Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Paarsgewijze Groei Competitie Assay voor het bepalen van de Replicatie Fitness van Human Immunodeficiency Virussen

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Virale replicatie conditie wordt gedefinieerd als het vermogen van een virus om infectieus nageslacht te produceren in een bepaalde omgeving 1 en is een belangrijke factor bij het ​​bepalen van het voorkomen van een virus variant op populatieniveau tijd 2. Zoals in vivo studies conditie niet haalbaar met pathogene menselijke virussen, zoals HIV-1, diverse in vitro en ex vivo replicatie fitness assays werden ontwikkeld om de effecten op fitness gevolge van resistentie tegen immune ontsnappingsmutaties, epistasie en de evolutie bestuderen van virale populaties 3-6. Onder verschillende fitness assays zijn groei competitiebepalingen erkend gevoeliger en valide metingen van fitness verschillen verkregen, als twee of meer virale varianten strijden om dezelfde celpopulatie onder exact dezelfde omgevingsomstandigheden, zoals gebeurt in vivo 1,7,8. Voordat groei concurrentie-experimenten te beginnen, enkele variables behoeft te worden vastgesteld, inclusief het gebruik van verschillende veelvouden van infectie (MOI), virale invoerfactor en timing van monsters voor analyse. We hebben de effecten van deze parameters op de virale kinetiek en de groei van het resultaat van de concurrentie-experimenten bestudeerd en hebben in celcultuur 9 belangrijke factoren die nodig zijn voor robuuste metingen van HIV-1 fitness geïdentificeerd.

Naast assay variabelen zijn verschillende methoden voor het kwantificeren van virale varianten groei competitie-experimenten. Bulk 10,11 of 12,13 klonale sequentie werd gebruikt om de verhouding van de concurrerende virussen gebaseerd op de nucleotide frequenties op de plaats (en) van belang te bepalen. Relatieve fitness is afgeleid van veranderingen in deze verhouding in de tijd. Deze methode is handig als DNA sequencing services zijn overal verkrijgbaar. De parallelle allel-specifieke sequencing (PASS) methode maakt sequencing op meerdere plaatsen en de opsporing van recombinanten 14 15 of synoniem mutaties 4,16-18 als tags aan de concurrerende virussen door sequentiebepaling, heteroduplex tracking-assays (HTA) 4,7,17,19 onderscheiden of omgekeerde transcriptie-kwantitatieve real-time polymerase-kettingreactie (RT-qPCR) 15,16,18,20, die allemaal toepassing studeren concurrerende stammen, onafhankelijk van sequentieovereenkomst kan worden gemaakt. Een extra stap nodig om labels in virale genoom te introduceren en de RT-qPCR assay vereist ook specifieke reagentia en instrumenten. We hebben ontdekt dat bulk Sanger sequencing levert vergelijkbare resultaten 9.

Na groei concurrentie, is virale replicatie fitness gepresenteerd als relatieve fitness, of een fitness-verhouding tussen two virale varianten. De relatieve conditie van een virus kan worden gedefinieerd als de uiteindelijke hoeveelheid van een virale variant genormaliseerd zijn aanvankelijke hoeveelheden in het inoculum of de netto groei tussen de twee concurrerende virussen. We vonden dat deze werkwijze gebruikt longitudinale gegevenspunten alleen in de exponentiële groeifase, produceerde de meest robuuste resultaten 9,20.

In vitro assays fitness hoofdzakelijk worden gebruikt om biologische klonen 6-8 en besmettelijke moleculaire klonen van HIV-1 te bestuderen. De laatste, die ontvankelijk zijn voor genetische manipulatie, worden dikwijls gebruikt om het effect op de geschiktheid van bepaalde mutaties of specifieke sequenties van belang 3-5,21,22 bestuderen. De volgende protocollen beschrijven een werkstroom van het punt van de bouw van nieuwe full-length infectieus HIV-1 moleculaire klonen middels HIV-1 vectoren die een sequentie tag, introduceren van mutaties plaats, waardoor virale voorraden en vaststelling virale groeikinetiek, Het uitvoeren van de groei competitieve test en het berekenen van relatieve fitness (figuur 1).

Met behulp van onze geoptimaliseerde procedures, creëerden we drie recombinant HIV-1 mutanten en vastberaden hun replicatie fitness. Het recombinante moleculaire kloon werd eerst geconstrueerd door de HIV-1 gag p24-gen regio pNL4-3, een plasmide dat een volledige lengte infectieus genoom van HIV-1 NL4-3 lab stam, een synthetisch COTB (Midden-Of- Boom, subtype B) gag-p24 volgorde 23 tot de prototype stam te creëren. Single aminozuur veranderingen (T186M, T242N en I256V) werden vervolgens geïntroduceerd tot drie mutante klonen te creëren. Elke mutant werd streden tegen het prototype virus aan de fitness effect van elke mutatie in de gegeven genetische achtergrond te observeren. De drie mutanten gedemonstreerd variërende niveaus van replicatie fsitness van licht tot ver onder het prototype virus. De T242N mutatie werd eerder gemeld een matige Fitne hebbenss kosten 24-26, vergelijkbaar met de in deze studie resultaat. De geschiktheid kosten van de andere twee mutaties nog niet eerder beschreven.

Protocol

OPMERKING: Het protocol, zoals hieronder beschreven, niet iedere patiënt identificeerbare informatie bevatten en wordt dus niet beschouwd Mensgebonden Onderzoek van de Universiteit van Washington Institutional Review Board of Human Onderwerpen Division.

1. Constructie van chimere HIV-1 NL4-3 Molecular Clones

1.1) Amplify Insert DNA Fragment

  1. Ontwerp chimerische primers. Helften van de 5 'van zowel voorwaartse en omgekeerde primers bevatten een HIV-1 vector sequentie, waarbij het fragment wordt ingevoegd. De 3 'helft van de primers het uiteinde van de insert-sequentie (Figuur 2) bevat. Zorg ervoor dat het chimère primersequentie behoudt de originele open reading frames.
    1. Gebruik primers ten minste 20 basen lang, met een smelttemperatuur hoger dan of gelijk aan 60 ° C, ~ 50% GC inhoud en een lage neiging tot primer dimeren, heterodimeren en / of hairpin structuren. Beoordelen deze eigenschappenmet behulp van de OligoAnalyzer webtool ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Met PCR 27 en het chimere primers insert DNA (Figuur 2) amplificeren. Voor elke PCR-reactie, gebruik 1X high fidelity buffer, 0,2 mM dNTPs, 1 U van high fidelity DNA polymerase, 0,5 uM van forward chimere primer, 0,5 uM van omgekeerde chimere primer en 1 pg0 ng DNA-monster uitvoeren insert regio. Voeg dH 2 O tot een eindvolume van 50 pi.
  3. Stel thermale cycli stappen als volgt: Voer een eerste DNA denaturatie stap bij 98 ° C gedurende 10 sec. Amplificeer met 30 cycli van DNA denaturatie bij 98 ° C gedurende 10 seconden en DNA hybridisatie bij 3 ° C boven de laagste smelttemperatuur van beide primers voor 20 sec. Voer een laatste verlenging bij 72 ° C gedurende 10 min. WINKEL PCR producten bij 4 ° C.
  4. Neem 5 pl van de PCR producten uit devorige stap en uitvoeren van agarosegelelektroforese 28.
    1. Gebruik een 0,7% agarosegel, 1 x TAE buffer (40 mM Tris-acetaat, 1 mM EDTA), 0,5 ug / ml ethidiumbromide (EtBr) eindconcentratie en 1 kb ladder als DNA groottemerker. Set voedingsbron spanning tot 5 V / cm afstand tussen de elektroden. Stop de elektroforese als de ladingskleurstof migreert door ongeveer 2/3 van de lengte gel. Visualiseren onder toepassing van een gel documentatiesysteem 28.
      OPMERKING: EtBr is een verdacht carcinogeen en moet goed worden afgevoerd, per instelling regelgeving. Handschoenen moeten altijd gedragen worden bij het hanteren van gels die EtBr. Wissel naar nieuwe handschoenen na de finish handling EtBr bevattende materiaal en voor de behandeling van andere materialen of apparatuur om kruisbesmetting te voorkomen.
  5. Als er slechts één DNA-band met een grootte die overeenkomt met het gewenste PCR-product wordt gedetecteerd, zuiveren de rest van het PCR product met een commerciële kit zoals QIAquick PCR Purification Kit according de protocollen van de fabrikant.
    1. Als andere, niet-specifieke banden zijn aanwezig, met de rest van het PCR product aan preparatieve gelelektroforese werking. Gebruik dezelfde parameters en voorwaarden die in stap 1.1.4. Zorg ervoor dat de gel goed groot genoeg te laden ~ 45 pi PCR producten. Knip de band van belang en extraheer het DNA uit de gel onder gebruikmaking van QIAquick gel extractie kit volgens protocollen van de fabrikant.

1.2) Introduceer de Insert Fragment in Full-length Infectious HIV-1 Subtype B Vector (pNL4-3)

  1. Gebruik gezuiverde PCR producten uit stap 1.1.5 als PCR primers. Gebruik pNL4-3VifA 20 als matrijs-DNA in een PCR- reactie en gebruiken pNL4-3VifB 20 als matrijs in de overige reactie (Figuur 2). Voor elke PCR-reactie, gebruik 1x high fidelity buffer, 0,2 mM dNTPs, 2 U van high fidelity DNA polymerase, 500 ng primer DNA en 50 ng template DNA in een finale volume van 50 ui. Stel de thermische cycli parameters: 98 ° C gedurende 30 seconden, 35 cycli bij 98 ° C gedurende 10 sec, 48 ° C gedurende 1 min en 72 ° C gedurende 10 min, gevolgd door 72 ° C gedurende 10 min.
  2. Voeg 10 U van Dpn I tot 50 ui van de PCR reactie en incubeer bij 37 ° C gedurende 1 uur aan het matrijs-DNA te verteren. Zorg ervoor dat het plasmide DNA wordt geïsoleerd uit een methylatie competent bacteriestam, bijv., TOP10 chemisch competente Escherichia coli.
  3. Gebruik Dpn I verteerd product aan de bevoegde bacteriële cellen te transformeren. Gebruik heat-shock transformatie met TOP10 chemisch competente E. coli, volgens het protocol van de fabrikant. Kiezen voor bacteriële cellen die het recombinante plasmide gebruikt Luria Broth (LB) kweek platen die 100 mg / l carbenicilline.
    1. Extra ~ 10 goed gescheiden koloniën en kweken afzonderlijk in 3 ml vloeibaar LB-medium dat 100 mg / L carbenicilline en incubeer bij 30 ° C in eenshaker O / N.
    2. Gebruik QIAprep Spin Miniprep kit plasmide-DNA te isoleren uit de bacteriële vloeibare kweek, volgens het protocol van de fabrikant.
  4. Met dubbele restrictiedigestie 29 om te bepalen of het plasmide-DNA bevat het juiste insert. Waardoor een van de restrictieplaatsen Alleen bij het insertgebied en andere restrictieplaats bestaat slechts eenmaal in de HIV-1 vector, buiten het insertgebied.
    1. Digest tenminste 300 ng plasmide-DNA in 10 pl uiteindelijk reactievolume. Select beperking buffers, incubatietemperatuur en incubatietijd volgens het protocol van de geselecteerde restrictie-enzymen van de fabrikant. Neem 9 ui van het geknipte DNA en run gelelektroforese zoals beschreven in stap 1.1.4. Selecteer recombinant plasmiden die DNA-banden van de voorspelde maten.
  5. Bevestig sequentie integriteit van de recombinante plasmiden door Sanger sequentiebepaling. Terwijl zeldzaam, ongewenstemutatie (s) kunnen in de PCR-reacties worden ingevoerd.
    1. Sequentie beide strengen van het plasmide DNA. Volg de instructies in stap 1.1.1.1 tot sequencing primers te ontwerpen. Bovendien zorgen dat de voorwaartse en omgekeerde sequentie-primers hybridiseren ten minste 50 bp stroomopwaarts en stroomafwaarts van het insertgebied in het recombinante plasmide, respectievelijk.
    2. Geef plasmide-DNA en sequencing primers commerciële DNA sequencing service provider. Bereid DNA-monster en primers zoals aangegeven door de dienstverlener.
  6. Een endotoxinevrij stock van het gemuteerde plasmide-DNA onder toepassing van een endotoxine-vrij plasmide-DNA kit volgens het protocol van de fabrikant. Bereid ten minste 1 pg endotoxine vrij plasmide DNA voor transfectie in de volgende stap.

1.3) Introduceer Kleinschalig Mutaties Via Site-directed mutagenese

  1. Ontwerp mutagene primers met overlappende voorwaartse en achterwaartse primers die de gewenste mutation (s). Plaats de base (s) worden vervangen, ingevoegd of verwijderd in het midden van de primers, geflankeerd door homologe 10-15 basen. Volg de instructies in stap 1.1.1.1.
  2. Met PCR mutante plasmiden synthetiseren. Voor elke PCR-reactie, gebruik 1x high fidelity buffer, 10 mM dNTPs, 2 U van high fidelity DNA polymerase, 0,5 uM van voorwaartse mutagene primer, 0,5 uM van omgekeerde mutagene primer en 50 ng van chimerische pNL4-3VifB, uit stap 1.2.6 , in een eindvolume van 50 pi. Stel de thermische cycli parameters: 98 ° C gedurende 30 seconden, 25 cycli bij 98 ° C gedurende 10 sec, 48 ° C gedurende 1 min en 72 ° C gedurende 10 min, gevolgd door 72 ° C gedurende 10 min.
  3. Herhaal stap 1.2.2 naar 1.2.6.

2. Generation van virale Stock behulp Transfection

  1. Bereken de hoeveelheid virale stock gewenste en plasmide-DNA vereist. Met een virale titer van 10 4 IU / ml of hoger, 1,8 ml van virale voorraad is voldoende voor twee reeksen groeicompetitie assays, waaronder monoinfections, elk in drievoud uitgevoerd. Voor transfectie uitgevoerd in een 6-wells plaat wordt ongeveer 1,8 ml supernatant geoogst per putje. Eén ug plasmide-DNA is nodig voor elke transfectie uitgevoerd in een 6-wells plaat.
  2. Voor elk putje van een 6-wells plaat, bereiden 100 gl transfectie mengsel, bijv. Bestaande uit 1 pi X-tremeGENE 9 transfectie reagens (of vergelijkbaar product), 1 ug plasmide DNA en serumvrij DMEM.
    1. Bepaal de hoeveelheid plasmide-DNA nodig middels 1 ug plasmide-DNA per putje. Zorg ervoor dat de uiteindelijke concentratie van het plasmide-DNA ten minste 50 ng / ul.
    2. Bepalen hoeveel serumvrij medium (DMEM) nodig per well met de formule: totale volume van DMEM in pi = 100 gl - DNA volume ui.
  3. Voeg 10 6 HEK 293T-17 (ATCC) cellen / putje in 2 ml propagatiemedium (DMEM + 10% foetaal runderserum (FBS)) in een 6-wells plaat. Incubeer gedurende 1 uur bij 37 ° C in een5% CO2 atmosfeer. Seed zoveel als nodig putjes (bepaald in stap 2.1).
  4. Om de transfectie mengsel bereiden aliquot het geschikte volume van serumvrij DMEM, zoals hierboven berekend, in een 1,8 ml polypropyleen microcentrifugebuis en voeg de transfectie reagens.
    1. Pipet reagens direct in de media oplossing, niet toe te voegen aan het plastic oppervlak van de microcentrifugebuis. Voeg plasmide DNA laatste. Pipet op en neer voorzichtig om de oplossing te mengen. Incubeer gedurende 15 minuten bij kamertemperatuur (15 ° C tot 25 ° C) om de vorming van complexen transfectie mogelijk.
    2. Voeg het mengsel in een druppelsgewijze wijze cellen uitgezaaid in 6-wells plaat. Schud of wervelen de putten om een ​​gelijkmatige verdeling van de transfectie complexen te verzekeren.
    3. Seal platen met plastic wrap.
  5. Incubeer kweken bij 37 ° C in een 5% CO2 atmosfeer gedurende 48 uur.
  6. Gebruik een pipet voorzichtig verzamelen en overbrengen supernatant naar een 15 ml buis through een 0,22 pm filter top.
  7. Gebruik pipet om 250 ul of meer overdracht van de gefilterde bovendrijvende tot 1,8 ml microcentrifuge buizen met rubberen afdichtingen in de deksels.
  8. WINKEL gefilterde supernatanten bij -80 ° C tot gebruik.

3. Bepaal Infectieuze titer van virale voorraden op perifeer bloed mononucleaire cellen (PBMCs)

  1. Stimuleer PBMCs met fytohemagglutinine (PHA). Per een virusvoorraad, zaad 2 x 10 6 PBMC's in volledig Iscove's gemodificeerd Dulbecco's medium (cIMDM, IMDM aangevuld met 20 U / ml humaan interleukine 2 (hIL-2), 10% foetaal runderserum en 1% penicilline / streptomycine), aangevuld met PHA (1,5 ug / ml). Seed PBMCs bij 2 x 10 6 cellen / ml. Incubeer PBMC bij 37 ° C in een 5% CO2 atmosfeer gedurende 72 uur.
  2. Harvest PHA gestimuleerde PBMC. Overdracht niet hechtende PHA-PBMC's een 50 ml conische buis. Spin buis bij 228 xg gedurende 10 min. Verwijder supernatant voorzichtig zonder disrupting de celpellet. Resuspendeer de celpellet tot een eindconcentratie van 2 x 10 5 PBMC / ml in cIMDM.
  3. Seed 2 x 10 4 PHA gestimuleerde PBMC / putje in 100 ul / well cIMDM in een ronde bodem 96-well plaat.
  4. Maak een 1:10 verdunning van het virale voorraad. Vervolgens, van de eerste verdunde stock, maak twaalf 3-voudige seriële verdunningen in een 96-well hoofdplaat. Deze verdunning regeling wordt aanbevolen voor het detecteren van virale titers in de range van 10 april - 10 juni infectieuze eenheid (IU) per ml.
    1. Bijvoorbeeld, voeg 20 ul van virusvoorraad met 180 ul medium in 1,5 ml buis. Meng de verwatering door voorzichtig pipetteren. Vervolgens over te dragen 90 pl van de verdunde bouillon in 180 ul media van de eerste goed en meng goed door pipetteren.
    2. Doorgaan verdunningsserie door de overdracht van 90 ul van de huidige goed op 180 ul media in de volgende goed elf keer. Verhoog of de aanvankelijke verwatering afnemen als titers hoger dan 10 6 IU / mlof lager dan 10 4 IU / ml verwacht, respectievelijk.
  5. Voeg 40 ul van de serieel verdund virale voorraad van de master verdunning plaat om de zaadjes PBMCs plaat (uit stap 3.3) in viervoud. Incubeer de platen bij 37 ° C in een 5% CO2 atmosfeer gedurende 16-24 uur.
  6. Verwijder voorzichtig 100 pi supernatant uit elk putje en vervangen door 160 ul vers cIMDM tot een totaal volume van 200 ul / putje. Incubeer de platen bij 37 ° C met 5% CO 2 atmosfeer (dag 1).
  7. Op dagen 4, 7, 10 en 13 overdragen 100 pl supernatant uit elk putje naar 100 pl verstoring buffer (2% Triton X-100 in PBS), en vervangen door 100 pl vers cIMDM. Bewaar de supernatanten bij -20 ° C.
    1. Houd het bemonsteren en het toevoegen van verse cIMDM elke drie dagen tot de titer stabiliseert.
  8. Bepaal de 50% weefselkweek infectieuze dosis (TCID50) van de virale voorraad door p24 ELISA met behulp van de dag 7 en 13 monsters zoals beschreven in stap 4.
    1. Als de TCID50 verkregen van dag 13 is duidelijk hoger dan de titer vanaf dag 7, kan de virus stock langer groeien nodig. Herhaal de p24 ELISA met latere monsters tot de besmettelijke titers van twee steekproeven tijdstippen worden stabiel (of daling). Select voorraden uit monsters met de hoogste titers.

4. ELISA (Enzyme-linked Immunoabsorbant Assay) Detectie van HIV-1 p24 voor het bepalen Virale infectieuze titer

OPMERKING: Het volgende protocol werd ontwikkeld met behulp van p24 antigen capture platen bereid in ons laboratorium 30. Commercieel HIV-1 p24 ELISA plaat / kits kunnen ook worden gebruikt, volgens het protocol van de fabrikant.

  1. Voorafgaand aan het werken met samples, bereiden werkvoorraden van primair antilichaam (konijn anti-HIV-1 SF2 p24 antiserum).
    1. Dooi p24 antiserum bij RT.
    2. Meng 2,5 ml glycerol met 2 ml van 10% FBS in Phosphate buffer saline (PBS).
    3. Voeg 0,5 ml van antiserum en meng.
    4. WINKEL 1 ml porties bij -20 ° C.
  2. Ontdooi monsters van stap 3.7 in een 37 ° C incubator.
  3. Was de p24 capture plaat 5 keer met wasbuffer (1x PBS met 0,05% Tween-20).
  4. Voeg 50 ul / putje van monster verdunningsmiddel (1% bovine serum albumine (BSA), 0,2% Tween-20 in RPMI-1640), voeg 50 pl monster aan geschikte putjes. Ten minste drie putjes met monsterverdunningsmiddel uitsluitend pseudo / negatieve controles. Incubeer 2 uur bij 37 ° C of O / N bij 4 ° C.
  5. Bereid de primaire antilichaamoplossing vers vóór gebruik. Maak een 1: 2000 verdunning van het primaire antilichaam werkvoorraden met het primaire antilichaam verdunningsmiddel (12% FBS in RPMI-1640). Zorg genoeg voorbereiding voor het gebruik van 100 gl oplossing per elk monster / controle putje in een 96-wells plaat.
    1. Bijvoorbeeld, om voldoende oplossing te maken voor één 96-well plaat, voeg 5 ul van het primaire antilichaam working voorraden het primaire antilichaam verdunningsmiddel voor een eindvolume van 10 ml.
  6. Was capture plaat 5 keer met wasbuffer.
  7. Voeg 100 ul van het primaire antilichaam oplossing in elk putje. Incubeer gedurende 1 uur bij 37 ° C in een 5% CO2 atmosfeer.
  8. Bereid het secundaire antilichaam oplossing vers vóór gebruik. Maak een 1: 14.400 voudige verdunning van het secondaire antilichaam (1 mg / ml geit anti-konijn HRP) met het secondaire antilichaam verdunningsmiddel (7% FBS, 0,01% Tween-20 in RPMI-1640). Om pipetteerfouten beperken, voert een tweestaps seriële verdunning. Zorg genoeg voorbereiding voor het gebruik van 100 gl oplossing per elk monster / controle putje in een 96-wells plaat.
    1. Bijvoorbeeld, om voldoende oplossing te maken voor één 96-putjesplaat, eerst 1 pl van het secundaire antilichaam aan 99 pl van het secundaire antilichaam verdunningsmiddel. Voeg vervolgens 70 ul van de eerste verdunning tot het secundaire antilichaam verdunningsmiddel voor een eindvolume van 10 ml.
  9. Wash capture plaat 5 times met wasbuffer.
  10. Voeg 100 ul van het secundaire antilichaam-oplossing aan elk putje. Incubeer gedurende 1 uur bij 37 ° C in een 5% CO2 atmosfeer.
  11. Was de plaat 5 keer met wasbuffer.
  12. Voeg 100 ul van RT TMB substraat. Incubeer 30 minuten bij kamertemperatuur in een gesloten container te beschermen tegen licht.
  13. Voeg 100 ul van RT stopoplossing (1 NH 2 SO 4).
  14. Lees absorptie bij 450-650 nm in elk putje met behulp van een microplaat reader. Gebruik de absorptie waarde aan elke evenals geïnfecteerde of niet-geïnfecteerde scoren. Overweeg een goed op infectieus virus bevatten, indien de absorptiewaarde ten minste driemaal hoger dan de waarde gelezen uit pseudo / negatieve controle wells. Bereken TCID50 van het virale voorraad met behulp van het Reed-Meunch methode 31.

5. Bepaal Viral groeikinetiek

5.1) Monoinfection

  1. Seed 3 x 10 5-PHA gestimuleerde PBMC / putje in 48-well plaats in een totaal volume van 500 ul / putje. Deze cultuur platen bij 37 ° C in een 5% CO2 atmosfeer tot inoculatie.
  2. Voor elk virus, bereiden een entstof met 6.000 IE in 2 ml cIMDM.
  3. Inoculeer wells in drievoud door toevoeging van 500 gl van het inoculum (1500 IU) aan de geënte cellen. Het eindvolume van de geïnfecteerde celkweek 1 ml / putje en de MOI is 0,005.
  4. Aliquot 200 ul van de resterende inoculum overgebracht in twee 96-well platen voor RNA-isolatie, waarvan er één wordt opgeslagen als back-up.
  5. Incubeer kweken bij 37 ° C in een 5% CO2 atmosfeer gedurende 16-24 uur.
  6. Wash kweken 16-24 uur na inoculatie.
    1. Verwijder en gooi 750 ul kweeksupernatant.
    2. Voeg 750 ul van verse cIMDM. Wikkel platen in plasticfolie en draai gedurende 10 minuten bij 300 x g. Verwijder en gooi 750 ul supernatant.
    3. Voeg 750 ul van verse cIMDM. Incubeer bij 37 ° C met 5% CO 2 bijmosphere (dag 1).
  7. Monster culturen dagelijks van dag 2 tot dag 7.
    1. Breng 500 pi kweeksupernatant een 1,8 ml centrifugebuis. Centrifugeren gedurende 1 minuut bij 3000 x g.
    2. Overdracht 200 ul van het celvrije supernatant aan de twee 96-well platen sample voor RNA-isolatie, opnieuw op te slaan een bord als backup. WINKEL supernatanten bij -80 ° C totdat RNA-isolatie.
    3. Voeg 500 ul vers cIMDM aan elke cultuur. Incubeer bij 37 ° C in een 5% CO2 atmosfeer.
    4. Gooi culturen tot Wescodyne aan het einde van het experiment.
    5. Isoleer RNA uit 200 ul supernatant (gebruik de handel verkrijgbare kits zoals QIAamp Viral RNA Mini Kit) volgens standaard protocol van de fabrikant. Voor een groot aantal monsters, gebruik maken van de Qiagen QIAxtractor.
    6. WINKEL RNA monsters bij -80 ° C tot cDNA synthese.

5.2) cDNA Synthesis (reverse transcriptie)

  1. Voor elk RNA sruim, voeg 1,2 nmol dNTP en 1,2 pmol van cDNA synthese primer (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', HXB2 nucleotide 7968-7995) aan 10 ul van viraal RNA. Voeg water toe tot een uiteindelijk volume van 14 pl. Flick buis te mengen en spinnen kort vloeistof verzamelen op de bodem van de buis.
  2. Incubeer het mengsel gedurende 5 minuten bij 65 ° C en vervolgens houden op 4 ° C totdat de master mix bereid.
  3. Bereid Master Mix behulp 5x eerste streng buffer (250 mM Tris-HCl, pH 8,3, 375 mM KCl, 15 mM MgCl2), 5 mM DTT, 120 U van SuperScriptIII en 240 U RNase inhibitor. Voeg water toe tot de uiteindelijke volume van 10 pi.
  4. Voeg 10 ul van de master mix aan RNA mengsel, flick te mengen en spin te verzamelen.
  5. Incubeer het mengsel gedurende 90 min bij 50 ° C om de synthese van cDNA mogelijk te maken. Incubeer gedurende 15 minuten bij 70 ° C om reverse transcriptase inactiveren. Houden op 4 ° C indien nodig.
  6. Voeg 2 U van Rnase H, flick te mengen, en dan draaien om te verzamelen.
  7. Incubeer 20 minbij 37 ° C. WINKEL cDNA bij -20 ° C.

5.3) cDNA Kwantificering met behulp van qPCR System

  1. Bereid een standaard verdunning serie. Doe 10-voudige seriële verdunning van 3 x 10 6 kopieën / ul tot 30 kopieën / ul, van pNL4-3VifA. Gebruik gedestilleerd water voor verdunningen. Bereid de standaard verdunningsseries vers vóór gebruik of bereiden kleine series en laten -20 ° C. Niet in de vriezer-dooi de normen meer dan drie keer.
  2. Het opzetten van een 96-well qPCR reactie plaat. Zorg ervoor dat elke plaat ten minste één putje van negatieve controles, een drievoud van de standaard verdunningsseries en ten minste een kopie van elk cDNA monster.
  3. Voor elke qPCR reactie, gebruik 12,5 ul qPCR master mix, 0,2 uM sonde, 0,8 uM van elk van de voorwaartse en achterwaartse primers en 1 pi van cDNA of de standaard verdunning serie of water / buffer (voor de negatieve controle ook). Voeg water toe tot een uiteindelijk volume van 25 pl. De qPCR sonde is licht sensitive. Hou het in een gesloten container.
    1. CDNA verkregen uit pNL4-3VifA gebaseerde moleculaire kloon te detecteren, het Vifa primer-probe: VifAB voorwaartse primer (GGTCTGCATACAGGAGAAAGAGACT), VIFA reverse primer (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') en VifAB probe (6FAM-5'-CTCCATTCTATGGAGACTC-3 '-MGBNFQ). Voor cDNA afgeleid van pNL4-3VifB gebaseerde kloon, met de VifB primer-probe: VifAB voorwaartse primer, probe en VifAB VifB reverse primer (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Stel PCR cyclusparameters tot 50 ° C gedurende 2 min, 95 ° C gedurende 10 minuten en 40 cycli van 95 ° C gedurende 15 sec en 60 ° C gedurende 1 min. Raadpleeg steun van de fabrikant document voor bediening van de machine qPCR.
  5. Bereken een standaardcurve met behulp van gegevens uit de triplo standaard verdunningsserie. Vergelijken amplificatie gegevens van de cDNA monster op de standaardcurve voor het aantal kopieën te bepalen. Raadpleeg steun van de fabrikant document voor data processing.

5.4) Bepaal Viral exponentiële groei Fase

  1. Plot virale groei kinetiek de dag sampling langs de X-as en de cDNA-kopieaantal langs de Y-as en identificeren van het virale exponentiële groeifase, bijv. Wanneer de virale cDNA-kopie aantallen vermeerdering van een exponentiële progressie.
  2. Gebruik de GRC webtool ( http://indra.mullins.microbiol.washington.edu/grc/ ) om virale groei (g) te berekenen. In deze aanvrage, het GRC gereedschap accepteert cDNA kopie getallen van ten minste twee tijdstippen als invoer en voert het virale groei (g). Gebruik alleen tijdstip gegevens binnen de exponentiële groeifase (zie stap 5.4.1 hierboven) om nauwkeurige groeicijfers te verkrijgen. Voor een gedetailleerde beschrijving van het wiskundige model worden gebruikt in de GRC webtool, zie 20.

6. Groei Competitie Assay

  1. Seed 3 x 10 5 </ Sup>-PHA gestimuleerde PBMC (of 1 x 10 5 CEMx174 cellen) in 500 ul totaal volume per putje in een 48 goed platbodem plaat.
  2. Blijf plaat 37 ° C in een 5% CO2 atmosfeer tot inoculatie.
  3. Voor elk virus, voor te bereiden 3 ml entstof bevatten 6.000 IE.
  4. Breng 1,5 ml van elk viraal inoculum in een steriele buis de dubbele infectie inoculum maken. Voeg 500 ul van tweevoudige inoculum (1500 IU) tot 3 x 10 5 cellen in een 48-wells plaat. Het uiteindelijke cultuur volume 1 ml / putje. Aliquot 200 ul van het inoculum twee 96-well platen voor RNA-isolatie; behalve een plaat als een back-up.
  5. Incubeer geënte cellen bij 37 ° C met 5% CO 2 atmosfeer gedurende 16-24 uur.
  6. Wash kweken 16-24 uur na inoculatie.
    1. Verwijder en gooi 750 ul kweeksupernatant.
    2. Voeg 750 ul van verse cIMDM. Wikkel platen in plasticfolie en draai gedurende 10 min bij 300 x g. Verwijder en gooi 75081; l supernatant.
    3. Voeg 750 ul van verse cIMDM. Incubeer bij 37 ° C met 5% CO 2 atmosfeer (dag 1).
  7. Selecteer bemonsteringstijdstippen ten minste 3 tijdstippen in de exponentiële groeifase waargenomen in stap 5.4.1 omvatten.
    1. Voor elke bemonstering, volgt u stap 5.1.7.
  8. Voer cDNA synthese zoals beschreven in paragraaf 5.2.
  9. Bepaal de virale variant verhouding met behulp van qPCR.
    1. Bereid een standaard seriële verdunningsreeks in drievoud, 10-voudig verdund in elke stap van 3 x 10 6 kopieën / ul tot 30 kopieën / pl pNL4-3VifA.
    2. Het opzetten van een 96-well qPCR reactie plaat. Zorg ervoor dat elke plaat ten minste één negatieve controle, de standaard verdunningsreeks in drievoud en duplicaten van elk cDNA monster.
    3. Voor elke qPCR reactie, gebruik 12,5 ul qPCR Master Mix, 0,2 uM sonde, 0,8 uM van elk van de voorwaartse en achterwaartse primers en 1 pi van cDNA of de standaard d ilution serie of water / buffer (voor de negatieve controle putten). Voeg water toe tot een uiteindelijk volume van 25 pl. De qPCR sonde is lichtgevoelig, houd het in een gesloten container.
      1. Gebruik Vifa primer-probe om signalen te detecteren in de negatieve controles en de standaard verdunningsseries en een duplicaat van het cDNA monster. Gebruik VifB primer-probe met andere duplicaat van het cDNA monster.
    4. Stel PCR cyclusparameters tot 50 ° C gedurende 2 min, vervolgens 95 ° C gedurende 10 min en vervolgens 40 cycli van 95 ° C gedurende 15 sec en 60 ° C gedurende 1 min. Raadpleeg steun van de fabrikant document voor bediening van de machine qPCR.
    5. Bereken de standaardkromme middels amplificatie gegevens van het standaard verdunningsserie. Vergelijken amplificatie gegevens van de cDNA monsters met de standaardkromme om kopieaantal te bepalen. Raadpleeg steun van de fabrikant document voor gegevensverwerking.
    6. Gebruik de GRC webtool (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) relatieve virale fitness (d) te berekenen.
      OPMERKING: Het GRC hulpmiddel accepteert cDNA kopiëren nummers of chromatogram piekhoogte uit ten minste twee tijdstippen als de input, en voert de netto-groei verschil (d) tussen de twee virussen. Terwijl het gereedschap van de netto-groei van twee tijdstip gegevens kunnen berekenen, is het sterk aanbevolen om input gegevens van drie of meer tijdstippen. Gebruik alleen de gegevens verkregen uit tijdstippen binnen de exponentiële groei fase (zie stap 5.4) om nauwkeurige groeicijfers te verkrijgen. Voor een gedetailleerde beschrijving van het wiskundige model worden gebruikt in de GRC webtool, zie 20.
  10. Bepaal virale verhoudingen met chromatogram peak-hoogten
    1. PCR versterken HIV-1 vif fragmenten die de VifAB volgorde tag met VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; HXB2 positioneert 5266-5291) en VifRev primers (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 posities 5579-5553).
      1. Voor elke PCR reactie werd gebruikt 1 pl cDNA, 1 x NH 4 buffer, 1,5 mM MgCl2, 0,2 mM dNTP, 2,5 U Taq polymerase en 0,45 pM van elke primer. Voeg water toe tot een uiteindelijk volume van 50 pl.
      2. Stel PCR cyclusparameters tot 3 cycli bij 94 ° C gedurende 1 min, 55 ° C gedurende 1 min en 70 ° C gedurende 1 min, gevolgd door 34 cycli bij 94 ° C gedurende 15 sec, 58 ° C gedurende 30 sec, en 70 ° C gedurende 1 min, en vervolgens houden op 4 ° C.
    2. Zuiver PCR producten met behulp van de QIAquick PCR zuivering kit volgens het protocol van de fabrikant.
    3. Geef gezuiverde PCR producten die een DNA sequentie dienstverlener voor Sanger sequentiebepaling.
    4. Controleer de gemiddelde read kwaliteit score, die moet worden verstrekt door de sequencing service. Als de gemiddelde nauwkeurigheid basis oproep minder dan 85%, opnieuw stap 6.10.1 naar 6.10.3
    5. Gebruik de ChromatQuan webtool (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) virale verhouding te berekenen op elk tijdstip. De machine moet de sequentie traceringbestand (* .ab1) en de sequentie 5 'aan de nucleotide plaats van belang. De tool meet de piek intensiteit op de opgegeven locatie. De verhouding van de piekintensiteit overeenkomt met de verhouding van de twee virussen (Figuur 4B).
    6. Gebruik de GRC webtool ( http://indra.mullins.microbiol.washington.edu/grc/ ) en de opgenomen piekintensiteiten als input voor virale relatieve fitness (d) te berekenen. Zie stap 6.10.6. 20

Representative Results

Om de geschiktheid effect van enkele aminozuurveranderingen in HIV-1-Gag p24 onderzoeken, gebruikten we oligonucleotide-gerichte mutagenese om mutaties te introduceren in een pNL4-3 plasmide dat het HIV-1-p24-gen COTB 23,32,33. Virale voorraden werden gegenereerd door transfectie van 293T-cellen en geoogst na 48 uur. We schatten de 50% weefselkweek infectieuze dosis (TCID50) van elke virale voorraad van het Reed-Muench methode 31. De TCID50 van het prototype en mutante virussen varieerde van 10 april - 10 mei IU / ml (Figuur 3A).

De groeikinetiek van de recombinante virussen werden in PBMC opgericht vanuit een donor met een MOI van 0,005. RT-qPCR werd gebruikt om de dagelijkse virale cDNA aantal kopieën te meten zes dagen. Alle mutante virussen en prototype exponentieel steeg tussen dag 2 en dag 4, waarna virale groei vertraagd, zoals aangegeven door een verminderde helling van het virale RNA kopienummer verhoging (<strong> Figuur 3B). De afname van cDNA kopienummer tussen dag 0 (overeenkomend met de inoculum) en dag 2 wordt veroorzaakt door de absorptie van het virus aan de cellen en het verwijderen van niet-gebonden virionen per dag 1 was (stap 5.1.6). In de exponentiële groeifase alledrie mutanten hadden een tragere groeisnelheid (g) dan het prototype virus (Figuur 3C).

Alle drie mutanten werden concurreerde prototype virus groei competitietesten in totaal MOI van 0,005. Virale groeikinetiek in tweevoudig geïnfecteerde kweken was vergelijkbaar met die van monoinfection; virale exponentiële groeifase was tussen dag 2 en 4, en virale groei een plateau bereikt rond dag 5 (Figuur 4A).

Virale groei verschillen werden afgeleid uit de verandering van de virale verhouding in de tijd. Het virus werd berekend op basis van cDNA kopieaantal van de referentie en de mutante virussen met behulp van RT-qPCR, en door vergelijking van piekhoogtenachtereenvolgens chromatogrammen op nucleotideplaatsen onderscheiden de twee virussen (Figuur 4B). Het groeitempo verschillen bepaald met behulp van de piek-hoogte en viraal RNA copy aantal methoden leverde vergelijkbare resultaten (Figuur 4C). Alle drie mutanten hadden lagere replicatie fitness dan het prototype-virussen met de mutant I256V met de laagste fitness (Figuur 4C).

Figuur 1
Figuur 1: Stroomdiagram van de in dit document protocols Het viruspreparaat protocols betrekking bouw van HIV-1 recombinante klonen en productie van virale voorraden.. De Fitness Testen protocollen zijn voor het vaststellen van virale groei kinetiek en het bepalen van de relatieve virale fitness. Stippellijnen vertegenwoordigen alternatieve stromen voor de protocollen. Bijvoorbeeld kan een mutatie worden direct in HIV-1 NL4-3 ingevoerdmoleculaire kloon zonder het genereren van een recombinant-kloon.

Figuur 2
Figuur 2:. Constructie van HIV-1 NL4-3 COTB Gag p24-recombinante moleculaire klonen middels overlap extensie PCR (A) Ontwerp de chimère primers. De 5 'helften van de primers bevatten de NL4-3 vector sequentie en de 3' helften bevatten de einden van de insert sequentie. (B) Chimere primers gebruikt om het insert fragment, COTB Gag p24 amplificeren. (C) De insertie-fragmenten worden gebruikt als primers voor een tweede PCR met een nieuw recombinant-plasmide te genereren.

Figuur 3
Figuur 3:. Virale groeikenmerken in PBMCs (A) Log 10 TCID50 (B) Virale groeikinetiek in monoinfections begonnen bij een MOI = 0,005. (C) Virale groeipercentage in zes dagen, inclusief de exponentiële groeifase (dagen 2-4) verkregen uit paneel (B). De getoonde waarden vertegenwoordigen het gemiddelde van drie herhalingen van het ene experiment. De fout balken geven 95% betrouwbaarheidsintervallen.

Figuur 4
Figuur 4: Virale groei en relatieve fitness bepalingen (A) Virale groei in tweevoudig geïnfecteerde PBMC culturen.. (B) Ratio van T242N en prototype virussen bepaald met behulp van RT-qPCR of sequencing piek hoogte methode. (C) Netto virale groei verschillen (d) tussen de mutant en het prototype virussen tweevoudig geïnfecteerde kweken, zoals in (A). d-waarden werden berekend from de virale verhoudingsgegevens getoond in (B). De getoonde waarden vertegenwoordigen het gemiddelde van drie herhalingen van het ene experiment. De fout balken geven 95% betrouwbaarheidsintervallen.

Discussion

De gepresenteerde protocol bestond uit twee delen: de bouw van recombinant HIV-1 moleculaire klonen en groei concurrentie assays. Om de twee virussen in een tweevoudig geïnfecteerde celkweek te onderscheiden, is het belangrijk dat de concurrerende moleculaire klonen bevatten sequentietags, die kan worden gedetecteerd door een RT-qPCR primer-probe assay of door Sanger sequentiebepaling. Dit protocol maakt gebruik van de Vifa en VifB markeringen, die hetzelfde gebied van HIV-1 NL4-3 vif bezetten en coderen voor dezelfde aminozuursequentie maar verschillen zes synoniem mutaties. Deze mutaties bleken niet te beïnvloeden virale replicatie fitness 20. De PCR-gebaseerde kloneringswerkwijze gebruikt in dit protocol geeft meer flexibiliteit bij de keuze kloneringsplaatsen tegenover restrictieplaats gebaseerde klonering. De efficiëntie van PCR klonering af naarmate de insert wordt groter. De stroomlimiet van de insert grootte ~ 5 kb 34. Voor PCR-gebaseerde klonen en plaatsgerichte mutagenesis, het gebruik van een high-fidelity DNA polymerase is cruciaal om de kans op extra mutaties verminderen. Het gebruik van het minimale aantal PCR cycli die nodig zijn om voldoende hoeveelheden van produkten verkregen wordt ook aanbevolen. In onze ervaring, hebben we geen extra mutaties na de PCR-gebaseerde klonen en plaatsgerichte mutagenese hier beschreven stappen op te sporen. Toch is de PCR producten worden gesequenced om te controleren op ongewenste mutaties. Idealiter zou de gehele HIV coderende gebied wordt resequenced.

Minstens drie sampling tijdstippen moeten worden onderzocht binnen de exponentiële groeifase 9. De virale groeikinetiek moet eerst worden vastgesteld met behulp van de dagelijkse steekproeven naar de juiste kweekperiode en bemonstering tijdstippen voor de groei concurrentie te bepalen. Een factor die virusgroei kinetiek beïnvloedt is de multipliciteit van infectie (MOI). Dit protocol maakt gebruik van een totaal MOI van 0,005 voor zowel monoinfection en de groei van de concurrentie, zoals het werd aangetoond dat meer ro opleverenbuste resultaten dan lagere MOI 9. Desalniettemin kunnen lagere MOI's worden gebruikt om indien gewenst een langere exponentiële groeifase te verkrijgen, maar ten koste van het resultaat consistentie. Dit protocol geeft een aanvankelijke infectie van 50:50, aangenomen dat de conditie verschillen van de virussen die in het algemeen niet op voorhand. Het gebruik van ongelijke ingang verhoudingen geschikt wanneer er voorlopige gegevens suggereren significante verschillen in virale replicatie kinetiek. In deze gevallen wordt een infectie van 70:30 aanbevolen om voor de detectie van een grote fitness uit waar het minder geschikt virus wordt in overmaat 9.

Het protocol voor het bepalen van de TCID 50, virale groei kinetiek en voor het uitvoeren van de groei competitietesten werden geoptimaliseerd met behulp van HIV-1 subtype B zijn NL4-3 COTB-p24 en PBMC's van een donor waarvan PBMC constante gevoeligheid aangetoond HIV- 1-infectie in vitro. De kweekperiodeen bemonstering tijdstippen die in dit protocol zijn waarschijnlijk geschikt voor het bestuderen van HIV-1 groep M virussen in menselijke PBMC's te zijn. Met behulp van PBMC uit één bron wordt sterk aangeraden om consistente resultaten te verkrijgen als de virale replicatie kan variëren in verschillende donorcellen 35. Alhoewel minder wenselijk kunnen PBMC samengebracht uit meerdere donoren worden gebruikt als vervanging voorwaarde dat dezelfde pool wordt gebruikt in alle experimenten. Een ander alternatief is het gebruik van cellijnen. De hier gepresenteerde protocol werd met succes gebruikt bij de T-cellijn CEMx174 23,36. Het is echter van belang dat het aantal cellen uitgezet zijn opnieuw geoptimaliseerd om consistente celgroei te bereiken. Virale groeikinetica moeten worden hersteld, omdat het kan variëren in verschillende cellijnen, voor de juiste bemonsteringstijdstip punten bepalen de stappen groeicompetitie.

Twee verschillende methoden om de virale verhouding berekend geschiktheid vast zijn opgenomen in de protocol. De eerste maakt gebruik van RT-qPCR om virale cDNA aantal kopieën op elk monsternemingstijdstip punt meten. Virusreplicatie fitness werd vervolgens berekend uit het virale verhouding, gebaseerd op cDNA-kopieaantal. Alternatief kan het virale verhouding worden bepaald op basis van de verhouding van chromatogram piekhoogte bij VifAB tag sites. Beide werkwijzen leverden vergelijkbare resultaten (Figuur 4). Het chromatogram piekhoogte werkwijze kan worden toegepast op andere HIV-1-stammen zonder aangelegde sequentieaanhangsel. Voor RT-qPCR, het gebruik van primers of probes om virale varianten onderscheiden eerst zorgvuldig moet worden geëvalueerd (zie 20). Niettemin RT-qPCR een betere gevoeligheid voor monsters met een kleine hoeveelheid viraal RNA, zoals die van het eerste tijdpunt in de exponentiële groeifase. Directe meting van de virale cDNA maakt het ook mogelijk de detectie van technische problemen die kunnen voortvloeien uit de RNA-extractie en cDNA synthese. Het gebruik van moleculaire klonen met sequentietags een kosteneffectieve oplossing to de RT-qPCR methode, aangezien slechts twee paren van primers en probes nodig zijn meerdere virussen te bestuderen. Deze strategie vermijdt het probleem van piek hoogte variatie in sequentie chromatogrammen vanwege naburige bases 37, zoals sequentiebepaling wordt uitgevoerd op dezelfde locatie voor alle virussen in de studie. De PCR producten geproduceerd voor RT-qPCR en Sanger sequentiebepaling kan ook gebruik van andere methoden om virale verhouding vastgesteld zoals bulk sequencen van individuele klonen 12,13, HTA 4,7,17,19 of oligonucleotide ligatie-assay (OLA) 38 .

Disclosures

De auteurs verklaren dat ze geen concurrerende financiële belangen. De meningen hier zijn die van de auteurs en mag niet worden opgevat als officiële of vertegenwoordiging van de standpunten van het Amerikaanse ministerie van Defensie of het Ministerie van het Leger.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Paarsgewijze Groei Competitie Assay voor het bepalen van de Replicatie Fitness van Human Immunodeficiency Virussen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter