Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Das BM12 Inducible Modell des systemischen Lupus erythematodes (SLE) in C57BL / 6-Mäuse

doi: 10.3791/53319 Published: November 1, 2015

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Systemischer Lupus erythematodes (SLE) ist eine komplexe Autoimmunerkrankung prototypisch durch Anti-Atom-Antikörper (ANA) Produktion und Glomerulonephritis gekennzeichnet. Zahlreiche weitere Folgeerscheinungen, einschließlich Haut, Herz-Lungen-und Leberläsionen mit Krankheit bei einigen Personen verbunden. Prävalenzschätzungen in den USA sind sehr unterschiedlich, von 150,000-1,500,000 1,2, mit besonders hohen Inzidenz bei Frauen und Minderheiten 3. Obwohl die Ätiologie von SLE ist schwer zu erkennen, ist es gedacht, um aus dem Zusammenspiel verschiedener genetischer und Umweltfaktoren, die bei der systemischen Autoimmunität gipfeln auftreten.

Wurden zahlreiche Tiermodelle verwendet werden, um Faktoren, die zu Beginn der Erkrankung und Progression zu studieren. Klassische Mausmodellen der SLE umfassen genetisch prädisponierten Mausstämmen einschließlich des NZB x NZW F1-Modell und seine Derivate NZM, MLR / lpr-Dehnung und der BXSB / Yaa Dehnung und induzierbare Systeme, wie beispielsweise die pristane und chronischen Graft-versus-Host-Krankheit (cGVHD) Modelle 4. Frühe Berichte der Autoantikörperproduktion in GVHD Modellen verschiedenen Mausstämmen oder Hamsterstämme für Eltern in F1 Transfers 5-8; häufiger Methoden verwendet, um Lupus-ähnlichen Krankheit zu studieren derzeit sind die DBA / 2-Mutter → (C57BL / 6 x DBA / 2) F1, und die hier beschriebene BM12 Transfermodell. Jedes Modell hat seine eigenen Vorbehalte, aber sie teilen in der Regel einen gemeinsamen Satz von Funktionen, die mit klinischen Merkmalen der Krankheit beim Menschen korrelieren. Die am häufigsten berichteten Parametern in Maus-Modellen gehören Splenomegalie, Lymphadenopathie, Nephritis, ANA Produktion und auf zellulärer Ebene, die Erweiterung der T-Helfer-Zellen follikuläre (Tfh), Keimzentrum (GC) B-Zellen und Plasmazellen.

H2 - - Ab1 BM12 / KhEgJ (BM12) Mäusen, einem Stamm i Die induzierbare BM12 Modell wird durch den adoptiven Transfer von Lymphozyten aus IA BM12 B6 (C) erreichtDentical auf C57BL / 6 mit Ausnahme von 3 Aminosäure-Substitutionen auf MHC-Klasse II, in IA b C57BL / 6 (B6) Mäusen. Alloaktivierung von Spender CD4 T-Zellen durch Empfänger APCs zu cGVHD mit Symptomen sehr ähnlich SLE. Diese umfassen insbesondere Ausbau der Spender abgeleiteten Tfh Expansion des Empfängers abgeleiteten GC-B-Zellen und Plasmazellen, und die Produktion von ANA einschließlich Anti-dsDNA, anti-ssDNA, Anti Chromatin und anti-RBC Antikörper 9. Im Laufe der Zeit entwickeln Empfängermäuse Glomerulonephritis mit IgG-Ablagerungen in der glomerulären, interstitiellen und vaskulären Bereichen der Nieren 10 verbunden. Wir haben kürzlich gezeigt, dass, ähnlich der menschlichen Krankheit, gibt es auch eine kritische Rolle für Typ I-IFN in diesem Modell 11. Insbesondere die Festlegung von Kriterien für die menschliche SLE umfassen die Entwicklung von Nephritis kompatibel mit SLE in Gegenwart von anti-dsDNA-Antikörper 12, die beide herausragende Merkmale dieses Mausmodell.

Es gibt seVeral Vorteile der BM12-Modell über die spontane Modelle. Classic-Modelle, die sich spontan SLE-ähnliche Zeichen zu entwickeln verlassen sich auf entweder Hybridmausstämme, Inzucht-Mausstämmen nicht auf dem B6 Hintergrund, oder große genetische Loci auf der B6 Hintergrund, die Überfahrt machen, um Knockout oder anderweitig genetisch veränderten Mäusen schwierig und zeitaufwendig. Mit dem BM12 induzierbaren Modell können genetisch veränderten Mäusen entweder als Spender oder Empfänger dienen, so dass eine schnellere Identifizierung der zellulären Kompartiment, in denen bestimmte Gene wichtig für die Krankheit sein. Darüber hinaus ist die Entwicklung der Krankheit in der BM12-Modell viel schneller und erfordert nur 2 Wochen bis zum Auftreten von ANA, im Vergleich zu mehreren Monaten für die meisten spontanen Modelle. Darüber hinaus, im Gegensatz zu den spontanen Krankheitsmodell zu unterschiedlichen Zeitpunkten zu entwickeln, die Krankheit Beginn und Fortschreiten im BM12 → B6 Modell hoch synchronisiert. Dies ermöglicht die Erzeugung von geeigneter Größe Kohorten daß Be für die interventionelle oder therapeutische Strategien in jedem Stadium des Krankheitsentwicklung eingesetzt.

Was folgt, ist eine detaillierte Protokoll zum Initiieren SLE-ähnliche Autoimmunität durch den adoptiven Transfer von BM12 Lymphozyten in C57BL / 6-Mäuse, oder genetische Varianten B6 Hintergrund. Zusätzlich beschreiben wir eine durchflusszytometrische Färbeprotokoll zum Aufzählen Tfh, GC-B-Zellen und Plasmazellen-Zelltypen mit menschlichem Krankheit. Wichtig ist, dass diese Protokolle ebenfalls verwendet, um Krankheiten in den meisten Mausmodelle für SLE zu charakterisieren und zu identifizieren Tfh, GC-B-Zellen und Plasmazellen in anderen Krankheitsmodellen werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tier Arbeit wurde unter spezifischen pathogenfreien Bedingungen in Übereinstimmung mit den Richtlinien der Gesellschaft für Evaluierung und Akkreditierung von Laboratory Animal Care International und unserer Institutional Animal Care und Verwenden Committee (IACUC) eingestellt durchgeführt.

HINWEIS: Integrieren Mäuse eine kongene Marker exprimieren, wie CD45.1 entweder Spender oder Empfängertiere falls möglich, da auf diese Weise für die Überwachung des Spendertransplantat Effizienz und spezifischen Dehnung des Spenders CD4 T-Zellpopulation. Wenn unter Berücksichtigung der Verwendung von ansonsten genetisch veränderten Mäusen als Spender oder Empfänger sicherzustellen, die Belastung richtig mit dem B6 Hintergrund zurückgekreuzt oder übertragen Zellen kann abgelehnt werden, dies wird ausführlicher in den repräsentativen Ergebnisse und Diskussion Abschnitten behandelt werden.

HINWEIS: Die folgenden Verfahren detailliert Mengen für die Ernte 4 Spender BM12 Mäusen, die genügend Zellen ergeben sollte 12-16 Mäusen zu spritzen. Sechsbis zwölf Wochen alten Mäusen BM12 ergeben etwa 100-140000000 Lymphozyten mit ca. 25% CD4-T-Zellen. Wenn die mit einer unterschiedlichen Anzahl von Mäusen, oder verschiedene Mausstämme, Skala Volumina nach oben oder unten entsprechend. C57BL / 6-Mäusen geben allgemein ähnlich Ausbeuten näher nur 20% CD4 T-Zellen.

HINWEIS: Führen Sie alle Schritte bei RT und RT nutzen Medien, um Wärme und Kälteschock, die langfristige Lebensfähigkeit Lymphozyten beeinträchtigen können, zu vermeiden. Führen gewebe Ernte und gewebeVerarbeitungsSchritte in einer Gewebekultur Haube unter aseptischen Bedingungen. Alle Medien in diesem Protokoll ist IMDM mit 10% hitzeinaktiviertem FBS, wenn nicht anders angegeben, und werden einfach nachstehend als "Komplettmedium".

1. neue Methode zur Genotypisierung BM12 Mäuse

ANMERKUNG: Eine kurze Restriktionsverdau-basiertes Protokoll für die Genotypisierung ist hier vorgesehen, wie eine einfache und preiswerte Alternative zur Sequenzierung, die derzeit die einzige veröffentlichte Genotypisierungsmethodefür diesen Mäusen.

  1. Isolieren genomischer DNA aus Mäuseschwänzen. Bitte auf einen früheren JoVE Artikel für detaillierte Protokolle über Maus Schwanz Clipping und der Erzeugung von cDNA aus tail beziehen verdaut 13.
  2. Einen Reverse-Transkriptase-polymerisierten Ketten-Reaktion (PCR) 14, einen gemeinsamen 474-bp-DNA-Fragment von MHC-II-IA b und IA BM12 Verwendung von Primern und Thermocycling-Bedingungen in Tabelle 1 aufgeführten amplifizieren.
  3. Führen Restriktionsverdau auf ~ 7 & mgr; l des PCR-Produkts unter Verwendung des Enzyms PsuI, oder einer ihrer Isoschizomere (BstX2I, BstYI, MflI oder XhoII), die Wildtyp-IA b schneidet, aber nicht IA BM12 Mutante. Folgen verdauen Protokoll des Herstellers, die eine Mischung aus Wasser geben wird, Puffer und Enzym und einer Inkubationszeit von 5 min zur Verfügung gestellt. bis zu mehreren Stunden bei 37 ° C 15.
  4. Laden Sie verdauen Produkt- und laufen auf 1% Polyacrylamid-Gel mit Ethidiumbromid 14 für 30-45 min. um 150V-obwohl optimale Spannung und Zeit-Einstellungen in Abhängigkeit von der PCR-Gel-Apparatur variieren. Visualisieren DNA-Banden mit einem UV-Belichtungseinheit. Repräsentative Ergebnisse sind in Abbildung 1 dargestellt.

Abbildung 1
Abbildung 1. Repräsentative BM12 Genotypisierung Ergebnisse.
Mäusen, die homozygot für IA BM12 / BM12 zu identifizieren, wurde Schwanz-DNA für BM12 durch PCR gescreent / Restriktionsverdau Genotypisierung (Schritt 1). Homozygot Wildtyp (IA b / b) DNA ergibt zwei Banden bei 227 und 247 bp (als einer dicken Band visualisiert bei ~ 250 bp); homozygot BM12 (IA BM12 / BM12) DNA-Ausbeuten eine Bande bei 474 bp; und heterozygote (IA BM12 / b) DNA ergibt zwei Banden bei ~ 250 und 474 bp. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

2. Ernte DonorCells

  1. Sacrifice Spendermäusen mit Institutional Animal Care und Verwenden Committee (IACUC) -anerkannte primären und sekundären Euthanasiemethoden. B. euthanize Mäuse durch Ersticken mit CO 2, gefolgt durch zervikale Dislokation.
  2. Unter aseptischen Bedingungen Ernte Milz und Lymphknoten (oberflächliche Hals-, Unterkiefer, brachial, Achsel, mesenterialen und Leisten) in 15 ml Röhrchen mit 10 ml Komplettmedium, wie in 11-13.
    HINWEIS: Siehe früheren Berichten für detaillierte Lymphknotendissektion Protokolle 16-18. Dieses Modell ist auch erfolgreich nur mit Maus-Splenozyten für die Übertragung, aber die Zugabe von Lymphknoten die erforderliche Anzahl von Spendermäusen signifikant verringert.
  3. Generieren Sie eine Einzelzellsuspension durch Maischen lymphatischen Gewebe mit dem Kolben aus einer Spritze in Schritt 2,2 bis 70 & mgr; m Zellsiebe gesammelt. Für bessere Erträge, nicht überladen Siebe bedien ~ 6 Siebe für alle 4Mäuse verarbeitet, und spülen Siebe häufig während der Verarbeitung. Kombinieren Gewebe von 4 Mäusen in zwei konische 50 ml-Röhrchen, so Zentrifuge Zellen 5 min bei 400 xg und Dekantieren.
  4. Die Zellen von beiden konischen Röhrchen in 50 ml Vollmedium und Transfer zum neuen konischen Rohr. Bewahren Sie dieses Rohr bei RT.
    Anmerkung: Fett haftet an den Seiten der Röhre, und, wenn das Rohr nicht ersetzt wird, endgültige Zell Ausbeuten leiden.

3. Spenderzellzählung

WICHTIG: Um die höchste Rentabilität, roten Blutzellen (RBC) Lyse der gesamten Probe zu erhalten wird nicht empfohlen.

  1. Mischen Sie Einzelzellsuspension aus Schritt 2.4 auch, entfernen 1 ml und überträgt es auf einer separaten 50 ml konischen. Beiseite verbleibenden, unberührte Zellen (49 ml) bei RT beim Zählen.
  2. 3 ml einer Ammoniumchloridbasis Lyse roter Blutkörperchen Puffer zu der 1 ml Donorzelle Probe. Vorsichtig mischen 1 min. durch Schaukeln, dann auf 50 ml mit kompletter Medien, ein füllennd Zentrifuge 5 min. bei 400 xg und Dekantieren.
  3. Resuspendieren RBC-lysierten Zellen in 10 ml komplettem Medium und Zählung (beispielsweise mit Trypanblau unter Verwendung eines Hämozytometers). Multiply Ergebnis um 49-dies ist die Gesamtzahl der Zellen in dem nicht-lysierte Probe, die aufgehoben wurde, bleibt. Verwerfen RBC-lysierten Zellen.

4. Spenderzellmarkierung und / oder CD4-T-Zellreinigung

  1. Falls erwünscht, reinigen CD4 T-Zellen in dieser Phase, allerdings ist dies nicht notwendig. Zusätzlich, falls gewünscht, Etiketten Zellen mit CFSE, wie in 19, oder andere Zellverfolgung Farbstoffe, ein Beispiel davon ist in Figur 4 der repräsentative Ergebnisse Schnitt gezeigt.
    HINWEIS: Für die CD4 T-Zell-Reinigung wird negative magnetische Auswahl empfohlen, da es hohe Reinheit zu erreichen und lässt Zellen unberührt mit hoher Überlebensfähigkeit, wie in 20 beschrieben. Wichtig ist, dass endotoxinfreie Puffer verwendet werden; daher anstelle von BSA, stellen Trennpuffer with 2% FBS und die empfohlene Konzentration an EDTA.

5. Die Injektion von Spender BM12 Cells

  1. Nach dem Zählen von Spenderlymphozyten in Schritt 3 (und gereinigt oder, wie in Schritt 4 beschriftet, wie gewünscht), Zentrifuge Zellen 5 min bei 400 x g. Dekantieren und resuspendieren Zellen in PBS bei 120 Millionen Lymphozyten pro ml (oder 30 Millionen gereinigten CD4-T-Zellen pro ml). Übertragungszellen, um eine sterile 5 ml-Rundrohr oder einem anderen sterilen Röhrchen, die leicht eine 1 ml-Spritze mit einer 27,5 g x 13 mm-Nadel versehen aufnimmt.
  2. Vor der Injektion bei 4 ° C für Durchfluss Färbung beiseite stellen eine kleine Auswahl der Spenderzellen aus Schritt 5.1, den Prozentsatz der CD4-T-Zellen in Spenderproben zu bestimmen. Fleck diese Proben wie in Schritt 8 mit der minimalen Antikörper-Panel (Tabelle 2) beschrieben.
    HINWEIS: Wenn Zellen von verschiedenen Mäusestämmen als separate Spender verwendet wird, ist dies ein wichtiger Gesichtspunkt, und wenn CD4 T-Zell-Prozent erheblich variieren, purifizierung kann erforderlich sein.
  3. Mischen Zellen vorsichtig, aber gründlich. Dies kann durch Abpipettieren Zellen nach oben und unten unter Verwendung einer 1 ml-Spritze ohne Kanüle erfolgen. Nach dem Mischen zu ziehen Zellen in die 1-ml-Spritze. Bringen Sie Nadel nach dem Entfernen von Luftblasen. Halten Sie die Nadel ab, während Grundierung der Spritze hilft bei der Erhaltung der Lebensfähigkeit der Zellen.
  4. Injizieren Sie 250 ul pro Maus intraperitoneal (die gleich 30 Millionen Lymphozyten oder 7,5 Mio. gereinigten CD4-T-Zellen pro Maus ist), wie in 21 beschrieben.
    HINWEIS: Bei den Versuchen hier dargestellt und in unseren früheren Arbeiten 11 wird jede Maus mit 30 Millionen insgesamt Lymphozyten von BM12 Spendern injiziert, anstatt die 100 Millionen Gesamt Splenozyten traditionell verwendet. In unveröffentlichte Daten aus unserem Labor wurde kein Unterschied in Serum-anti-dsDNA an Tag 14 folgende Injektionen von 30 oder 100 Millionen Lymphozyten pro Maus beobachtet. Während dies die Anzahl der Mäuse für Experimente benötigt wird, die Entwicklung der Nephritis wit deutlich reduzierth diese Anzahl von Zellen wurde nicht untersucht.

6. Bestimmen Pfropfeffizienz

Anmerkung 1: In diesem Abschnitt wird beschrieben, wie der Grad der Spenderzelle Transplantation in den Empfänger am Tag 3, um etwaige Mäusen, die suboptimal Injektionen erhalten haben (zB ist das Transplantat in einer Maus <10%, dass in gesehen zu identifizieren bestimmen alle anderen Mäuse aus der gleichen Gruppe). Diese Daten können auch helfen, festzustellen, ob Zellen, die aus einem genetisch veränderten Mausstamm werden zu späteren Zeitpunkten abgelehnt (Details siehe repräsentative Ergebnisse Schnitt, Abbildung 6).

Hinweis 2: Dieser Abschnitt ist nur möglich, wenn Spender und Empfänger sind von Mäusen auf verschiedenen kongenen Hintergründe, zum Beispiel bei der Verwendung von CD45.1 BM12 Spendern und CD45.2 C57BL / 6-Empfänger, oder wenn Spender-Zellen werden mit einer Zelle Tracking-Farbstoff markiert. Wichtig ist, dass in 3 Tage nach der Injektion, CD4-T-Zellen haben minimalen Ausdehnung unterzogen (see repräsentative Ergebnisse Schnitt, Abbildung 4), so dass in der Pfropfgrad beobachteten Unterschiede sind aufgrund der Variabilität Injektionen nicht Expansion.

  1. Anesthetize Mäusen, die mit 4% Isofluran oder andere IACUC genehmigten Methode. Testen hinteren Fuß Reflexe, um die Maus zu gewährleisten ordnungsgemäß, bevor Sie den Blutabnahme betäubt.
  2. Ernte 100-200 & mgr; l Blut mit Hilfe eines IACUC zugelassenen Verfahren, wie beispielsweise retroorbitale Punktion wie in 22. Sammeln von Blut in einzelne 0,5 ml-Mikrozentrifugenröhrchen, das ein Antikoagulans, beispielsweise die Plasmasammelrohre in der Materialtabelle verwiesen, die lyophilisiert Dikalium EDTA enthalten. Nach der Blutentnahme, sanften Druck auf die Maus Auge mit einem sterilen Tuch oder Gaze, um die Blutung stoppt wieder in seiner eigenen Käfig zu gewährleisten, legen Sie dann die Maus, wo es bis zum Schlussgewebeernte (Schritt 7) bleiben.
    HINWEIS: Lassen Sie keine Mäuse unbeaufsichtigt, bis Mäusen haben ausreichend Bewusstsein wiedererlangtaufrechtzuerhalten ventralen recumbency und keine Mäuse in die Gesellschaft von anderen zurück, bis vollständig erholt.
  3. Bringt Blutvolumen bis 500 & mgr; l mit 21 ° C PBS und Transfer zum konischen Bodenmikrozentrifugenröhrchen, dann langsam zugrunde 200 ul von 21 ° C hochdichte Zellseparation Lösung mit einem 200 ul-Pipette, wobei darauf zu minimieren Mischen zwischen den beiden Phasen ( siehe Materialien Tabelle für empfohlene Lösungen). Centrifuge Zellen bei 700 × g für 20 min bei 20-25 ° C mit Zentrifugenbremse zu niedrig eingestellt.
  4. Entfernen Sie die obere Schicht, die Lymphozyten, die mit einer 1 ml Pipette und in ein neues Mikrozentrifugenröhrchen, die 800 & mgr; l kaltem komplette Medien. Vorsichtig vortexen, um Zellen zu mischen. Zentrifuge Zellen bei 700 g für 5 min bei 4 ° C Überstand dekantieren.
  5. Die Zellen in 200 ul vollständigem Medium, Transfer auf eine 96-Well U-Bodenplatte, und Fleck für die Durchflusszytometrie, wie in Schritt 8 unter Verwendung einer minimalen Antikörper-Panel (Tabelle 2) zu bestimmen, t beschriebener die relative Häufigkeit des CD4-T-Zelltransplantat als Prozentsatz der PBMCs.

7. Schluss Tissue Ernte

HINWEIS: Die im Ergebnisteil beschriebenen Experimente wurden 14 Tage nach der Injektion von Spenderzellen geerntet (oder in einigen Fällen weniger Zeit), wie sie auf der anfänglichen Entwicklung Tfh Zellen und Plasmazellen zu konzentrieren; Da dieses Modell ist eine chronische GVHD Modell der SLE-Krankheit kann zu einem viel späteren Zeitpunkten überwacht werden. Der optimale Zeitrahmen hängt von der Fragestellung in jedem einzelnen Experiment aufgeworfen abhängen.

  1. Zu einem vorbestimmten Zeitpunkt nach der Injektion von BM12 Spenderzellen (Schritt 5.4), opfern Mäusen mit Hilfe eines IACUC genehmigten Methode der Euthanasie. Erstickung mit CO 2, gefolgt von Ausbluten empfohlen. Genickbruch kann als sekundäre Methode der Euthanasie zu funktionieren, aber das kann die Blutabnahme Ertrag zu reduzieren.
  2. Befeuchten Sie den Bauch der Maus leicht mit einer Sprühflasche mit 70%Ethanol. Machen Sie eine kleine, oberflächliche Inzision mit chirurgische Schere ca. 1 cm über den Genitalien. Zurückziehen die Haut des Abdomens in Richtung des Brustbeins, wobei darauf geachtet, die Bauchbinde intakt zu halten.
    HINWEIS: Erkrankte Mäusen in der Regel mit 0,5-3 ml Aszites am Tag 14, die, obwohl sie noch nicht gut charakterisiert, kann gemessen und als zusätzlicher Parameter Krankheit analysiert werden anwesend.
  3. Setzen Sie eine 5-ml-Spritze mit einer 18 G-Nadel. Führen Sie die Nadel in den unteren rechten Quadranten des Bauches mit der oben in Richtung Kopf des Tieres und bei 15 ° Winkel zur Ebene der Faszie gerichtete Nadel. Positionieren Sie die Nadelspitze in der Nähe der Blinddarm, um zu verhindern, dass die Nadel immer mit Darm verstopft, während Absaugen Aszites.
  4. Vorsichtig drehen Sie die Maus auf die Seite, dann langsam ziehen Aszites in die Spritze. Sobald Aszites verwertet worden sind, entfernen Sie die Spritze und nehmen Sie das absaugen Volumen, auf der Grundlage der Volumenmarkierungen auf der Seite des syringe.
  5. Entladungs ​​Aszites in eine 5-ml-Rundrohr und store auf Eis für die spätere Verarbeitung.
  6. Ernte Blut über Zug von der unteren Vena cava (IVC) im Wesentlichen wie in 22. Verwenden langweilig Pinzette vorsichtig bewegen Darm auf die linke Seite der Maus, die Aufdeckung der IVC. Legen Sie eine 27,5 G-Nadel in eine 1 ml-Spritze in die IVC ausgestattet und langsam ziehen 400-500 ul Blut.
  7. Um Hämolyse zu vermeiden, langsam injizieren Blut in ein 0,5-ml-Mikro Serum- oder Plasmasammelröhrchen. Für spätere Serum Analyse der ANA ELISA, halten den Blut auf Eis.
  8. Sezieren und zu erhalten zusätzliche relevanten Geweben (Milz und, falls gewünscht, Lymphknoten und Nieren, vor allem, wenn das Sammeln zu späteren Zeitpunkten und Glomerulonephritis werden erzielt). Entfernen der Milz durch sanftes Auflegen der Darm wieder in Richtung der rechten Seite des Tieres, und Ziehen an der Bauchspeicheldrüse, die primäre Bindegewebe der Milz ist.
  9. Entfernen Sie alle verbleibenden Pankreas, dann wiegenMilz auf einem Hochpräzisionswaage sofort nach der Sektion, als Brutto Splenomegalie ist eine häufig berichtete Parameter in Maus-Modellen von SLE. Zeigen Lymphgewebe in einzelne 1,5-ml-Röhrchen mit 1 ml komplettem Medium auf Eis gefüllt. Fix Nieren in 10% neutral gepuffertem Formalin oder Schnapp einfrieren Nieren zur späteren Histologie, wie in 23.
  10. Zentrifuge Blut innerhalb von 2 h der Sammlung für 3 min. bei 10.000 × g (4 ° C). Entfernen Serum und bei -80 ° C für eine spätere Analyse der ANA ELISA. Siehe früheren Berichten für detaillierte ANA ELISA Protokollen 24,25. Speicher Serum in mehrere 10-20 ul Aliquots Gefrier / Tau-Zyklen zu minimieren, und ermöglichen es, eine größere Anzahl von zukünftigen Assays.
  11. Zentrifuge Aszites 400 xg für 5 min. Entfernen Sie den Überstand mit einer 1 ml Pipette und aliquoten in mehrere 0,5-ml-Röhrchen. Einfrieren Überstand bei -80 ° C für die spätere Analyse der Anti-Atom-Antikörper (ANA) oder andere lösliche Entzündungsmediatoren.
  12. Resuspendieren Zell fract Ion in etwa 1 ml komplettem Medium übertragen und 200 ul wurden auf eine 96-Well U-Bodenplatte für die Strömungs Färbung (wie in Schritt 8).
  13. Mash jeder Milz durch 70 & mgr; m-Zelle Siebe in separate Röhren und spülen mit kompletter Medien. Resuspendieren Splenozyten mit 1 ml kaltem RBC Lysepuffer für 1 min. und vorsichtig durch Schwenken. Bringt Volumen auf 10 ml mit kaltem komplette Medien- und Zentrifuge für 5 Minuten bei 400 xg und Dekantieren.
  14. Resuspendieren Zellpellet in 5 ml Komplettmedium und zählen mit einer Zählkammer. Einstellen der Lautstärke, so dass 200 ul Vollmedium falls 1-3 Millionen Zellen. Beginnen Färbung für die Durchflusszytometrie (Schritt 8) mit einem erweiterten Bereich (Tabelle 2) an die Geber CD4 T-Zellen und dem Empfänger B-Zell-Differenzierung und Expansion zu quantifizieren.
    HINWEIS: Je nachdem, was Laser sind Photomultiplier (PMT) und Filtersatz-Kombinationen zur Verfügung, Abtrennen der T- und B-Zellanalyse Platte in mehrere Platten erforderlich sein.
ve_title "> 8. Durchfluss Färbung

  1. Transfer 1-3000000 Splenozyten in 200 ul Vollmedium in einzelne 5-ml-Rundrohren oder in getrennte Vertiefungen einer 96-Well-U-Bodenplatte.
    HINWEIS: Mit einem 96-Well-Platte ist eine effiziente Möglichkeit, mehrere Proben zu färben, aber darauf achten, dass Proben in jedem anderen auch, um Kreuzkontamination zu vermeiden plattieren. Eine Platte mit 96 Vertiefungen entsprechend halten 24 Proben.
  2. Zentrifugenplatte bei 500 × g für 3 min., Dann Flick Stand aus Platte in entsprechende (Biohazard) Container.
  3. Resuspendieren des Zellpellets mit 100 ul Fließpuffer (1% FBS in PBS), die eine fixierbare Lebensfähigkeit Farbstoff bei der vom Hersteller empfohlenen Konzentration und gereinigtes anti-CD16 / anti-CD32-Antikörper-Cocktail bei 1 ug / ml. Inkubieren für 10 Minuten bei 20-25 ° C, dann fügen Sie 100 ul kalten Vollmedien, um die Lebensfähigkeit Farbstoff zu stillen.
    HINWEIS: Splenozyten von erkrankten Mäusen enthalten in der Regel relativ hohe Zahl von toten oder sterbenden Zellen;Daher wird die Einbeziehung einer Lebensfähigkeit Farbstoff empfohlen, um unspezifische Antikörpermarkierung von sterbenden Zellen, wodurch eine saubere, zuverlässigere Daten zu vermeiden. Ähnlich wird der anti-CD16 / anti-CD32 Cocktail enthalten, um nicht-spezifische fluoreszenzmarkierte Antikörper-Bindung von Fc-Rezeptoren zu blockieren.
  4. Zentrifugenplatte bei 500 × g für 3 min., Dann Flick Stand aus Platte in Behälter für biologischen. Die Zellen in 200 ul Fließpuffer. Zentrifugenplatte bei 500 × g für 3 min., Dann Flick Stand aus Platte in Behälter für biologischen.
  5. Die Zellen in 50 ul Puffer, der Strömungs Antikörper-Cocktail (Tabelle 2). Inkubieren für 20 Minuten bei 4 ° C, dann fügen Sie 150 ul Fließpuffer. Wiederholen Waschschritt 8.4.
  6. Die Zellen mit 100 ul 2% Paraformaldehyd in PBS. Inkubation für 30 min bei 4 ° C, dann werden 100 ul Fließpuffer. Zentrifugenplatte bei 500 × g für 3 min., Dann Flick Stand aus Platte in Behälter für biologischen.
  7. Resuspend in 200 ul Fließpuffer, Transfer zum Strömungsrohr Einsätze oder Standard-Durchflussrohre, fügen Sie eine zusätzliche 100-200 ul Fließpuffer, und bei 4 ° C im Dunkeln bis auf den Erwerb Durchflusszytometer.
  8. Erhalten, auf einem Durchflusszytometer mit den entsprechenden Laser und PMTs für die gewählten Antikörperplatten innerhalb einiger Tage der Färbung ausgestattet. Nehmen Vorwärtsstreuung Breite und / oder Höhe zusätzlich zur Streubereich, Seitenstreubereich und Bereich der verwendeten Fluoreszenzparameter zu übermitteln. Für zuverlässige Ergebnisse, erwerben ≥1,000 Spenderzellen in jedem WT Probe oder eine gleichwertige Anzahl der gesamten Lymphozyten in gentechnisch veränderten oder anderweitig manipuliert werden Mäuse, die eine minimale Ausdehnung von Spenderzellen, wo Sammlung von so vielen Ereignissen möglicherweise nicht machbar zu zeigen.
    HINWEIS: Die Durchflusszytometrie-Analysen sind in Detail in der repräsentative Ergebnisse Abschnitt (Figuren 3-6) beschrieben.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Erkrankten Mäuse entwickeln Splenomegalie in weniger als 14 Tagen aufweisen Milzen 2-3 mal die Größe des gesunden Mäusen in Bezug auf Masse und Zellularität (Abbildung 2).

Splenozyten werden nacheinander auf Lichtstreuung (FSC-A von SSC-A) gated, Eliminierung von Dubletten (FSC-W oder -H von FSC-A), lebensfähigen Zellen (niedrige Färbung der Lebensfähigkeit Farbstoff) und CD4 + TCR & bgr; + (Abbildung 3A). Spenderzellen unterscheiden sich von Empfängerzellen basierend auf CD45.1 und CD45.2 (3B, links unten). Spenderzellen vorwiegend nehmen eine T-Helfer follikulären (Tfh) Zell-Phänotyp, wie gekennzeichnet durch die Hochregulation von PD-1, CXCR5, Bcl-6 und ICOS (3B, C). Ein Teil des Empfängers CD4 T-Zellpopulation unterscheidet ebenfalls in Tfh (3B, unten rechts). Nach einem anfänglichen Absterben und / oder Migration von Zellen übertragen, ist die Erweiterung des dem Spender abgeleiteten Tfh logarithmisch, rEACHING 10-20 Millionen Zellen in der Milz von Mäusen 14 Tage nach der Injektion (Figur 3D).

CFSE-Kennzeichnung der übertragenen Lymphozyten zeigten, dass die Spender CD4-Zellen differenzieren sich in Tfh früh nach Aktivierung; im wesentlichen alle getrennten Zellen an den Tagen 3, 7 beobachtet und 14 hochreguliert CXCR5 und PD-1 (Figur 4). Die Proliferationspeakprofile legen auch nahe, dass ein relativ geringer Prozentsatz der Spender CD4-Zellen unter Alloaktivierung und Division. Am Tag 14, sind die meisten der detektierbaren Donorzellen jener, über die maximale Anzahl von Unterteilungen meßbar CFSE aufgeteilt haben.

Der Ausbau der Spender abgeleiteten Tfh wird durch eine entsprechende Ansammlung endogener GC-B-Zellen und Plasmazellen (5A) begleitet. Plasmazellakkumulation in der Milz im Vergleich zu der Tfh verzögert, aufweist keinen Anstieg mehr als naive Tiere an den Tagen 3 oder 7 (5B). Accordingly, sind anti-nukleäre Antikörper nicht ohne weiteres vor dem Tag 9 (Daten nicht gezeigt) nachweisbar, aber zuverlässig am 14. Tag 11 quantifiziert werden.

Durch den Einsatz von kongenen Marker haben wir Abstoßung von Spenderzellen in mehrere Stämme beobachtet. Dies ist zwar ein allgemeines Problem, wenn die Mäuse nicht ausreichend an der C57BL / 6-Hintergrund zurückgekreuzt, beobachteten wir auch Ablehnung beim BM12 Zellen wurden in B6.PL- Thy1 a / ​​CYJ (CD90.1) Mäusen, die im allgemeinen als vollständig angesehen werden transferiert rückgekreuzt. Daher Mäuse routinemßig an Tag ~ 3 durch Fließ Färbung Blutproben untersucht, um die Wirksamkeit des anfänglichen CD4 T-Zelltransplantat zu bewerten; wir wissen aus CFSE Verbreitung Experimente, die Zellen zu diesem frühen Zeitpunkt sehr wenig erweitert gepfropft. Diese Ergebnisse werden dann im Vergleich zu den Ergebnissen aus dem 14. Tag der Ernte erhalten. In einem Beispiel, bei Ablehnung, wurden 30 Millionen CD45.1 + BM12 Lymphozyten in Cardif übertragen - / - Mäuse, die C57BL / 6-Mäusen 12 Generationen rückgekreuzt worden war. An Tag 5 zeigten alle Mäuse äquivalente Pfropfen (2-3% der zirkulierenden CD4 + T-Zellen), aber am Tag 14 wurden BM12 Donorzellen vollständig aus dem gentechnisch veränderten Empfänger (6) eliminiert.

Figur 2
Abbildung 2. Milz Wachstumskinetik nach der Injektion von BM12 Lymphozyten. Die Milz wurde auf einem Hochpräzisionswaage direkt nach der Exzision (links) gewogen. Live-Zellzahlen wurden durch Zählung mit einem Hämozytometer unter Verwendung von Trypanblau, um tote Zellen auszuschließen (rechts) bestimmt. Die Ergebnisse sind als Mittelwert ± SEM, dargestellt, wobei n = 9, 4, 3, bzw. 6. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

jpg "/>
Abbildung 3. Analyse der T-Helferzell-follikulären Expansion im BM12 Modell des SLE. CD45.1 + BM12 Lymphozyten wurden in C57BL / 6-Empfänger übertragen und Milzen wurden 14 Tage später analysiert. (A) Repräsentative Gating-Strategie, die "Lymphozyten" (erste Platte), "Einzelzellen" (zweite Platte), "lebende Zellen" (drittes Feld) und "CD4-T-Zellen" (vierter Teil). (B) Spenderzellen unterscheiden sich von Empfänger CD4 T-Zellen durch CD45.1 und CD45.2 Färbung und zur Expression von PD-1 und CXCR5 analysiert. (C) Die Donorzellen annehmen Tfh Phänotyp, wie durch die Hochregulierung von mehreren Proteinen, die häufig gemeinsam Tfh einhergeht. (D) Typische Ergebnisse, die die Erweiterung der Spender abgeleiteten Tfh (definiert als CD4 + CD45.1 + PD-1 + CXCR5 + lebende Zellen) an den Tagen 3, 7 und 14 nach der Übertragung. Die Ergebnisse sind dargestellt eins Mittelwert ± SEM, n = 5, 4, 3, bzw. 6. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 4
Abbildung 4 PD-1 und CXCR5 auf sich teilende Zellen hochreguliert. BM12 Zellen wurden mit CFSE vor der Injektion in C57BL / 6-Empfänger bezeichnet. Repräsentatives Flussgrundstücke sind für die Geber CD4-Zellen bei 3, 7 gezeigt, und 14 Tage nach der Injektion. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 5
Abbildung 5. Erweiterung der Milz-Plasmazellen und GC-B-Zellen. (A) Repräsentative Flussdiagramme aus naiven Maus Milz, oder solche ausMäusen 14 Tage nach CD45.1 + BM12 Übertragung. Plasmazellen sind als CD138 + CD19 niedrigen lebenden Zellen (obere Felder) definiert. GC-B-Zellen sind eine Untergruppe von CD19 + B-Zellen, die GL-7 und Fas (untere Tafeln) auszudrücken. (B) Quantitave Daten, die die Ansammlung von Milz-Plasmazellen über die Zeit. Die Ergebnisse sind als Mittelwert ± SEM, dargestellt, wobei n = 5, 4, 3, bzw. 6. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 6
Abbildung 6. BM12 Transplantate werden von einigen genetisch veränderte Empfängermäuse abgelehnt. CD45.1 + BM12 Lymphozyten wurden entweder in genetisch veränderten Mäusen (Deckplatten) oder C57BL / 6 (Bodenplatten) Empfängermäuse transferiert. Die Mäuse wurden nach 5 Tagen nach der Injektion Blut entnommen und für Pfropfeffizienz bewertet. Splenozytens aus den gleichen Mäusen wurden 14 Tage später untersucht. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Primer-Name Sequenz (5 '- 3') Glühtemperatur
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segment Anzahl von Zyklen Temperatur Dauer
1 1 95 ° C 2 min.
2 40 95 ° C 15 Sek.
* 65 bis 0,5 ° C / Schritt 15 Sek.
72 ° C 45 Sek.
3 1 72 ° C 10 min.

Tabelle 1:. Grundierungen und Thermocycling-Bedingungen für BM12 Genotypisierung Optimale Thermocycling-Bedingungen werden von den genauen Reagenzien und Instrumente abhängen. Diese Bedingungen wurden für eine Thermocycler ändern kann Glühtemperatur bei jedem Schritt optimiert, wenn das Protokoll kann auch die Verwendung einer statischen Glühtemperatur zu arbeiten.

Tabelle 2
Tabelle 2:. Antikörper-Panels für Milz Tfh, GC B und Plasmazellenidentifikation mittels Durchflusszytometrie Präsentiert werden Panels haben wir erfolgreich eingesetztzur Beurteilung Pfropfwirkungsgrad am Tag 3 (links) und die Analyse von T und B-Zellen am Tag 14 nach der Zellinjektion BM12 (mittel). Diese wurden für eine LSRII mit 5-Laser (355, 405, 488, 561 und 640 nm) optimiert. Empfohlene Filtersätze für jedes Fluorochrom werden aufgelistet (rechts), obwohl diese möglicherweise nicht die beste Option für jede Maschine. Je nachdem, was Laser, PMT und Filtersatz Kombinationen stehen zur Verfügung, Abtrennen der T- und B-Zellanalyse Platte in mehrere Platten erforderlich sein.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das BM12 induzierbaren Modell ist eine relativ einfache und effiziente Möglichkeit, die zellulären und molekularen Prozesse der SLE-Studie. Chronische Aktivierung adoptiv transferierte CD4 T-Zellen gegen Selbstantigene gerichtet führt zur Akkumulation von Tfh, GC-B-Zellen und Plasmazellen, die durch Flusszytometrie gemessen werden kann, wie hier beschrieben. Zukünftige Studien unter Verwendung dieses Modells können schnell und einfach abfragen, die Rolle von Kandidatengenen und neuartiger Therapien in den Autoimmunkeimzentrum Prozesse, die bei Patienten mit SLE auftretenden ähneln, und letztlich bestimmen die pathologische Anhäufung von Autoantikörpern. Weiterhin kann die hier beschriebene durchflusszytometrische Analyse verwendet werden, um zusätzliche Mausmodelle, die die Entwicklung von Immunglobulinen einschließlich beinhalten zu untersuchen, aber nicht beschränkt auf Autoimmunität, Infektion und Allergie beschränkt.

Wie alle Tiermodellen menschlicher Erkrankungen, hat dieses Modell auch seine Grenzen. Angesichts der Geschwindigkeit, mit der Krankheit develops und ihre Grße sind nicht alle in der Entwicklung von SLE beteiligten Gene sind wahrscheinlich für die Pathogenität in diesem Modell notwendig. Darüber hinaus muss darauf geachtet werden, um auszuschließen, Transplantatabstoßung, wenn Daten darauf minimalen Ausdehnung der Tfh in gentechnisch veränderten Empfänger. Kongenen Marker verwendet werden, um die Anwesenheit von Spenderzellen bei der Ernte zu bestätigen zumal Empfängerzellen können auch in Tfh (3B), die sonst zu maskieren könnte das Fehlen von Spenderzellen zu differenzieren. Verwendung kongenen Marker beobachteten wir vollständige Beseitigung der Spenderzellen, die offenbar hegte Abstoßungsantigene für Tag 14 (Abbildung 6). Wir haben erfolgreich als Spender verwendet CD45.1 + BM12 und BM12 CD45.2 + Mäuse und CD45.1 + BoyJ (B6.SJL- Ptprc ein Pepc b / BoyJ) und CD45.2 + C57BL / 6 Mäusen als Empfänger (Abbildungen 3, 6, 7, und unveröffentlichte Daten). Allerdings Wildtyp kongenenCD90.1 + Zellen aus dem B6.PL- Thy1 a / ​​CYJ Mausstamm nicht gut zu pfropfen, noch CD90.2 + BM12 Zellen Transplantat gut in einem CD90.1 + Empfänger (unveröffentlichte Daten), ein Phänomen, das offenbar nicht einzigartig für dieses Modell 26.

Entweder C57BL / 6 oder BM12 Mäuse können als Spender oder Empfänger, wie ursprünglich von Morris et al dienen. 9 jedoch in unserem Labor finden wir die Übertragung von BM12 Zellen in B6-Mäusen produziert mehr konsequente Ausbau der T-Zell- und B-Zell- Populationen an Tag 14. Ferner Spender und Empfänger-Mäuse aus verschiedenen Gruppen sollten nach Geschlecht und Alter angepasst werden. Obwohl Versuche in der ersten Beschreibung der BM12-Modell berichtet, fanden keinen signifikanten Unterschied in jedem Krankheitsparameter zwischen männlichen → männlichen und weiblichen → weibliche Transfers 9 werden männliche → weibliche Transfers nicht geraten, als männlich-Antigen (HY) von übertragenen CD4 T-Zellen exprimiert kann Transplantat Reje induzierenction bei weiblichen Empfängern 27.

Bei der Auswahl von Antikörpern und Fluorochromen für kongenen Marker sollte angemerkt werden, dass Spenderzellen positiv werden für den Empfänger kongenen Marker in unterschiedlichem Ausmaß, so dass ein CD45.2 - Gatter würde die gesamte CD45.1 + Transplantat darstellen. Das Phänomen wird deutlich bei einem Vergleich der Expression durch CD45.1 CD45.2 + naiv CD45.1 + Donor und CD45.2 + Empfänger CD4-Zellen (Figur 7) erläutert. Bemerkenswerterweise scheinen Donorzellen auch Expressions eigene kongenen Marker hochregulieren, im Vergleich zu naiven Kontrollen (Abbildung 7). Ähnliche Ergebnisse werden auch mit CD45.2 + BM12 Transfer in CD45.1 + BoyJ Mäusen beobachtet (Daten nicht gezeigt). Vermutlich Erwerb der Empfänger CD45 resultiert aus Trogozytose 28 von aktivierten CD4-T-Zellen nach wiederholter Interaktionen mit Empfänger B-Zellen. In der Tat die BM12-Modusl kann ein nützliches Werkzeug bei der Untersuchung der Prozess der Trogozytose in vivo nachzuweisen.

Figur 7
Abbildung 7. Spenderzellen zu erwerben Empfänger CD45 kongenen Marker. CD45.1 + BM12 Lymphozyten wurden in CD45.2 + C57BL / 6-Empfänger übertragen. Spendern, Empfängern, und naiv (CD45.1 +) CD4-T-Zellen werden für CD45.1 und CD45.2 Ausdruck 14 Tage nach Überweisung bewertet. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Es hat sich gezeigt, dass die Übertragung des gereinigten BM12 CD4 T-Zellen in C57BL / 7 Mäusen ausreicht, um Krankheits 29 zu initiieren; entwickelt jedoch äquivalente Erkrankungen wenn ganze Lymphozyten übertragen werden, und die Reinigung ist nicht unbedingt erforderlich, um Krankheiten Abhängigkeit T ce studierenll-Eigen Genexpression. Eisenberg und Kollegen, klar gezeigt, dass die Antikörper-produzierende Zelle in der BM12-Modell ist fast ausschließlich des Empfängers Ursprung 30. Ferner ist das Erfordernis für die Empfänger CD4-T-Zellen 10 auf das "Pflege" von B-Zellen während der Entwicklung, die versetzt von der Zugabe von exogenem IL-4 31 sein kann, obwohl unsere Daten zeigen, dass die Empfänger-T-Zellen können teilnehmen etwas in der Keimzentrumsreaktion, wie einige von ihnen tun, entwickeln eine Tfh Phänotyp (3B, rechts unten).

Eine wichtige Entscheidung, die für jede BM12 Experiment gemacht werden muss, ist bei den Geweben für Analysen zu ernten. Natürlich hängt die Entscheidung, was genau Faktoren sind wichtig, um die aktuelle Studie, die variieren kann. Die hier beschriebenen Experimente nehmen bis zu 14 Tage, wie sie von der anfänglichen Entwicklung der Tfh Zellen und Plasmazellen zu konzentrieren; Da jedoch das Modell ist eine chronischeGVHD-Modell von SLE, können Krankheiten sehr viel länger überwacht werden. In der Tat, bestimmte klinische Merkmale von SLE, einschließlich Glomerulonephritis, entwickeln später. Proteinurie festgestellt wurde bereits 2 Wochen nach der Injektion, aber erreicht Spitzenwerte bei 4-8 Wochen nach der Injektion 10,31. Zusätzlich analysiert der durchflusszytometrischen hier beschrieben wurden für Experimente einer Dauer von 2 Wochen optimiert. Wir finden eine beträchtliche Anzahl von GC-B-Zellen und Plasmazellen zu diesem Zeitpunkt; obwohl, da zusätzliche Zeit kann ein hoher Prozentsatz der ANA-sekretierenden Plasmazellen im Knochenmark, 32 befinden. Außerdem dürfte auch die Plasmazellen durch dieses Flussfärbungskasten identifiziert Plasmablasten-, um zwischen diesen beiden Zelltypen zu unterscheiden, würde zusätzliche Antikörper erforderlich. TFH Expansions vermutlich erreicht einen Spitzenwert bei einem gewissen Punkt, nachdem der 14-Tage-Fenster, auf denen wir konzentriert. Jedoch unseres Wissens keine Studien BM12 Spenderzellzahl über 2 Wochen gemeldet, oder die Nutzungd kongenen Marker adoptiv transferierten Zellen zu verfolgen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).
Das BM12 Inducible Modell des systemischen Lupus erythematodes (SLE) in C57BL / 6-Mäuse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).More

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter