Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Crescimento Pairwise competição ensaio para determinar a replicação de Fitness de Imunodeficiência vírus humanos

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Aptidão replicação viral é definida como a capacidade de um vírus para produzir progenitura infecciosa num dado ambiente 1 e é um factor importante na determinação da prevalência de uma variante do vírus a nível da população ao longo do tempo 2. Como estudos in vivo aptidão não era possível com os vírus humanos patogénicos, tais como VIH-1, vários in vitro e ex vivo, os ensaios de aptidão de replicação foram desenvolvidos para estudar os efeitos sobre a aptidão resultantes da resistência à droga e mutações de escape imune, epistasia e a evolução de populações virais 3-6. Entre os diferentes ensaios de aptidão, ensaios de competição de crescimento são reconhecidos para produzir medidas mais sensíveis e válidas de diferenças de fitness, como duas ou mais variantes virais competir para a mesma população de células justamente sob as mesmas condições ambientais, como ocorre in vivo 1,7,8. Antes de iniciar o crescimento experiências de competição, vários variables necessita de ser determinado, incluindo a utilização de diferentes multiplicidades de infecção (MOI), relação de entrada viral, e tempo de amostragem para análise. Estudamos os efeitos desses parâmetros na cinética de crescimento viral e sobre o resultado de experimentos de competição, e identificaram fatores-chave necessários para as medições robustas de HIV-1 em cultura de células de fitness 9.

Além das variáveis ​​de ensaio, há uma variedade de métodos para a quantificação variantes virais em experiências de competição de crescimento. Massa de 10,11 ou 12,13 clonal sequenciação foi usado para determinar o rácio dos vírus que competem com base nas frequências de nucleótidos no sítio (s) de interesse. Aptidão Relativa é derivada de mudanças nesta relação ao longo do tempo. Este método é conveniente como serviços de sequenciação de DNA estão amplamente disponíveis. O alelo-específico sequenciamento paralelo método (PASS) permite sequenciamento em múltiplos locais ea detecção de recombinantes 14 15 ou mutações sinônimas 4,16-18 como marcas para distinguir os vírus concorrentes por seqüenciamento, os ensaios de rastreamento de heteroduplexes (HTA) 4,7,17,19 ou reverter em tempo real reação em cadeia da polimerase transcrição-quantitativa (RT-qPCR) 15,16,18,20, todos os quais podem ser aplicados para estudar estirpes competindo independentemente de similaridade de sequência. É necessário um passo adicional para introduzir marcas em genomas virais e o ensaio de RT-qPCR também requer reagentes e instrumentos específicos. Descobrimos que a granel Sanger rendimentos seqüenciamento resultados comparáveis ​​9.

Seguindo competição crescimento, aptidão replicação virai é apresentada como a aptidão relativa, ou uma relação entre t aptidãoWO variantes virais. A aptidão relativa de um vírus pode ser definido como a proporção final de uma variante virai normalizado pela sua proporção no inoculo inicial ou como a diferença da taxa de crescimento líquido entre os dois vírus concorrentes. Descobrimos que este último método, utilizando pontos de dados longitudinais apenas dentro da fase de crescimento exponencial, produziu os resultados mais robustos 9,20.

Os ensaios in vitro de fitness são utilizados principalmente para estudar biológicos clones 6-8 e clones moleculares infecciosos do HIV-1. Este último, sendo passíveis de manipulação genética, são muitas vezes utilizados para estudar o efeito sobre a aptidão de mutações particulares ou sequências específicas de interesse 3-5,21,22. Os seguintes protocolos de descrever um fluxo de trabalho a partir do ponto de construção de novo de comprimento total de HIV-1 utilizando os clones moleculares infecciosos de HIV-1 vectores contendo uma sequência de etiqueta, a introdução de mutações de interesse, fazendo reservas virais e estabelecer uma cinética de crescimento viral, Para a realização do ensaio de competição e o cálculo do crescimento aptidão relativa (Figura 1).

Usando nossos procedimentos otimizados, criamos três recombinantes de HIV-1 mutantes e determinou a sua aptidão de replicação. O clone molecular recombinante foi construído substituindo a região do gene de HIV-1 gag-p24 de pNL4-3, um plasmídeo contendo um genoma de comprimento total infeccioso do HIV-1 estirpe NL4-3 de laboratório, com um COTB sintético (Centro-OF- Árvore, subtipo B) sequência gag-p24 23 para criar a estirpe protótipo. Mudanças aminoácidos individuais (T186M, T242N, e I256V) foram então introduzidas para criar três clones mutantes. Cada mutante foi competiu contra o vírus protótipo de observar o impacto da aptidão de cada mutação na dada fundo genético. Os três mutantes demonstrado diferentes níveis de fsitness replicação de leve a significativamente menor do que o vírus protótipo. A mutação T242N foi previamente relatado para ter quen moderadass custar 24-26, semelhante ao resultado mostrado neste estudo. O custo da aptidão das outras duas mutações não tinha sido previamente relatado.

Protocol

NOTA: O protocolo, conforme descrito abaixo, não inclui qualquer informação de identificação do paciente e, portanto, não é considerado experimentação com seres humanos pela Universidade de Washington Institutional Review Board ou Seres Humanos Divisão.

1. Construção de quimérico de HIV-1 NL4-3 clones moleculares

1.1) Amplify Inserir DNA Fragment

  1. Conceber iniciadores quiméricos. O metades 5 'de ambos os iniciadores para a frente e reverso contêm uma sequência de vector de HIV-1, em que o fragmento será inserido. A "metade dos iniciadores 3 deve conter a extremidade da sequência de inserção (Figura 2). Certifique-se de que a sequência de iniciador quimérico retém os quadros de leitura abertos originais.
    1. Use iniciadores, pelo menos, 20 bases de comprimento, com uma temperatura de fusão maior do que ou igual a 60 ° C, ~ 50% de teor em GC, e uma baixa tendência para formar dímeros de iniciadores, heterodímeros e / ou estruturas em gancho de cabelo. Avaliar essas propriedadesutilizando a ferramenta web OligoAnalyzer ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. A utilização de PCR 27 e os iniciadores quiméricos para amplificar DNA de inserção (Figura 2). Para cada reacção de PCR, utilizar 1X tampão de alta fidelidade, dNTP 0,2 mM, 1 U de DNA polimerase de alta fidelidade, 0,5 pM de iniciador quimérico para a frente, 0,5 pM de iniciador quimérico inversa, e uma pg0 ng de amostra de DNA contendo a região de inserção. Adicionar dH 2 O para um volume final de 50 ul.
  3. Definir passos de ciclos térmicos do seguinte modo: executar um passo de desnaturação inicial de ADN a 98 ° C durante 10 seg. Amplificar com 30 ciclos de desnaturação de ADN a 98 ° C durante 10 seg e emparelhamento de DNA a 3 ° C acima da temperatura mais baixa de fusão dos dois iniciadores para 20 seg. Realizar uma extensão final a 72 ° C durante 10 min. Armazenar produtos de PCR a 4 ° C.
  4. Tirar 5 ul dos produtos de PCR a partir daetapa anterior e executar electroforese em gel de agarose a 28.
    1. Usar um gel de agarose a 0,7%, 1x tampão TAE (40 mM Tris-acetato, 1 mM de EDTA), 0,5 ug / ml de brometo de etídio (EtBr) a concentração final e escada de 1 kb como o marcador de tamanho de ADN. Set tensão fonte de energia para 5 V / cm de distância entre os eletrodos. Pare a electroforese quando o corante de carga migra através de cerca de 2/3 do comprimento do gel. Visualize o gel usando um sistema de documentação de gel 28.
      NOTA: EtBr é um cancerígeno e deve ser descartado adequadamente, de acordo com regulamentos da instituição. As luvas devem sempre ser usado quando manusear géis contendo EtBr. Mude para novas luvas após EtBr manipulação acabamento contendo material e antes de manipular outros materiais ou equipamentos para evitar a contaminação cruzada.
  5. Se for detectada uma única banda de ADN com o tamanho correspondente ao produto de PCR desejado, purificar o resto do produto de PCR, utilizando um kit comercial, tal como PCR Purification Kit QIAquick acordoção com os protocolos do fabricante.
    1. Caso outras bandas não específicas também estão presentes, utilizar o resto do produto de PCR para executar electroforese em gel preparativa. Use os mesmos parâmetros e condições especificadas no passo 1.1.4. Certifique-se de que o poço de gel é suficientemente grande para carregar ~ 45 ul de produtos de PCR. Cortar a banda de interesse e extrair o ADN a partir do gel utilizando o kit de extracção de gel QIAquick de acordo com os protocolos do fabricante.

1.2) Introduzir o Insert Fragmento em Full-length Infecciosas HIV-1 subtipo B vetorial (pNL4-3)

  1. Use produtos de PCR purificados a partir do passo 1.1.5 como iniciadores de PCR. Use pNL4-3VifA 20 como ADN molde em uma reacção de PCR e usar pNL4-3VifB 20 como molde na reacção de outro (Figura 2). Para cada reacção de PCR, utilizar tampão 1x alta fidelidade, os dNTP 0,2 mM, 2 U de polimerase de DNA de alta fidelidade, 500 ng de ADN do iniciador e 50 ng de ADN molde num volume final deume de 50 ul. Definir os parâmetros dos ciclos térmicos a: 98 ° C durante 30 seg, 35 ciclos a 98 ° C durante 10 seg, 48 ° C durante 1 min e 72 ° C durante 10 min, seguido de 72 ° C durante 10 min.
  2. Adiciona-se 10 U de Dpnl para 50 uL da reacção de PCR e incubar a 37 ° C durante 1 h para digerir o ADN molde. Assegure-se que o DNA de plasmídeo é isolado a partir de uma estirpe bacteriana competente metilação, por exemplo., Escherichia coli TOP10 quimicamente competente.
  3. Uso Dpnl produto digerido para transformar células bacterianas competentes. Use transformação de choque térmico com TOP10 quimicamente competente E. coli, de acordo com o protocolo do fabricante. Para seleccionar as células bacterianas que contêm o plasmídeo recombinante, usar Caldo de Luria (LB) placas de cultura contendo 100 mg / l de carbenicilina.
    1. Escolha ~ 10 colónias bem separadas e crescem, cada, separadamente, em 3 ml de meio LB líquido contendo 100 mg / l de carbenicilina e incubar a 30 ° C numashaker O / N.
    2. Use QIAprep spin kit miniprep para isolar o DNA de plasmídeo a partir da cultura bacteriana líquida, de acordo com o protocolo do fabricante.
  4. Use digestão de restrição dupla 29 para determinar se o DNA do plasmídeo contém o inserto correcto. Certifique-se de que um dos sítios de restrição só existe na região de inserção e o outro local de restrição existe apenas uma vez no vector de VIH-1, do lado de fora da região de inserção.
    1. Digest, pelo menos, 300 ng de DNA plasmídico num volume de reacção final de 10 ul. Escolha de tampões de restrição, temperatura de incubação e tempo de incubação de acordo com o protocolo dos enzimas de restrição seleccionadas do fabricante. Aqui 9 ul do DNA e electroforese em gel de execução digerido tal como descrito no passo 1.1.4. Escolha plasmídeos recombinantes que têm as bandas de ADN com os tamanhos previstos.
  5. Confirmar a integridade da sequência dos plasmídeos recombinantes por seqüenciamento Sanger. Embora raro, indesejadomutação (ões) pode ser introduzida durante as reacções de PCR.
    1. Sequência de ambas as cadeias do DNA de plasmídeo. Siga as instruções no passo 1.1.1.1 para projetar primers de seqüenciamento. Além disso, garantir que a frente e para os iniciadores de sequenciação reversa recozimento pelo menos 50 pb a montante e a jusante da região de inserção no plasmídeo recombinante, respectivamente.
    2. Enviar DNA plasmídeo e iniciadores de sequenciação para um provedor de serviço de sequenciação de ADN comercial. Prepare a amostra de ADN e iniciadores tal como especificado pelo fornecedor de serviços.
  6. Realizar uma livres de endotoxina do DNA de plasmídeo mutagenizado utilizando um kit de ADN plasmídeo de endotoxina livre de acordo com o protocolo do fabricante. Preparar pelo menos 1 ug de DNA do plasmídeo livre de endotoxina para a transfecção no passo seguinte.

1.3) Introduzir escala pequenas mutações Via-Site dirigido mutagênese

  1. Projete iniciadores mutagénicos com sobreposição de frente e iniciadores contendo o desejado reverter mutatiónica (s). Posicionar a base (s) a ser substituído, inserido ou eliminado no meio dos iniciadores, flanqueado por 10-15 bases homólogas. Siga as instruções na etapa 1.1.1.1.
  2. Use PCR para sintetizar plasmídeos mutantes. Para cada reacção de PCR, utilizar tampão de alta fidelidade 1x, 10 mM dNTPs, 2 U de polimerase de DNA de alta fidelidade, 0,5 pM de iniciador mutagénico para a frente, 0,5 pM de iniciador mutagénico inverso e 50 ng de pNL4-3VifB quimérico, a partir do passo 1.2.6 , num volume final de 50 ul. Definir os parâmetros dos ciclos térmicos a: 98 ° C durante 30 seg, 25 ciclos a 98 ° C durante 10 seg, 48 ° C durante 1 min e 72 ° C durante 10 min, seguido de 72 ° C durante 10 min.
  3. Repita o passo 1.2.2 para 1.2.6.

2. Geração de Viral da Usando Transfection

  1. Calcular a quantidade de estoque desejado e plasmídeo de DNA viral necessária. Com um título virai de 10 4 UI / ml ou superior, 1,8 ml de estoque viral é suficiente para dois conjuntos de assa competição crescimentoys, incluindo monoinfections, cada um feito em triplicado. Para uma transfecção feito de uma placa de 6 poços, cerca de 1,8 ml de sobrenadante é colhido por poço. Um? G de DNA de plasmídeo é necessário para cada transfecção feito de uma placa de 6 poços.
  2. Para cada poço de uma placa de 6 poços, 100 ul de preparar mistura de transfecção, por exemplo., Que consiste em 1 uL de X-tremeGENE 9 reagente de transfecção (ou produto semelhante), 1 ug de ADN plasmídeo e DMEM isento de soro.
    1. Determinar o volume de ADN plasmídeo necessário, usando 1 ug de ADN de plasmídeo por poço. Certifique-se de que a concentração final do ADN de plasmídeo é de pelo menos 50 ng / ul.
    2. Determinar quanto é necessário meio isento de soro (DMEM) por poço usando a fórmula: Volume total de DMEM em ul = 100 ul - DNA de volume em ul.
  3. Adiciona-se 10 6 HEK 293T-17 (ATCC) células / cavidade em 2 ml de meio de propagação (DMEM + 10% de soro fetal de bovino (FBS)) em uma placa de 6 poços. Incubar durante 1 hora a 37 ° C numa5% de CO2. Semente como muitos poços, conforme necessário (determinado no passo 2.1).
  4. Para preparar a mistura de transfecção, a alíquota volume apropriado de meio DMEM isento de soro, tal como calculado acima, para um tubo de microcentrífuga de 1,8 ml de polipropileno, e, em seguida, adicionar o reagente de transfecção.
    1. Pipeta reagente directamente na solução de meios, não adicioná-lo à superfície plástica do tubo de microcentrífuga. Adicionar DNA plasmídeo passada. Pipeta cima e para baixo suavemente para misturar a solução. Incubar durante 15 min à temperatura ambiente (15 ° C a 25 ° C) para permitir a formação de complexos de transfecção.
    2. Adicionar a mistura de uma maneira gota a gota a células cultivadas em placas de 6 poços. Agite ou rodam os poços para assegurar uma distribuição de complexos de transfecção.
    3. Placas de vedação com filme plástico.
  5. Incubar as culturas a 37 ° C numa atmosfera de CO2 a 5% durante 48 horas.
  6. Usar uma pipeta para recolher e transferir cuidadosamente o sobrenadante para um tubo de 15 ml atragh um top 0,22 nm.
  7. Usar uma pipeta para transferir 250 ul ou mais do sobrenadante filtrado para tubos de microcentrífuga de 1,8 ml com juntas de borracha nas tampas.
  8. Loja sobrenadantes filtrado a -80 ° C até à sua utilização.

3. Determine Infecciosas Titer de Ações virais em células mononucleares de sangue periférico (PBMC)

  1. Estimular PBMC com fito-hemaglutinina (PHA). Por um estoque virai, semente de 2 x 10 6 PBMC em Meio de Dulbecco Modificado por Iscove completo (cIMDM; IMDM suplementado com 20 U / ml de interleucina humana 2 (hIL-2), 10% de soro fetal bovino e 1% de penicilina / estreptomicina) suplementado com PHA (1,5 ng / mL). PBMC de sementes a 2 x 10 6 células / ml. Incubar PBMC a 37 ° C numa atmosfera de CO2 a 5% durante 72 h.
  2. Colheita PBMC estimulados com PHA. Transferência não-aderente de PHA-PBMC para um tubo de 50 ml. Rotação do tubo a 228 xg durante 10 min. Remova cuidadosamente o sobrenadante sem disrupting o sedimento celular. Re-suspender o sedimento de células até uma concentração final de 2 x 10 5 PBMC / ml em cIMDM.
  3. Semente de 2 x 10 4 PBMC estimulados com PHA / poço em 100 ul / cavidade em uma parte inferior cIMDM placa de 96 poços redondos.
  4. Fazer uma diluição de 1:10 do estoque virai. Em seguida, a partir do primeiro banco diluído, fazer doze diluições em série de 3 vezes de uma placa mestra de 96 cavidades. Este esquema de diluição é recomendada para a detecção de títulos virais no intervalo de abril 10-junho 10 unidades infecciosas (UI) por ml.
    1. Por exemplo, adicionar 20 ul de estoque de vírus a 180 ul de meios de comunicação no tubo de 1,5 ml. Misture a diluição pipetando cuidadosamente. Em seguida, transferir 90 ul do estoque diluído em 180 mL de mídia do primeiro poço e misture bem por pipetagem.
    2. Continue a série de diluição por transferência de 90 uL de um poço de corrente para 180 ul mídia no poço seguinte mais onze vezes. Aumentar ou diminuir a diluição inicial se títulos superiores a 10 6 UI / mlou inferior a 10 UI / ml 4 são esperados, respectivamente.
  5. Adicionar 40 ul de estoque virai diluída em série a partir da placa mestre de diluição na placa semeada PBMC (a partir do passo 3.3) em quadruplicado. Incubar as placas a 37 ° C numa atmosfera de CO2 a 5% durante 16-24 horas.
  6. Remover cuidadosamente 100 ul do sobrenadante de cada poço, e substituir com 160 ul de cIMDM fresca para um volume total de 200 ul / poço. Incubar as placas a 37 ° C com 5% de CO2 (dia 1).
  7. Nos dias 4, 7, 10 e 13 de transferência de 100 ul de sobrenadante de cada poço para 100 ul de tampão de disrupção (2% Triton X-100 em PBS), e substituir com 100 ul de cIMDM fresco. Armazenar os sobrenadantes a -20 ° C.
    1. Manter a amostragem e adicionando cIMDM fresco a cada três dias até o título estabilizar.
  8. Determinar a dose infecciosa de cultura de tecidos de 50% (TCID 50) de a reserva viral p24 por ELISA, utilizando o dia 7 e 13 amostras, tal como descrito no passo 4.
    1. Se a TCID 50 obtido a partir do dia 13 é claramente mais elevado do que o título a partir do dia 7, o stock de virus pode necessitar de mais tempo para se expandir. Repetir o ELISA p24 utilizando amostras posteriores até os títulos infecciosos a partir de dois pontos de tempo de amostragem tornar-se estável (ou diminuição). Selecione os stocks de amostras com títulos mais elevados.

4. ELISA (Enzyme-linked Ensaio imunoabsorvente) Detecção de HIV-1 p24 para determinar virais infecciosas Titer

NOTA: O protocolo seguinte foi desenvolvido usando placas de captura de antigénio de p24 preparados no nosso laboratório 30. Comercial do HIV-1 de placas de ELISA de p24 / kits podem também ser utilizados, seguindo o protocolo do fabricante.

  1. Antes de trabalhar com amostras, preparar stocks de trabalho de anticorpo primário (de coelho anti-HIV-1 SF2 p24 anti-soro).
    1. Anti-soro p24 Thaw na RT.
    2. Misturar 2,5 ml de glicerol com 2 ml de 10% de FBS em phosphatsalina e tampão (PBS).
    3. Adicionar 0,5 ml de anti-soro e misture.
    4. Loja 1 mL de alíquotas a -20 ° C.
  2. Descongele as amostras a partir do passo 3.7 em um 37 ° C incubadora.
  3. Lavar a placa de captura de p24, 5 vezes com tampão de lavagem (1x PBS com 0,05% de Tween-20).
  4. Adicionar 50 ul / poço de diluente de amostra (1% de albumina de soro bovino (BSA), 0,2% de Tween-20 em meio RPMI-1640), em seguida, adicionar 50 ul de amostra aos poços apropriados. Inclua pelo menos três poços com diluente de amostra apenas como controles simulados / negativos. Incubar durante 2 horas a 37 ° C ou O / N a 4 ° C.
  5. Preparar a solução de anticorpo primário fresco antes da utilização. Fazer uma diluição 1: 2000 de diluição dobra do anticorpo primário estoques de trabalho usando o diluente de anticorpo primário (12% de FBS em meio RPMI-1640). Assegurar a preparar o suficiente para o uso da solução de 100 ul por cada amostra / controlo poço numa placa de 96 poços.
    1. Por exemplo, para fazer a solução suficiente para uma placa de 96 poços, adicionam-se 5 ul do anticorpo primário que trng estoques para o diluente de anticorpo primário para um volume final de 10 ml.
  6. Lavar placa de captura de 5 vezes com tampão de lavagem.
  7. Adicionar 100 ul da solução de anticorpo primário em cada poço. Incubar durante 1 h a 37 ° C numa atmosfera de CO2 a 5%.
  8. Preparar a solução de anticorpo secundário fresco antes da utilização. Fazer uma diluição 1: 14.400 vezes a diluição do anticorpo secundário (1 mg / ml de anticorpo de cabra anti-coelho HRP) usando o diluente de anticorpo secundário (7% de FBS, 0,01% de Tween-20 em meio RPMI-1640). Para reduzir erros de pipetagem, execute uma diluição em série de duas etapas. Assegurar a preparar o suficiente para o uso da solução de 100 ul por cada amostra / controlo poço numa placa de 96 poços.
    1. Por exemplo, para fazer a solução suficiente para uma placa de 96 cavidades, primeiro adicionar 1 ml de anticorpo secundário de 99 uL de diluente de anticorpo secundário. Em seguida, adicionar 70 ul de diluição para o primeiro diluente anticorpo secundário para um volume final de 10 ml.
  9. Lavar a placa de captura de 5 times com tampão de lavagem.
  10. Adicionar 100 ul da solução de anticorpo secundário em cada poço. Incubar durante 1 hora a 37 ° C numa atmosfera de CO2 a 5%.
  11. Lavar a placa 5 vezes com tampão de lavagem.
  12. Adicionar 100 ul de substrato TMB RT. Incubar 30 minutos à temperatura ambiente num recipiente fechado para proteger da luz.
  13. Adicionar 100 ul de solução de paragem TA (1 NH 2 SO 4).
  14. Ler a absorvância a 450-650 nm em cada poço utilizando um leitor de microplacas. Use o valor de absorção de marcar cada um bem como infectado ou não infectado. Considere um poço para conter vírus infecciosos se o valor de absorção é, pelo menos, três vezes maior do que o valor lido a partir de poços de controlo simuladas / negativo. Calcule TCID50 do estoque viral utilizando o método de Reed-Meunch 31.

5. Estabelecer cinética de crescimento viral

5.1) monoinfecção

  1. Semente de 3 x 10 5 PBMC estimuladas com PHA / poço em placas de 48 poçoss num volume total de 500 ul / poço. Manter as placas de cultura a 37 ° C numa atmosfera de CO2 a 5% até que a inoculação.
  2. Para cada um dos vírus, preparar um inoculo contendo 6000 UI, em 2 ml de cIMDM.
  3. Inocular poços em triplicado, através da adição de 500 uL do inoculo (1500 UI) para as células semeadas. O volume final da cultura de células infectada é de 1 ml / poço e a MOI é 0,005.
  4. Alíquota de 200 ul do inoculo remanescente para cada uma das duas placas de 96 poços para o isolamento de ARN, um dos quais é guardado como uma cópia de segurança.
  5. Incubar as culturas a 37 ° C numa atmosfera de CO2 a 5% durante 16-24 horas.
  6. Lavar as culturas 16-24 h após a inoculação.
    1. Remova e descarte 750 ul de sobrenadante de cultura.
    2. Adicionar 750 ul de cIMDM fresco. Embrulhe em filme plástico placas e centrifugação durante 10 minutos a 300 x g. Remova e descarte 750 sobrenadante ul.
    3. Adicionar 750 ul de cIMDM fresco. Incubar a 37 ° C com 5% de CO 2 emmosphere (dia 1).
  7. Amostra culturas diárias do dia 2 ao dia 7.
    1. Transferir 500 mL de sobrenadante da cultura para um tubo de centrífuga de 1,8 ml. Rotação durante 1 minuto a 3000 x g.
    2. Transferir 200 ul do sobrenadante isento de células para as duas placas de 96 poços de amostra para o isolamento de ARN, uma vez mais poupando uma placa como cópia de segurança. Os sobrenadantes armazenar a -80 ° C até o isolamento do ARN.
    3. Adicionar cIMDM 500 ul fresco para cada cultura. Incubar a 37 ° C numa atmosfera de CO2 a 5%.
    4. Descartar culturas em Wescodyne no final da experiência.
    5. Isolar o ARN a partir de 200 ul de sobrenadante (uso de kits comerciais tais como QIAamp Viral RNA mini kit) seguindo o protocolo padrão do fabricante. Para um grande número de amostras, utilizar o Qiagen QIAxtractor.
    6. As amostras de RNA armazenar a -80 ° C, até a síntese de cDNA.

5.2) de síntese de ADNc (transcrição reversa)

  1. Para cada ARN samplo, adicionar 1,2 nmol de dNTP e 1,2 pmol de iniciador de síntese de ADNc, (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', HXB2 nucleótidos 7968-7995) a 10 ul de ARN viral. Adicionar água para um volume final de 14 ul. Flick o tubo para misturar e girar rapidamente para recolher o líquido na parte inferior do tubo.
  2. Incubar mistura durante 5 min a 65 ° C, em seguida, manter a 4 ° C até a mistura principal é preparado.
  3. Preparar a mistura mestra usando 5x tampão de primeira cadeia (250 mM de Tris-HCl, pH 8,3, KCl 375 mM, MgCl2 15 mM), DTT 5 mM, 120 U de SuperScriptIII e 240 U de inibidor de Rnase. Adicionar água para um volume final de 10 ul.
  4. Adicionar 10 ml de mistura principal a mistura RNA, passe o dedo para misturar e girar para coletar.
  5. Incubar mistura durante 90 min a 50 ° C para permitir a síntese de ADNc. Incubar durante 15 min a 70 ° C para inactivar a transcriptase reversa. Manter a 4 ° C conforme necessário.
  6. Adicionar 2 U de RNase H, passe o dedo para misturar, e depois girar para coletar.
  7. Incubar 20 mina 37 ° C. ADNc Armazenar a -20 ° C.

5.3) A quantificação de ADNc Utilizando Sistema qPCR

  1. Prepara-se uma série de diluições padrão. Faça 10 vezes diluição em série, a partir de 3 x 10 6 cópias / mL até 30 cópias / mL, de pNL4-3VifA. Use água destilada para diluições. Preparar diluições em série do padrão fresco antes da utilização ou preparar pequenos lotes e manter a -20 ° C. Não congelar-descongelar as normas mais do que três vezes.
  2. Configurar uma placa de 96 poços de reacção qPCR. Certifique-se de que cada placa contém pelo menos um poço de controlo negativo, um triplicado da série de diluições do padrão, e pelo menos um duplicado de cada amostra de cDNA.
  3. Para cada reacção de qPCR, usar 12,5 ul de qPCR mistura principal, 0,2 uM de sonda, 0,8 uM de cada um dos iniciadores directo e inverso, e 1 ul de ADNc ou a série de diluição padrão ou de água / tampão (para o poço de controlo negativo). Adicionar água para um volume final de 25 ul. A sonda qPCR é leve sensível. Mantenha-o em recipiente fechado.
    1. Para detectar ADNc derivada do clone molecular baseada pNL4-3VifA, utilizar o Vifa iniciador-sonda: VifAB iniciador directo (GGTCTGCATACAGGAGAAAGAGACT), Vifa iniciador reverso (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') e sonda VifAB (6FAM-5'-3-CTCCATTCTATGGAGACTC '-MGBNFQ). Para ADNc derivada do clone com base pNL4-3VifB, utilizar o VifB iniciador-sonda: VifAB iniciador directo, sonda VifAB e VifB iniciador reverso (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Definir os parâmetros dos ciclos de PCR a 50 ° C durante 2 min, 95 ° C durante 10 min, e 40 ciclos de 95 ° C durante 15 seg e 60 ° C durante 1 min. Consulte o documento de suporte do fabricante para o funcionamento da máquina qPCR.
  5. Calcular uma curva padrão, utilizando os dados do padrão de séries de diluição em triplicado. Comparar os dados de amplificação do ADNc da amostra com a curva padrão para determinar o número de cópias. Consulte o documento de suporte do fabricante para daprocessamento ta.

5.4) Determinar viral fase de crescimento exponencial

  1. Traçar cinética de crescimento viral com o dia de amostragem ao longo do eixo X e do número de cópias de ADNc ao longo do eixo Y e identificar a fase exponencial de crescimento virai, isto é., Quando ADNc virais copiar números de aumento de uma progressão exponencial.
  2. Use a ferramenta da web GRC ( http://indra.mullins.microbiol.washington.edu/grc/ ) para calcular a taxa de crescimento viral (g). Nesta aplicação, a ferramenta GRC aceita ADNc copiar números de, pelo menos, dois pontos de tempo como entrada, e gera a taxa de crescimento viral (g). Utilizar apenas os dados de ponto de tempo dentro da fase de crescimento exponencial (ver o passo 5.4.1, supra) para se obter as taxas de crescimento precisos. Para uma descrição detalhada do modelo matemático utilizado na ferramenta da web GRC, ver 20.

6. Crescimento ensaio de competição

  1. Semente de 3 x 10 5 </ Sup> PBMC estimulados com PHA (ou 1 x 10 5 células CEMx174) em 500 ul de volume total por poço numa placa de fundo plano de 48.
  2. Mantenha a placa em 37 ° C em atmosfera de CO2 a 5% até que a inoculação.
  3. Para cada um dos vírus, preparar 3 ml de inoculo contendo 6000 UI.
  4. Transferir 1,5 ml de cada inoculo virai para um tubo estéril para criar o inoculo infecção dupla. Adicionar 500 ul da dupla inoculo (1500 UI) de 3 x 10 5 células em uma placa de 48 poços. O volume de cultura final é de 1 ml / poço. Alíquota de 200 ul do inoculo a duas placas de 96 poços para o isolamento do ARN; salvar uma placa como um back-up.
  5. Incubar as células inoculadas a 37 ° C com uma atmosfera de CO2 a 5% durante 16-24 horas.
  6. Lavar as culturas 16-24 h após a inoculação.
    1. Remova e descarte 750 ul de sobrenadante de cultura.
    2. Adicionar 750 ul de cIMDM fresco. Enrole em placas de plástico e centrifugação durante 10 min a 300 x g. Remova e descarte 75081; l sobrenadante.
    3. Adicionar 750 ul de cIMDM fresco. Incubar a 37 ° C com uma atmosfera de CO2 a 5% (1 dia).
  7. Seleccionar tempos de amostragem para incluir, pelo menos, três pontos de tempo dentro da fase exponencial de crescimento observado no passo 5.4.1.
    1. Para cada amostragem, siga o passo 5.1.7.
  8. Realizar a síntese de cDNA como descrito na seção 5.2.
  9. Determinar a proporção variante viral utilizando qPCR.
    1. Prepara-se uma série padrão de diluição em série em triplicado, diluição de 10 vezes em cada passo a partir de 3 x 10 6 cópias / ul de 30 cópias / mL de pNL4-3VifA.
    2. Configurar uma placa de 96 poços de reacção qPCR. Certifique-se de que cada placa contém, pelo menos, um controlo negativo, a série de diluição padrão em triplicado, e duplicados de cada amostra de cDNA.
    3. Para cada reacção de qPCR, usar 12,5 ul de qPCR Master Mix, 0,2 uM, 0,8 uM sonda de cada um dos iniciadores directos e inversos e 1 ul de ADNc ou o padrão d série ilution ou água / tampão (para os poços de controlo negativo). Adicionar água para um volume final de 25 ul. A sonda qPCR é sensível à luz, mantenha-o em recipiente fechado.
      1. Use o iniciador-sonda para detectar sinais Vifa nos controlos negativos e as séries de diluições do padrão e com uma duplicata da amostra cDNA. Use o iniciador-sonda VifB com o outro duplicado da amostra cDNA.
    4. Definir os parâmetros dos ciclos de PCR a 50 ° C durante 2 min, depois 95 ° C durante 10 min, e em seguida 40 ciclos de 95 ° C durante 15 seg e 60 ° C durante 1 min. Consulte o documento de suporte do fabricante para o funcionamento da máquina qPCR.
    5. Calcula-se a curva padrão, utilizando dados de amplificação a partir da série de diluições padrão. Comparar os dados de amplificação das amostras de ADNc com a curva padrão para determinar o número de cópia. Consulte o documento de suporte do fabricante para processamento de dados.
    6. Use a ferramenta da web GRC (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) para calcular a aptidão viral relativa (d).
      NOTA: A ferramenta GRC aceita ADNc copiar números ou alturas de pico de cromatograma de, pelo menos, dois pontos de tempo como a entrada, e produz a diferença de taxa de crescimento líquido (d) entre os dois vírus. Enquanto a ferramenta pode calcular a taxa de crescimento líquido de dois dados de ponto de tempo, recomenda-se fortemente a entrada de dados a partir de três ou mais pontos de tempo. Utilizar apenas os dados obtidos a partir de pontos de tempo dentro da fase de crescimento exponencial (ver passo 5.4) para se obter as taxas de crescimento precisos. Para uma descrição detalhada do modelo matemático utilizado na ferramenta da web GRC, ver 20.
  10. Determinar os rácios virais utilizando chromatogram pico-alturas
    1. Amplificar por PCR de HIV-1 vif fragmentos contendo o marcador de sequência VifAB usando VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; HXB2 posiciona 5266-5291) e VifRev iniciadores (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 posições 5579-5553).
      1. Para cada reacção de PCR, usar 1 ul de ADNc, 1x tampão de NH 4, MgCl2 1,5 mM, dNTP 0,2 mM, 2,5 U de Taq polimerase, e 0,45 uM de cada iniciador. Adicionar água para um volume final de 50 ul.
      2. Definir os parâmetros dos ciclos de PCR a 3 ciclos a 94 ° C durante 1 min, 55 ° C durante 1 min, e 70 ° C durante 1 min, seguido de 34 ciclos a 94 ° C durante 15 seg, 58 ° C durante 30 seg, e 70 ° C durante 1 min, e, em seguida, manter a 4 ° C.
    2. Purifica-se os produtos de PCR utilizando o kit de purificação de PCR QIAquick de acordo com o protocolo do fabricante.
    3. Enviar produtos de PCR purificados a um prestador de serviços de seqüenciamento de DNA para sequenciamento Sanger.
    4. Verifique a pontuação média a qualidade da leitura, que deve ser fornecido pelo serviço de sequenciamento. Se a precisão média chamada base é inferior a 85%, refazer passo 6.10.1 a 6.10.3
    5. Use a ferramenta da web ChromatQuan (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) para calcular proporção viral em cada ponto de tempo. A ferramenta exige que o ficheiro de sequência de rastreio (* .ab1) e a sequência 5 'para o local de nucleótidos de interesse. A ferramenta mede a intensidade do pico no local especificado. A razão entre a intensidade de pico corresponde à ração dos dois vírus (Figura 4B).
    6. Utilizar a ferramenta da web GRC ( http://indra.mullins.microbiol.washington.edu/grc/ ) e as intensidades de pico registadas como entrada para calcular a aptidão relativa viral (d). Veja o passo 6.10.6. 20

Representative Results

Para estudar o impacto das mudanças de fitness de um único aminoácido em HIV-1 Gag-p24, utilizou-se mutagénese dirigida oligonucleotídeo para introduzir mutações num plasmídeo pNL4-3 contendo o gene 23,32,33 HIV-1 COTB-p24. Stocks virais foram produzidos por transfecção de células 293T e depois colhidas 48 horas. Estimou-se a cultura de tecidos de dose de 50% infecciosas (TCID 50) de cada ação viral pelo método de Reed-Muench 31. O TCID 50 do protótipo e vírus mutantes variou de abril 10 - maio 10 UI / ml (Figura 3A).

A cinética de crescimento dos vírus recombinantes foram estabelecidos em PBMC a partir de um único dador, a uma MOI de 0,005. RT-qPCR foi utilizado para medir o número da cópia de ADNc viral por dia durante seis dias. Todos os mutantes e vírus protótipo cresceram exponencialmente entre o dia 2 e no dia 4, após o que retardou o crescimento viral, tal como indicado por uma diminuição da inclinação do aumento do número cópia de RNA viral (<forte> Figura 3B). A diminuição do número de cópias de cDNA entre o dia 0 (o que corresponde ao do inóculo) e dia 2 é devido à absorção do vírus às células e a remoção de viriões não ligados por lavagem no dia 1 (passo 5.1.6). Na fase de crescimento exponencial, todos os três mutantes tinham uma taxa de crescimento mais lenta (g) do que o vírus protótipo (Figura 3C).

Todos os três mutantes foram competiu contra o vírus protótipo em ensaios de competição de crescimento a uma MOI total de 0,005. Cinética de crescimento virai em culturas infectadas duplamente foi semelhante ao do mono-infecção; a fase exponencial de crescimento virai foi entre os dias 2 e 4, e o crescimento viral atingido um patamar por volta do dia 5 (Figura 4A).

Viral diferenças de taxas de crescimento foram obtidos a partir da alteração na proporção da virai ao longo do tempo. A proporção viral foi calculada com base no número de cópias de cDNA do vírus de referência e os mutantes, utilizando RT-qPCR, e por comparando alturas de picoem sequência cromatogramas em locais de nucleótidos que distinguem os dois vírus (Figura 4B). As diferenças nas taxas de crescimento determinado utilizando a pico-altura e cópia de RNA virais Número métodos obtiveram resultados semelhantes (Figura 4C). Todos os três mutantes tiveram aptidão replicação mais baixa do que os vírus protótipo com o I256V mutante tendo o menor aptidão (Figura 4C).

Figura 1
Figura 1: Diagrama de fluxo dos protocolos apresentados neste trabalho o vírus protocolos de preparação preocupação construção de HIV-1 clones recombinantes e geração de stocks virais.. Os protocolos para exercício ensaios são para estabelecer uma cinética de crescimento viral e a determinação da replicação viral relativo. As linhas tracejadas representam os fluxos alternativos para os protocolos. Por exemplo, uma mutação pode ser introduzida directamente no HIV-1 NL4-3clone molecular sem gerar um clone recombinante.

Figura 2
Figura 2:. Construção de HIV-1 NL4-3 COTB Gag p24 clones moleculares recombinantes utilizando extensão de sobreposição PCR (A) Concepção dos iniciadores quiméricos. A 5 'metades dos iniciadores contêm a sequência do vector NL4-3 e a 3' metades conter as extremidades da sequência de inserção. (B) os iniciadores quiméricos são utilizados para amplificar o fragmento de inserção, COTB Gag p24. (C) Os fragmentos de inserção são utilizados como iniciadores para uma segunda PCR para gerar um novo plasmídeo recombinante.

Figura 3
Figura 3:. Características de crescimento viral em PBMC (A) Log10 TCID50 (B) uma cinética de crescimento viral em monoinfections começado a uma MOI = 0,005. (C) as taxas virais mais de seis dias de crescimento, incluindo a fase exponencial de crescimento (dias 2-4) derivada a partir do painel (B). Os valores apresentados representam a média de três repetições de uma experiência. As barras de erro representam intervalos de confiança de 95%.

Figura 4
Figura 4: o crescimento viral e fitness relativa determinações (A) o crescimento viral em culturas de PBMC duplamente infectados.. (B) Rácios de vírus T242N e protótipos determinada utilizando RT-qPCR ou o método de sequenciação de pico-altura. (C) diferenças líquidas virais taxa de crescimento (D) entre o mutante e os vírus protótipo em culturas duplamente infectadas, como mostrado em (A). d valores foram calculados from a relação dos dados mostrados na virais (B). Os valores apresentados representam a média de três repetições de uma experiência. As barras de erro representam intervalos de confiança de 95%.

Discussion

Os protocolos apresentados consistia de duas partes principais: construção de HIV-1 Os clones moleculares recombinantes e ensaios de competição de crescimento. A fim de distinguir dois vírus numa cultura de células duplamente infectadas, é importante que os clones moleculares concorrentes conter marcadores de sequências, que podem ser detectadas por um ensaio de iniciador-sonda de RT-qPCR ou por sequenciação de Sanger. Este protocolo faz uso das marcas Vifa e VifB, que ocupam a mesma região de HIV-1 NL4-3 e vif codificam a mesma sequência de aminoácido, mas que diferem por seis mutações sinónimas. Estas mutações foram mostrados para não afetar aptidão replicação viral 20. O método de clonagem baseada em PCR utilizada neste protocolo oferece mais flexibilidade na seleção de locais de clonagem, em comparação com a clonagem com base local de restrição. No entanto, a eficiência de clonagem de PCR diminui à medida que aumenta o tamanho do inserto. O limite atual do tamanho da inserção é ~ 5 kb 34. Para a clonagem baseada em PCR e local dirigida mutagenesis, a utilização de uma polimerase de DNA de alta-fidelidade é essencial para reduzir a probabilidade de mutações adicionais. A utilização de um número mínimo de ciclos de PCR necessários para produzir quantidades adequadas de produtos, também é recomendável. Em nossa experiência, nós não detectou quaisquer mutações extra depois que as etapas de clonagem e mutagénese dirigida ao local com base em PCR aqui descritos. No entanto, os produtos de PCR deve ser sequenciado para verificar quaisquer mutações indesejadas. Idealmente, a região de codificação inteira do HIV deve ser resequenced.

Pelo menos três pontos de tempo de amostragem devem ser examinados na fase de crescimento exponencial 9. A cinética de crescimento viral deve primeiro ser estabelecida utilizando amostragem diariamente para determinar o período de cultura e tempo de amostragem pontos apropriados para a competição crescimento. Um factor que afecta a cinética do crescimento virai é a multiplicidade de infecção (MOI). Esse protocolo utiliza uma MOI total de 0,005 para ambos monoinfecção e concorrência de crescimento, uma vez que foi mostrado, para se obter mais roresultados busto do que inferior MOIs 9. No entanto, MOIs inferiores podem ser utilizados para se obter uma fase de crescimento exponencial mais longo se necessário, mas à custa de consistência resultado. Este protocolo sugere um rácio de 50:50 a infecção inicial, assumindo que as diferenças de aptidão dos vírus são geralmente desconhecidos de antemão. No entanto, a utilização de proporções desiguais de entrada são apropriadas quando houver dados preliminares que sugerem diferenças significativas na cinética de replicação virais. Nestes casos, uma taxa de infecção de 70:30 é recomendado para permitir a detecção de uma grande diferença de fitness, onde o vírus menos ajuste é colocado em excesso 9.

O protocolo para determinar a TCID50, cinética de crescimento viral, e para a execução de ensaios de competição do crescimento foram optimizadas usando o HIV-1 do subtipo B, NL4-3 COTB-p24, e PBMC de um único dador cujos PBMC demonstraram susceptibilidade ao HIV consistente uma infecção in vitro. O período de culturae pontos de tempo de amostragem apresentados neste protocolo são susceptíveis de ser adequado para o estudo do HIV-1 grupo M vírus em PBMC humanos. Utilizando PBMC a partir de uma única fonte é altamente recomendável para obter resultados consistentes como a replicação viral pode variar em diferentes células de dador 35. Embora menos desejável, PBMC de doadores de múltiplos agrupados pode ser utilizado como uma substituição, desde que a mesma piscina é utilizado em todas as experiências. Outra alternativa é a utilização de linhas de células. O protocolo aqui apresentado foi usado com sucesso com a linha de células T CEMx174 23,36. No entanto, é importante que o número de células inoculadas são re-optimizados para conseguir o crescimento celular consistente. Cinética de crescimento virai também tem de ser re-estabelecido, uma vez que é susceptível de variar em diferentes linhas de células, para determinar os pontos de tempo de amostragem apropriados nas etapas de concorrência crescimento.

Dois métodos diferentes para determinar a proporção viral para o cálculo de fitness estão incluídos no PROTOCol. O primeiro utiliza RT-qPCR para medir viral número de cópias de ADNc em cada ponto de tempo de amostragem. Aptidão replicação virai foi então calculado a partir da proporção viral, com base no número de cópias do ADNc. Em alternativa, a proporção viral pode ser determinada com base na relação entre a altura do pico cromatograma nos locais tag VifAB. Os dois métodos deram resultados comparáveis ​​(Figura 4). O método da altura de pico cromatográfico pode ser aplicado a outras estirpes de HIV-1 sem um marcador de sequência de engenharia. Para RT-qPCR, o uso de primers ou sondas para distinguir variantes virais deve primeiro ser cuidadosamente avaliados (ver 20). No entanto, a RT-qPCR proporciona uma melhor sensibilidade para as amostras com uma pequena quantidade de ARN virai, tais como aqueles a partir do primeiro ponto de tempo dentro da fase de crescimento exponencial. A medição directa de cDNA viral também permite a detecção de problemas técnicos que possam surgir a partir da extração de RNA e síntese de cDNA. Usando clones moleculares com etiquetas de seqüência fornece uma solução de custo eficaz to Os métodos de RT-qPCR, uma vez que apenas dois pares de iniciadores e sondas são necessários para estudar vários vírus. Esta estratégia também evita o problema da variação de pico-altura em sequência cromatogramas devido às bases vizinhas 37, como a sequenciação é realizada no mesmo local em todos os vírus do estudo. Os produtos de PCR produzidos por RT-qPCR e Sanger de sequenciação pode também ser usado com outros métodos para determinar a proporção viral, tais como grandes quantidades de sequenciação de clones individuais 12,13, HTA 4,7,17,19, ou um ensaio de ligação de oligonucleótidos (OLA) 38 .

Disclosures

Os autores declaram que não têm interesses financeiros concorrentes. As opiniões aqui expressas são de responsabilidade dos autores e não deve ser interpretado como oficial ou representem os pontos de vista do Departamento de Defesa dos EUA ou o Departamento do Exército.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Crescimento Pairwise competição ensaio para determinar a replicação de Fitness de Imunodeficiência vírus humanos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter