إصلاح غاية في أنبوب microcentrifuge العقيمة باستخدام وحدات التخزين التالية لكل عينة: 10 ميكرولتر من 10X NEBNext النهاية اصلاح التفاعل العازلة (الجدول 2)، 5 ميكرولتر NEBNext النهاية إصلاح أنزيم ميكس (الجدول 2)، 35 ميكرولتر نوكلياز معقمة مجانا H 2 O.
  2. قسامة 50 ميكرولتر من كل الحمض النووي المنفصمة في آبار منفصلة من لوحة 96 جيدا. إضافة 50 ميكرولتر من استعداد إصلاح نهاية مزيج الرئيسي إلى كل رد فعل. احتضان في thermocycler لمدة 30 دقيقة عند 20 درجة مئوية.

3. إصلاح آخر نهاية تنظيف

  1. إضافة حجم 2X (200 ميكرولتر) من AMPure XP الخرز (الجدول 2) لكل عينة وماصة بلطف وحدة التخزين بالكامل صعودا وهبوطا 10X باستخدام pipettor الأقنية. احتضان عند RT لمدة 15 دقيقة.
  2. وضع على الوقوف المغناطيسي (الجدول 2
  3. إزالة بلطف وتجاهل واضح الرعاية أخذ طاف على عدم تعكير صفو الخرز. قد تبقى بعض السائل في الآبار.
  4. مع أنابيب على الوقوف، إضافة بلطف 200 ميكرولتر من الطازجة 80٪ من الإيثانول إلى كل عينة واحتضان لوحة في درجة حرارة الغرفة لمدة 30 ثانية. بعناية، وإزالة الإيثانول عن طريق ماصة.
  5. كرر الخطوة 5، ليصبح المجموع 2 يغسل الايثانول. ضمان تمت إزالة جميع الايثانول. إزالة من الوقوف المغناطيسي واسمحوا الجافة في RT لمدة 5 دقائق.
  6. في resuspend حبات المجففة مع 44.5 H العقيمة ميكرولتر 2 O. بلطف، ماصة كامل حجم صعودا وهبوطا 10X خلط دقيق. لم تعد تعلق ضمان الخرز إلى جانب البئر.
  7. احتضان حبات معلق على RT لمدة 2 دقيقة. وضع على الوقوف المغناطيسي لمدة 5 دقائق حتى يظهر عينة واضحة.
  8. نقل بلطف 42 ميكرولتر من طاف واضحة تحتوي على عينة لبئر جديد.
    يمكن أن توقف الإجراء بأمان في هذه الحادي والجيش الشعبي وتخزين العينات في -20 درجة مئوية لمدة تصل إلى 7 أيام. إلى إعادة تشغيل العينات المجمدة ذوبان الجليد على الجليد قبل المتابعة.

4. إعداد مكتبة - DA-المخلفات وحدة

  1. تحضير مزيج الرئيسي DA-المخلفات في أنبوب microcentrifuge العقيمة باستخدام وحدات التخزين التالية لكل عينة: 5 ميكرولتر من 10X NEBNext DA-المخلفات رد فعل العازلة (الجدول 2)، 3 ميكرولتر (3'-5 'إكسو) Klenow جزء (الجدول 2 ).
  2. إضافة 8 ميكرولتر من استعداد DA-المخلفات مزيج الرئيسي لتحتوي كل منها على 42 بئر ميكرولتر من الحمض النووي إصلاحه نهاية. احتضان في thermocycler لمدة 30 دقيقة عند 37 درجة مئوية.
  3. إجراء آخر DA-المخلفات تنظيف: كرر الخطوات من 3،1-3،8 باستخدام حجم 2X (100 ميكرولتر) من الخرز، ولكن resuspend في H 2 O معقمة إلى الحجم النهائي من 33.75 ميكرولتر.
    يمكن أن توقف الإجراء بأمان في هذه الخطوة وتخزين العينات في -20 درجة مئوية لمدة تصل إلى 7 أيام. إلى إعادة تشغيل العينات المجمدة ذوبان الجليد على الجليد قبل المتابعة. </ لى>

5. إعداد مكتبة - محول ربط وحدة

  1. تحضير مزيج الرئيسي ربط في أنبوب microcentrifuge العقيمة باستخدام وحدات التخزين التالية لكل عينة: 10 ميكرولتر من 5X NEBNext خيارات ربط رد فعل العازلة (Biolabs نيو انغلاند، الجدول 2)، 5 ميكرولتر السريع T4 DNA يغاز (الجدول 2).
  2. إضافة 15 ميكرولتر من مزيج الرئيسي ربط إلى كل بئر يحتوي على الحمض النووي دا الذيل.
  3. إضافة 1.25 ميكرولتر من 25 ميكرومتر المناسبة NEXTflex محول barcoded (الجدول 2) إلى كل بئر. يجب أن تتلقى كل عينة محول barcoded منفصلة. احتضان في thermocycler لمدة 15 دقيقة عند 20 درجة مئوية.
  4. أداء محول آخر ربط التنظيف: كرر الخطوات من 3،1-3،8 باستخدام 1X حجم (50 ميكرولتر) من الخرز، ولكن resuspend في H 2 O معقمة إلى الحجم النهائي من 50 ميكرولتر.
  5. كرر الخطوات من 3،1-3،8 لحجم 1X الثانية (50 ميكرولتر) تنظيف، ولكن resuspend في العقيمة H 2 O لالحجم النهائي من 23 ميكرولتر.
    يمكن أن توقف الإجراء بأمان في هذه الخطوة وتخزين العينات في -20 درجة مئوية لمدة تصل إلى 7 أيام. إلى إعادة تشغيل العينات المجمدة ذوبان الجليد على الجليد قبل المتابعة.

6. التضخيم المكتبة

  1. تحضير مزيج الرئيسي KAPA هيفي في أنبوب microcentrifuge العقيمة باستخدام وحدات التخزين التالية لكل عينة: 25 ميكرولتر 2X KAPA هيفي HS RM (الجدول 2)، 1 ميكرولتر من كل 100 ميكرومتر التمهيدي 1 و 2 التمهيدي (الجدول 3).
  2. إضافة 27 ميكرولتر من مزيج الرئيسي إلى كل بئر يحتوي على المنتج ربط. تعيين ماصة إلى 50 ميكرولتر ماصة بلطف وحدة التخزين بالكامل صعودا وهبوطا 10X.
  3. وضع في thermocycler لدورات PCR التالية: تمسخ الأولي من 45 ثانية في 98 درجة مئوية، 10 دورات من 15 ثانية في 98 درجة مئوية، و 30 ثانية في 60 درجة مئوية، و 30 ثانية في 72 درجة مئوية، والتمديد النهائي من 1 دقيقة في 72 درجة مئوية.
  4. إجراء آخر التضخيم تنظيف: كرر الخطوات من 3،1-3،8 باستخدام1X حجم (50 ميكرولتر) من AMPure XP الخرز، وresuspend في الماء المعقم إلى الحجم النهائي من 30 ميكرولتر.
  5. قياس تركيز كل مكتبة واسعة المدى و qubit باستخدام الفحص (تقنيات الحياة، الجدول 2) وفقا لتعليمات الشركة الصانعة.

7. روش Nimblegen SeqCAP EZ مكتبة التهجين، واغسل، والتضخيم

  1. ذوبان الجليد حاصرات قليل النوكليوتيد العالمية ومؤشر (الجدول 3)، مكتبة EZ SeqCap، ومكونات القبض Nimblegen (DNA COT، العازلة التهجين 2X، والتهجين مكون A، الجدول 2) على الجليد. يتم تخزين كافة حاصرات نيوكليوتيدات دقيقة في مخزونات العمل من 1 ملم. مكتبة EZ SeqCap لدينا هو تجمع مصمم خصيصا لالتقاط تحقيقات تشمل جميع الإكسونات الترميز البروتين من 279 الجينات المرتبطة بالسرطان، وإن كان العرف وكتالوج تصاميم أخرى يمكن استخدامها.
  2. إعداد تجمع 1 ملم من حاصرات مؤشر نيوكليوتيدات دقيقة المقابلة لإعلان barcoded محددةتسلسل aptor المستخدمة في إعداد المكتبة. الجمع بين 1 ميكرولتر من كل مانع، ودوامة.
  3. في العقيمة 1.5 مل أنبوب microcentrifuge جديدة، إضافة 5 ميكرولتر من الحمض النووي COT 1mg/ml، 2 ميكرولتر من 1 ملم مانع عالمية و 2 ميكرولتر من 1 ملم مجموعة من حاصرات مؤشر نيوكليوتيدات دقيقة.
  4. تجمع 24 مكتبات barcoded في رد فعل واحد. إضافة ما مجموعه 1-3 ميكروغرام من المجمعة، مكتبة تسلسل barcoded (أعدت أعلاه) إلى خليط الالتقاط. لمدة 24 عينات، فمن المستحسن 100 نانوغرام لكل عينة. عند تجميع عينات الأورام والعادي المتطابقة، أوصينا إضافة المزيد من مكتبة الورم (مثلا 100 نانوغرام في الورم و 50 نانوغرام لكل العادي) بحيث يتم التسلسل لهم بمزيد من التعمق التغطية.
  5. إغلاق غطاء أنبوب وجعل 15-20 ثقوب في الجزء العلوي من الغطاء مع 18-20 G أو أصغر إبرة. سرعة بطالة في تضخيم عينة مكتبة / COT الحمض النووي / oligos في فراغ المكثف الحمض النووي على حرارة عالية (60 درجة مئوية).
  6. مرة واحدة جفت تماما أسفل، مع ترطيب 7.5 ميكرولتر من 2X hybridiاالنترنت العازلة ويجب 3 ميكرولتر من التهجين عنصر A. يحتوي أنبوب الآن ما يلي: 5 ميكروغرام الحمض النووي COT، ميكروغرام متغير مكتبة عينة تضخيم و 1000 من بمول العالمي ومؤشر Oligos، العازلة 7.5 ميكرولتر 2X التهجين، 3 ميكرولتر التهجين المكون A في إجمالي حجم 10.5 ميكرولتر.
  7. تغطية فتحات في السقف مع قطعة صغيرة من الشريط المختبر. دوامة العينة لمدة 10 ثانية وأجهزة الطرد المركزي في أقصى سرعة لمدة 10 ثانية.
  8. احتضان العينة على 95 درجة مئوية لمدة 10 دقيقة لتفسد الحمض النووي، تليها الطرد المركزي في أقصى سرعة لمدة 10 ثانية في RT.
  9. في الجديدة 0.2 مل أنبوب PCR قطاع، وإعداد 2.25 ميكرولتر قسامة من SeqCap EZ تحقيقات القبض على المكتبة و2.25 ميكرولتر من العقيمة نوكلياز مجانا H 2 O وإضافة محتويات الخطوة 7.7. ماصة بلطف وحدة التخزين بالكامل صعودا وهبوطا 10X.
  10. احتضان في cycler الحرارية في 47 درجة مئوية لمدة 48-96 ساعة. تعيين والحفاظ على درجة حرارة الغطاء على cycler الحرارية إلى 57 درجة مئوية.
  11. فلخطوات منخفضة في الفصل 6 من دليل NimbleGen SeqCap مكتبة EX SR المستخدم V3.0 (الجدول 2) لغسل والانتعاش من الحمض النووي التي تم التقاطها.
  12. يتبع الخطوات في الفصل 7 من بروتوكول روش NimbleGen لالتضخيم من الحمض النووي التي التقطتها مع التعديلات التالية:
    • استخدام 2X KAPA هيفي البلمرة (الجدول 2) بدلا من Phusion عالية الدقة PCR ماجستير ميكس
    • استخدام 100 ميكرومتر التمهيدي 1 و 2 التمهيدي المدرجة في الجدول 3.
    • تشغيل PCR الظروف التالية: تمسخ الأولي في 98 درجة مئوية لمدة 30 ثانية، 11 دورات من 98 درجة مئوية لمدة 10 ثانية و 60 درجة مئوية لمدة 30 ثانية و 72 درجة مئوية لمدة 30 ثانية، والتمديد النهائي في 72 درجة مئوية لمدة 5 دقائق . عقد في 4 درجات مئوية.
  13. قياس تركيز الحمض النووي القبض على تضخيمها باستخدام و qubit حساسية عالية الفحص (الجدول 2) وفقا لتعليمات الشركة الصانعة.
  14. تحليل نوعية الحمض النووي استولت باستخدام اجيلنت بيومحلل الحمض النووي HS رقاقة (الجدول 2) وفقا لتعليمات الشركة الصانعة.
    • يجب أن يكون العائد PCR لا يقل عن 100 نانوغرام (المدى 100-1،000 نانوغرام).
    • يجب أن يكون متوسط ​​طول القطعة بين 150-400 أزواج القاعدة.

8. البورشيد مرحبا تسلسل تسلسل

  1. تمييع DNA القبض تضخيم ل14:00، وتحميل العينة على حارة واحدة من خلية تدفق البورشيد HiSeq 2000. تسلسل تقرن نهاية الزوج 75 قاعدة يقرأ وفقا لتعليمات الشركة الصانعة. في تجربتنا، وممر واحد يكفي لتغطية إنتاج تسلسل فريد 500-700X لكل عينة في 279 الجينات لمجموعة من 24 عينة.
  2. البورشيد البرمجيات (ريال تحليل الوقت) سيتم تحويل صور عالية الدقة لشدة الكتلة إلى قاعدة المكالمات وعشرات الجودة. استخدام CASAVA لdemultiplex البيانات وفقا لهوية الباركود وإنشاء ملفات FASTQ الفردية لكل عينة.

9. الشرج البياناتysis

  1. محول تسلسل تقليم من 3 'نهاية تسلسل يقرأ في ملفات FASTQ باستخدام Cutadapt ( http://code.google.com/p/cutadapt/ ). الحد الأدنى لطول التداخل (-O) هو 3 مع معدل الخطأ (ه) من 1٪. الحد الأدنى لطول قاعدة لاستبقاء المقترنة يقرأ بعد التشذيب هو 25.
  2. محاذاة تسلسل يقرأ على الإشارة hg19 الجينوم البشري باستخدام أداة الجحور-يلر أليجنر (التحالف) 12. تنفيذ الخطوات مرحلة ما بعد المعالجة بما في ذلك وضع علامات مكررة، المحلية متعددة إعادة تسلسل، ونوعية قاعدة النتيجة إعادة تقويم باستخدام أدوات تحليل الجينوم (GATK) وفقا لأفضل الممارسات القياسية ( http://www.broadinstitute.org/gatk/guide/topic؟ اسم = أفضل الممارسات ) 13. عندما التنميط عينات متعددة من نفس المريض (مثل الورم المتطابقة والعادي)، يجب أن تكون محلية متعددة إعادة تسلسل ادائهاميد معا. الناتج من هذه الخطوات بعد تجهيز ملف BAM منفصلة لكل عينة، والتي تحتوي على كافة تسلسل، والجودة، والمعلومات المحاذاة ويمكن تحميلها مباشرة في علم الجينوم التكاملية عارض (IGV) لتصور من يقرأ وتسلسل المتغيرات 14.
  3. حساب مقاييس الأداء تسلسل باستخدام أدوات بيكار ( http://picard.sourceforge.net/ ). وتشمل المقاييس بالمعلومات معدل المحاذاة، حجم التوزيع جزء، GC-المحتويات المرتبطة تحيز التغطية، وعلى الهدف التقاط خصوصية، PCR مكررة معدل والتعقيد المكتبة، ويعني التغطية المستهدفة. يتم عرض القيم ممثل في الشكل 1. وتستخدم الترددات أليل في مواقع تعدد الأشكال شيوعا حسابها باستخدام DepthOfCoverage من GATK لرصد التلوث من الحمض النووي لا علاقة لها، وضمان أن جاءت عينات المتطابقة من نفس المرضى.
    التحليلات الحسابية التالية تعتمد على وجود المتطابقةورم وطبيعية عينات للكشف عن تغيرات جينية جسدية. ويمكن أيضا أن تحلل الأورام لا مثيل لها باستخدام عينة منفصلة تحكم عادية، ولكن الطفرات الأكثر جسدية لا يمكن بسهولة التمييز بين المتغيرات تسلسل الموروثة.
  4. استدعاء المتغيرات الجسمية النوكليوتيدات واحد (SNVs) لكل زوج للورم العادي باستخدام المتصل طفرة جسدية، مثل muTect 15، SomaticSniper 16، أو 17 ستريلكا. نستخدم muTect مع معايير التصفية تعديل، مما يسمح للمتغيرات مع انخفاض (غير صفرية) التهم أليل في العينة طبيعية طالما تردد أليل هو 5X على الأقل أكبر في الورم. تتم إزالة المتغيرات دعا متكررة في لجنة من السلطات الوطنية المعينة كالمعتاد التحف المنهجي المحتمل لتسلسل أو المحاذاة. ثم يتم مراجعة كل SNV تمرير مرشحات بعناية باستخدام IGV.
  5. استدعاء indels الجسدية لكل زوج للورم العادي باستخدام خوارزميات مثل SomaticIndelDetector 13، Dindel 18، أو 19 SOAPindel
  6. استقراء الوضع نسخة رقم من التغطية في تسلسل الإكسونات الهدف. لكل عينة على حدة، إجراء تطبيع اللوس التغطية تسلسل متوسط ​​لجميع الإكسونات الهدف، الانحدار على نسبة GC. ضبط القيم التغطية unnormalized بطرح صالح اللوس واضاف ان متوسط ​​التغطية على نطاق العينة. حساب نسبة التغطية في تسلسل تطبيع في جميع الإكسونات هدفا للأزواج للورم العادية. في حالة عدم وجود عينة طبيعية المتطابقة و / أو لتقليل الضوضاء، وغيرها مضاعفا المطابقة بين الجنسينالضوابط العادية التي تفتقر إلى سلالة الجرثومية المتغيرات في عدد النسخ يمكن استخدامها. تحديد عدد النسخ المكاسب والخسائر الجسدية على أساس الزيادة أو النقصان في نسبة التغطية.
  7. استدعاء إعادة ترتيب الجسدية التي تنطوي على جينات السرطان حيث تقع نقطة الجيني واحد على الأقل داخل أو بالقرب من الفاصل الزمني المستهدف من الجينوم. وتشمل خوارزميات اقترح GASV 20، Breakdancer 21، كريست 22، وdRanger 23. ويمكن التمييز بين ظاهرة الانقلاب داخل الصبغي، والحذف، والازدواجية جنبا إلى جنب على أساس الوضع النسبي والتوجه لدعم يقرأ في أزواج المتنافرة. ينبغي إعادة النظر في كل إعادة ترتيب المرشح يدويا باستخدام IGV. نوصي التحقق التجريبي عن طريق PCR والتسلسل سانجر عبر نقاط إعادة ترتيب المفترضة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تم القبض على واحد مجموعة من 24 مكتبات barcoded تسلسل (12 زوجا للورم عادي) باستخدام مجسات المقابلة لجميع الإكسونات الترميز البروتين من 279 جينات السرطان والتسلسل كما يقرأ 2 × 75 نقطة أساس على حارة واحدة من خلية تدفق HiSeq 2000. وكان يتم تجميع الورم والمكتبات العادية في نسبة 2:1. وأظهرت مقاييس الأداء عينة لمجموعة من العينات المجمدة الحمض النووي ورم في الشكل 1، بما في ذلك معدل المحاذاة، حجم التوزيع جزء، على التقاط الهدف والنوعية، ويعني التغطية المستهدفة. المثال الطفرات الجسدية، وتظهر الإدراج، والحذف، والتغييرات في عدد النسخ في أرقام 2-4.

الشكل 1
الشكل 1. الأرقام ممثل مقاييس الأداء التسلسل. أ) كثافة الكتلة ومعدل المحاذاة، ب) يعني التغطية المستهدفة، > ج) إدراج حجم التوزيع، ود) التقاط خصوصية. اضغط هنا لمشاهدة صورة بشكل اكبر .

الرقم 2
الشكل 2. علم الجينوم التكاملية عارض (IGV) صورة تظهر خصوصية التغطية تسلسل في الإكسونات من EGFR في سرطان الرئة (أعلى) ويقابل الأنسجة الطبيعية (القاع). قضبان رمادي تمثل يقرأ تسلسل فريد من نوعه. في الحق، طفرة T> G متخالف موجود في 24٪ من يقرأ في الورم و0٪ من يقرأ في العادي، مشيرا إلى أن ذلك هو إجراء تبديل L858R الأحماض الأمينية الجسدية. اضغط هنا لمشاهدة صورة بشكل اكبر .

3 "FO: محتوى العرض =" 6in "سرك =" / files/ftp_upload/50710/50710fig3.jpg "العرض =" 600px ل"/>
الرقم 3. أمثلة من indels في سرطان القولون والمستقيم الورم العادي الزوج: أ) الإدراج انزياح الإطار الجسدية في APC ب) حذف انزياح الإطار الجسدية من 7 أزواج في قاعدة TP53 اضغط هنا لمشاهدة صورة بشكل اكبر .

الرقم 4
الشكل 4. تغييرات في عدد النسخ في زوج الورم العادي. كل نقطة بيانات يمثل اكسون احد من 279 الجينات المستهدفة. يتم الاستدلال نسخة المكاسب والخسائر عدد من الزيادة والنقصان في التغطية تسلسل الورم. اضغط هنا لمشاهدة صورة بشكل اكبر .

gether.within صفحة = "دائما"> الجدول 1: دقق تصميم ميزات لقطة الهدف.

مجموع الإكسونات 4،535
مجموع الإنترونات 14
تعدد الأشكال * 1042
مجموع الأراضي المستهدفة 879966 basepairs
مجموع أراضي التحقيق 1400415 basepairs

الجدول 2. الكواشف ومجموعات.

اسمكاشف / المواد شركة عدد التسويقي
NEBNext النهاية وحدة اصلاح جديدة إنجلاند Biolabs E6050L
NEBNext DA-التعقب وحدة جديدة إنجلاند Biolabs E6053L
NEBNext ربط سريع وحدة جديدة إنجلاند Biolabs E6056L
Agencourt AMPure XP بيكمان كولتر الجينوم
NEXTflex PCR خالية من الرموز الشريطية - 24 Bioo العلمية 514103
هيفي مكتبة التضخيم كيت KAPA النظم البيولوجية KK2612
COT DNA الإنسان، فلوروميتريك العلمية روش تشخيص 05 480 647 001
NimbleGen EZ SeqCap التهجين وغسل عدة روش NimbleGen 05 634 261 001
الطعوم مكتبة EZ SeqCap روش NimbleGen
QIAquick PCR تنقية كيت QIAGEN 28104
و qubit dsDNA ومجموعة واسعة (BR) الفحص كيت تقنيات الحياة Q32850
و qubit dsDNA وحساسية عالية (HS) الفحص كيت تقنيات الحياة Q32851
اجيلنت الحمض النووي HS كيت اجيلنت تكنولوجيز 5067-4626، 4627
2100 اجيلنت Bioanalyzer اجيلنت تكنولوجيز
Covaris E220 Covaris
المغناطيسي حامل-96 AMBION AM10027
البورشيد مرحبا تسلسل 2000 البورشيد

الجدول 3. مؤشر جزئية الحاجزون والاشعال متواليات.

TS-INV-HE مؤشر مانع 2
TS-HE العالمي مانع AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TS-INV-HE مؤشر مانع 1 CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر مانع 3 CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 4 معوق CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر مانع 5 CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر مانع 6 CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 7 مانع CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 8 مانع CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 9 معوق CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 10 معوق CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 11 معوق CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 12 معوق CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 13 معوق CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 14 معوق CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 15 معوق CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 16 معوق CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 18 معوق CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 19 معوق CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 20 معوق CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 21 معوق CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 22 معوق CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 23 معوق CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 25 معوق CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE مؤشر 27 معوق CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
التمهيدي 1 5'-AATGATACGGCGACCACCGAGATCT-3 '
التمهيدي 2 5'-CAAGCAGAAGACGGCATACGAGAT-3 '

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

لدينا IMPACT فحص تنتج نسبة عالية المحاذاة، وارتفاع معدل على الهدف، التغطية المستهدفة عالية، وحساسية عالية للكشف عن الطفرات، indels، ونسخ التعديلات العدد. لقد أثبتنا قدرة لدينا فحص الحمض النووي لIMPACT تسلسل من كلا الطازجة المجمدة وأرشفة عينات الحمض النووي FFPE من المدخلات منخفضة. عن طريق إجراء تسلسل اكسون تستهدف الجينات المرتبطة بالسرطان الرئيسية، يمكن للمرء أن تحقيق التغطية تسلسل عميق جدا لالإكسونات من هذه الجينات الأكثر أهمية مما تعظيم القدرة على الكشف عن الطفرات التردد المنخفض. استخدام المتوازية ومضاعفة تمكن أعلى إنتاجية، وانخفاض التكلفة لكل عينة، وانخفاض كميات المدخلات من الحمض النووي.

وهناك فائدة من النهج المستهدف هو أنه من المجدي لتحسين تحقيقات التقاط بحيث يتم تغطية جميع الإكسونات بشكل موحد وبما فيه الكفاية للكشف عن الطفرات. كما هو مبين في الجدول رقم 1، لدينا تصميم يشمل 4،535 الإكسونات في 279 الجينات. بعد التحسينات المتكررة للدينا تصميم، تجربة نموذجية التسلسل لا ينتج أكثر من 2٪ من الإكسونات في أقل من 20٪ من التغطية وسيطة لعينة بأكملها. وبالتالي، لاستئصال ورم التسلسل إلى 500X تغطية التسلسل (وهو تقدير متحفظ كما هو معروض في الشكل 1)،> وسيتم تغطية 98٪ من الإكسونات التي كتبها> 100X عمق، وضمان حساسية عالية لتحديد الطفرات التردد المنخفض. هذا التوحيد من التغطية ويمكن أن يعزى إلى حد كبير إلى مرونة النظام Nimblegen SeqCap، حيث يمكن توليفها تحقيقات لأطوال مختلفة في مناطق مختلفة من تكوين النوكليوتيدات. ونحن أيضا استخدمت بنجاح توليفها بشكل فردي أليغنوكليوتيد البيروكسيديز من تقنيات الحمض النووي المتكاملة (IDT) لإضافة محتوى جديد إلى لوحة لدينا وتعزيز تغطية المناطق التي يصعب التقاط و / أو التسلسل. من خلال التقاط أيضا تحديد الإنترونات من الجينات ترتيبها متكرر، ونحن قادرون على إعادة ترتيب الهيكلية تحديد الجينات المنتجة الانصهار حتى عندما fusio واحد فقطيتم التقاط ن الشريكة.

هذا النهج التسلسل المستهدفة لا يملكون اثنين من القيود الرئيسية في القدرة على الكشف عن "سائق" التعديلات الجينية في الأورام. الأولى، يتم استجوابه إلا جزء من الجينوم. التسلسل المستهدف هو، بحكم طبيعتها، محدودة. كما جينات سرطان جديدة تظهر من جهود منهجية علم الجينوم، فإنها يمكن أن يضاف بسرعة إلى لوحة الالتقاط، ولكن قد يكون غاب الطفرات الهامة وظيفيا التي سيتم الكشف عنها بواسطة الجينوم كله أو كله التسلسل exome. الثاني، فإنه يقتصر على التعديلات المعتمدة على الحمض النووي. الكشف عن محاضر أعرب aberrantly، الإسوية لصق الرواية، واندماج الجينات يتطلب تسلسل الحمض النووي الريبي أو تقنيات مشابهة 24. تعديلات جينية مثل التعديلات لونين والحامض النووي قد تلعب أيضا دورا رئيسيا في تكون الأورام وتطور الورم. مع استمرار تقنيات التسلسل لتحسين، يمكن للمرء تصور استراتيجيات متكاملة توظف كامل تسلسل الجينوم، تسلسل الحمض النووي الريبي وapproa التكميليةالشطرنج لتوصيف شامل الجينية وجينية المكياج الأورام الفردية على أساس روتيني 25. استراتيجيات متكاملة كما هي كاملة ويعرض حاليا من حيث التكلفة وحسابيا-باهظة، التسلسل استهدف بديل عملي لالتقاط ملامح الجيني لأبرز التطبيقات السريرية ومتعدية.

يفترض أن لدينا بروتوكول الأورام ومتسلسلة إلى جانب مطابقة الأنسجة الطبيعية المأخوذة من نفس المريض. الغرض من هذه السيطرة العادي هو لتحديد ما إذا كان الكشف عن تسلسل المتغيرات في الورم موروثة أو مكتسبة جسديا. في حالة عدم وجود مطابقة طبيعي، يمكن للمرء أن يستنتج أن المتغيرات التي تحدث في النقاط الساخنة طفرية (أي مواقع الطفرات الجسدية المتكررة في أنواع أخرى من السرطان) من المحتمل أن تكون جسدية. علاوة على ذلك، تحليل المكاسب والخسائر في عدد النسخ التي يمكن إجراؤها باستخدام عينة العادي مضاعفا غير المتطابقة وراثيا. لجميع تغيرات جينية رواية أخرى، متزامنةتحليل الأوس من الأنسجة الطبيعية المتطابقة يبسط إلى حد كبير تفسير البيانات الناتجة طفرة وينصح بشدة.

بروتوكول IMPACT الموصوفة هنا يوضح الاتساق وأداء عالي الجودة للعينات المجمدة. وقد لاحظنا التباين في بعض الأحيان عند العمل مع عينات FFPE، وإن كان. اعتمادا على العمر ونوعية العينة FFPE، قد يكون الحمض النووي المتدهورة بشدة أو معدلة كيميائيا، ونتيجة لذلك قد يجعل من الصعب تحليل التسلسل و26. أن يقال، لقد وجدت هذه الظروف التجريبية لتكون موثوقة بالنسبة لغالبية كبيرة من عينات FFPE. ونحن أيضا تطبيقها بنجاح هذا البروتوكول لتوصيف العينات الأخرى ذات الصلة سريريا مثل الخزعات، حرف هاء إبرة دقيقة، والعينات سيتولوجي. ولهذا السبب، المرونة اللازمة لاستيعاب أنواع مختلفة من العينات من نوعية المتغير، والكمية، وعدم التجانس التي تقف هذه الطريقة للتأثير على التشخيصد علاج مرضى السرطان في الساحة السريرية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وقد تلقى الدكتور بيرغر رسوم الاستشارات وتمويل البحوث من مؤسسة الطب، وهي شركة تشخيص السرطان.

Acknowledgments

نشكر الدكتور أغنيس فيالي ومختبر علم الجينوم MSKCC الأساسية للحصول على المساعدة الفنية. وقد تم تطوير هذا البروتوكول بدعم من مركز أبحاث السرطان Beene جيفري ومؤسسة مزارع العائلة.

Materials

Name Company Catalog Number Comments
NEBNext End Repair Module New England Biolabs E6050L  
NEBNext dA-Tailing Module New England Biolabs E6053L  
NEBNext Quick Ligation Module New England Biolabs E6056L  
Agencourt AMPure XP Beckman Coulter Genomics  
NEXTflex PCR-Free Barcodes – 24 Bioo Scientific 514103  
HiFi Library Amplification Kit KAPA Biosystems KK2612  
COT Human DNA, Fluorometric Grade Roche Diagnostics 05 480 647 001  
NimbleGen SeqCap EZ Hybridization and Wash kit Roche NimbleGen 05 634 261 001  
SeqCap EZ Library Baits Roche NimbleGen  
QIAquick PCR Purification Kit Qiagen 28104  
Qubit dsDNA Broad Range (BR) Assay Kit Life Technologies Q32850  
Qubit dsDNA High Sensitivity (HS) Assay Kit Life Technologies Q32851  
Agilent DNA HS Kit Agilent Technologies 5067-4626, 4627  
Agilent 2100 Bioanalyzer Agilent Technologies  
Covaris E220 Covaris  
Magnetic Stand-96 Ambion AM10027  
Illumina Hi-Seq 2000 Illumina  

DOWNLOAD MATERIALS LIST

References

  1. Stratton, M. R., Campbell, P. J., Futreal, P. A. The cancer genome. Nature. 458, (7239), 719-724 (2009).
  2. Meyerson, M., Gabriel, S., Getz, G. Advances in understanding cancer genomes through second-generation sequencing. Nat. Rev. Genet. 11, (10), 685-696 (2010).
  3. Thomas, R. K., Baker, A. C., Debiasi, R. M., et al. High-throughput oncogene mutation profiling in human cancer. Nat. Genet. 39, (3), 347-351 (2007).
  4. Macconaill, L. E., Campbell, C. D., Kehoe, S. M., et al. Profiling critical cancer gene mutations in clinical tumor samples. PLoS One. 4, (11), e7887 (2009).
  5. Dias-Santagata, D., Akhavanfard, S., David, S. S., et al. Rapid targeted mutational analysis of human tumours: a clinical platform to guide personalized cancer medicine. EMBO Mol. Med. 2, (5), 146-158 (2010).
  6. Macconaill, L. E., Van Hummelen, P., Meyerson, M., Hahn, W. C. Clinical implementation of comprehensive strategies to characterize cancer genomes: opportunities and challenges. Cancer Discov. 1, (4), 297-311 (2011).
  7. Taylor, B. S., Ladanyi, M. Clinical cancer genomics: how soon is now. J. Pathol. 223, (2), 318-326 (2011).
  8. Gnirke, A., Melnikov, A., Maguire, J., et al. Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted sequencing. Nat. Biotechnol. 27, (2), 182-189 (2009).
  9. Mamanova, L., Coffey, A. J., Scott, C. E., et al. Target-enrichment strategies for next-generation sequencing. Nat. Methods. 7, (2), 111-118 (2010).
  10. Craig, D. W., Pearson, J. V., Szelinger, S., et al. Identification of genetic variants using bar-coded multiplexed sequencing. Nat. Methods. 5, (10), 887-893 (2008).
  11. Wagle, N., Berger, M. F., Davis, M. J., et al. High-throughput detection of actionable genomic alterations in clinical tumor samples by targeted, massively parallel sequencing. Cancer Discov. 2, (1), 82-93 (2012).
  12. Li, H., Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25, (14), 1754-1760 (2009).
  13. Depristo, M. A., Banks, E., Poplin, R., et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet. 43, (5), 491-498 (2011).
  14. Robinson, J. T., Thorvaldsdottir, H., Winckler, W., et al. Integrative genomics viewer. Nat. Biotechnol. 29, (1), 24-26 (2011).
  15. Cibulskis, K., Lawrence, M. S., Carter, S. L., et al. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat. Biotechnol. 31, (3), 213-219 (2013).
  16. Larson, D. E., Harris, C. C., Chen, K., et al. SomaticSniper: identification of somatic point mutations in whole genome sequencing data. Bioinformatics. 28, (3), 311-317 (2012).
  17. Saunders, C. T., Wong, W. S., Swamy, S., Becq, J., Murray, L. J., Cheetham, R. K. Strelka: Accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 28, (14), 1811-1817 (2012).
  18. Albers, C. A., Lunter, G., Macarthur, D. G., Mcvean, G., Ouwehand, W. H., Din del Durbin, R. Accurate indel calls from short-read data. Genome Res. 21, (6), 961-973 (2011).
  19. Li, S., Li, R., Li, H., et al. Efficient identification of indels from short paired reads. Genome Res. 23, (1), 195-200 (2013).
  20. Sindi, S., Helman, E., Bashir, A., Raphael, B. J. A geometric approach for classification and comparison of structural variants. Bioinformatics. 25, (12), 222-230 (2009).
  21. Chen, K., Wallis, J. W., Mclellan, M. D., et al. BreakDancer: an algorithm for high-resolution mapping of genomic structural variation. Nat. Methods. 6, (9), 677-681 (2009).
  22. Wang, J., Mullighan, C. G., Easton, J., et al. CREST maps somatic structural variation in cancer genomes with base-pair resolution. Nat. Methods. 8, (8), 652-654 (2011).
  23. Drier, Y., Lawrence, M. S., Carter, S. L., et al. Somatic rearrangements across cancer reveal classes of samples with distinct patterns of DNA breakage and rearrangement-induced hypermutability. Genome Res. 23, (2), 228-235 (2012).
  24. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat. Rev. Genet. 10, (1), 57-63 (2009).
  25. Roychowdhury, S., Iyer, M. K., Robinson, D. R., et al. Personalized oncology through integrative high-throughput sequencing: a pilot study. Sci. Transl. Med. 3, (111), 111ra121 (2011).
  26. Kerick, M., Isau, M., Timmermann, B., et al. Targeted high throughput sequencing in clinical cancer settings: formaldehyde fixed-paraffin embedded (FFPE) tumor tissues, input amount and tumor heterogeneity. BMC Med. Genomics. 4, 68 (2011).
الكشف عن التعديلات الوراثية الجسدية في عينات الورم عن طريق التقاط اكسون وتسلسلها الموازي واسع
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Won, H. H., Scott, S. N., Brannon, A. R., Shah, R. H., Berger, M. F. Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing. J. Vis. Exp. (80), e50710, doi:10.3791/50710 (2013).More

Won, H. H., Scott, S. N., Brannon, A. R., Shah, R. H., Berger, M. F. Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing. J. Vis. Exp. (80), e50710, doi:10.3791/50710 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter