Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Chemistry

Flow-patrón Fabricación guiada de alta densidad de códigos de barras de anticuerpos microarrays

doi: 10.3791/53644 Published: January 6, 2016

Summary

Este protocolo describe la fabricación de una gran escala, multiplexado de ADN o anticuerpo matriz de dos dimensiones, con aplicaciones potenciales en los estudios de la señalización celular y la detección de biomarcadores.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Microarrays de anticuerpos han sido ampliamente utilizados en estudios proteómicos durante décadas para examinar la presencia de proteínas específicas, incluyendo biomarcadores proteicos 1-3. Aunque este campo se enfrenta actualmente a grandes retos de otras tecnologías de alto rendimiento, tales como la espectrometría de masas (MS), todavía hay mucho espacio para la utilidad de los microarrays de anticuerpos, principalmente debido a que estos dispositivos ofrecen la interpretación de datos simple y fácil interfaz con otros ensayos. En los últimos años, la integración de los microarrays en andamios microchip ha proporcionado el microarray anticuerpo una nueva oportunidad para prosperar 4-7. Por ejemplo, el microarray de código de barras integrado en un microchip de una sola célula se ha utilizado en estudios de comunicación celular 8,9. Esta tecnología tiene ventajas distintivas con respecto a otras tecnologías de microarrays disponibles. Cuenta con elementos de la matriz de 10-100 micras a, mucho menor que el 150 micras tamaño típico utilizado en elemen microarrays convencionalests. La construcción de elementos de la matriz más pequeños se consigue utilizando enfoques sistemáticos de flujo de modelado, y esto da lugar a microarrays compactos que pueden detectar las proteínas de una sola célula secretadas y proteínas intracelulares. Otra ventaja es el uso de una configuración simple,-instrumento libre. Esto es particularmente importante, ya que la mayoría de los laboratorios y las pequeñas empresas pueden no ser capaces de acceder a las instalaciones centrales de microarrays. Tal código de barras microarrays de anticuerpos de funciones mejorado rendimiento del ensayo y se pueden usar para realizar ensayos altamente multiplexados en células individuales mientras que el logro de alta sensibilidad y especificidad comparable con la de ensayo de inmunoabsorción ligado a enzimas sándwich convencional (ELISA 8). Esta tecnología ha encontrado numerosas aplicaciones en la detección de proteínas de glioblastoma 9-11, células T 12, y células tumorales circulantes 13. Alternativamente, microarrays de ADN de código de barras solo se han utilizado en el posicionamiento preciso de neuronas y astrocitos para mimicking la asamblea en vivo de tejido cerebral 14.

Este protocolo se centra sólo en las etapas experimentales y bloquea la acumulación de las dos dimensiones (2-D) de código de barras de microarrays de anticuerpos que tiene aplicaciones potenciales en la detección de biomarcadores en muestras de fluidos y en células individuales. La tecnología se basa en una direccionable de una sola hebra, unidimensional (1-D) de microarrays de ADN construidos utilizando oligonucleótidos ortogonales que se modelan espacialmente sobre sustratos de vidrio. El patrón 1-D se forma cuando se utilizan canales de flujo paralelos en el paso de flujo patrón, y tal patrón aparece como bandas discretas visualmente similares a 1-D Código Universal de Producto (UPC) los códigos de barras. La construcción de un 2-D (n x m) matriz de anticuerpos - una reminiscencia de un código de la matriz 2-D de respuesta rápida (QR) - necesita estrategias de modelado más complejas, pero permite la inmovilización de anticuerpos a una densidad mayor 8,15. La fabricaciónrequiere dos pasos de modelado de ADN, con el primer patrón perpendiculares a la segunda. Los puntos de intersección de estos dos patrones constituyen los elementos de m x n de la matriz. Al seleccionar estratégicamente las secuencias de ADN de cadena sencilla (ssDNA) utilizado en flow-patrón, cada elemento de una matriz dada es asignada una dirección específica. Es necesario Esta referencia espacial para distinguir entre las señales de fluorescencia en la diapositiva de microarrays. La matriz de ssDNA se convierte en una matriz de anticuerpos a través de la incorporación de los conjugados anticuerpo-ADN complementarios, formando una plataforma llamada ADN codificado biblioteca de anticuerpos (DEAL 16).

Este protocolo de vídeo se describen los pasos clave en la creación de matrices nxm anticuerpos que incluyen la preparación de polidimetilsiloxano (PDMS) moldes de código de barras, flujo-patrón ssDNA en dos orientaciones, la preparación de los conjugados anticuerpo-DEAL oligonucleótidos, y la conversión de la matriz de ADN 3 x 3 en un 3x 3 matriz de anticuerpos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Precaución: Varios productos químicos utilizados en este protocolo son irritantes y son peligrosos en caso de contacto con la piel. Consulte las hojas de datos de seguridad de materiales (MSDS) y utilizar equipo de protección personal adecuado antes de realizar este protocolo. La solución Piranha utilizado en el paso (1.1.1) es altamente corrosivo y debe ser preparado mediante la adición de peróxido lentamente con el ácido con agitación. Manejar esta solución con extrema precaución en una campana de humos. Utilice protección ocular adecuada y guantes resistentes al ácido. Trimetilclorosilano (TMCS) es un corrosivo químico inflamable utilizado en un paso opcional después de (1.1.6). Maneje este producto químico en una campana de humos.

Nota: Realizar la fabricación de diapositivas código de barras y procedimientos críticos flujo de modelado en una habitación limpia para minimizar la contaminación por partículas. Las partículas de polvo pueden bloquear los puertos y microcanales de moldes de PDMS e interferir con el flujo-patrón.

1. Construcción del Uno-dimensionl de ADN de código de barras de diapositivas

  1. Preparación del maestro SU-8 para los patrones de flujo de código de barras
    Nota: Los dibujos de los patrones de flujo perpendiculares (Figura 1A-B) se crean usando un (CAD) de software de diseño asistido por ordenador. Estos patrones son prestados en una fotomáscara cromo. Las áreas transparentes de la máscara que correspondan a las características del maestro SU-8.
    1. Limpiar una oblea de silicio (100 mm de diámetro) a fondo en una mezcla de 3 H 2 SO 4: 1 H 2 O 2 (solución Piranha) 30% se calienta a 96 ° C. Lavar la oblea con agua destilada y alcohol isopropílico, seguido de secado con una pistola de soplado de nitrógeno.
    2. Vierta aproximadamente 4 ml de SU-8 2025 fotoprotector en la oblea. Utilice un giro revestidor programable para extender uniformemente la fotoprotección en la oblea durante 10 segundos a 500 rpm, y luego 30 segundos a 3.000 rpm. Esto crea una capa de resina fotosensible con un espesor de ~ 25 m. Poco a poco permiten vueltas a frenar antes de detenerse - esta es maintain una capa uniforme sobre la superficie de la oblea.
    3. Hornear la oblea recubierta sobre una placa caliente durante 1 min a 65 ° C, a continuación durante 5 min a 95 ° C. Este paso permite que el recubrimiento se solidifique. Enfriar a temperatura ambiente durante 5 min.
    4. Coloque la máscara de cromo (Figura 1C) en la capa de resina fotosensible. Exponer las características de la máscara a la luz UV cercano (350-400 nm, energía exposición 150-160 mJ / cm2) durante 20 segundos.
      Nota: El diseño de la máscara de cromo contiene 20 canales, cada uno de los cuales son 20 m de ancho, con 50 micras de paso. Los canales están enrollando desde un extremo del patrón hasta el extremo opuesto. En conjunto, los 20 canales cubren un área rectangular con una longitud de ~ 40 mm y una anchura de ~ 20 mm. Cada canal está flanqueada por dos rasgos circulares que corresponden a una entrada y una salida. Las entradas y salidas son intercambiables.
    5. Hornear la oblea expuesta sobre una placa caliente durante 5 min a 95 ° C. Enfriar a ta gradualmente.
    6. Sumerja la oblea en el SU-8 desarrollador con agitacióndurante 5 min. Lavar la oblea con una pequeña porción de fresco SU-8 promotora, seguido por alcohol isopropílico. Seque la oblea con una pistola de soplado de nitrógeno. Hard-hornear la oblea en una placa de cocción de 200 ° C durante 30 minutos, y deje que la oblea se enfríe gradualmente a RT.
      Nota: Desarrollo puede llevarse a cabo durante más tiempo si se observa una película en blanco después del lavado en este paso.
      Opcional: silanizar el maestro SU-8 mediante su exposición a vapor de trimetilclorosilano en un plato de Petri cerrada durante 10 min.
  2. Preparación del molde de código de barras PDMS
    1. Combine 40,0 g de base de elastómero de silicona con 4,0 g de agente de curado. Se agita la mezcla vigorosamente durante 10 prepolímero min. Degas durante 20 min al vacío.
      Nota: Como regla general, utilice un 10: 1 (base: agente de curado) relación de masa.
    2. Vierta el prepolímero en una placa de Petri que contiene una oblea de silicio con el SU-8 maestro del patrón de código de barras. La altura de la mezcla de PDMS debe ser de aproximadamente 7,5 mm o superior. Desgasificar la mezcla en el Petri plato por segunda vez para eliminar las burbujas restantes, luego hornear la mezcla durante 1 hora a 75 ° C para permitir PDMS de curar.
      Nota: Es importante mantener suficiente espesor de la losa de PDMS en ~ 7,5 mm o superior para evitar la adición de demasiada tensión al vínculo PDMS de vidrio tras la inserción de pines / tubería a través de agujeros en el molde de PDMS en el paso (1.3.3.1)
    3. El uso de un bisturí, corte con cuidado alrededor de la zona de la losa de PDMS que contiene las características del molde de código de barras y la cáscara de la losa de la oblea.
    4. Recortar los bordes de la losa para alcanzar la forma deseada del molde de código de barras PDMS. Perforar agujeros 20 (1,0 mm de diámetro) a través del molde utilizando un punzón de biopsia con el émbolo. Asegúrese de que los agujeros estén alineados con las características circulares del patrón de código de barras. Estos agujeros sirven como las entradas y salidas.
  3. Patrón unidimensional de poli-L-lisina (PLL)
    1. Elimine el polvo en la superficie de un portaobjetos de vidrio recubiertos con poli-L-lisina utilizando una pistola de soplado de nitrógeno. Attach el molde de PDMS para el portaobjetos de vidrio limpio. Asegúrese de que los bordes del molde y la corredera están alineados.
    2. Hornear durante 1,5 horas a 75 ° C para fortalecer el vínculo entre el molde de PDMS y la corredera con recubrimiento de PLL. Mientras tanto, preparar 20 piezas de tubo de polietileno flexible (de 3 a 4 pulgadas piezas, con un diámetro interior de 0,5 mm y un diámetro exterior de 1,5 mm).
      Nota: El número de piezas de tubo se corresponde con el número de entradas en el molde de código de barras PDMS. El tubo sirve para acoplar los canales en el código de barras del molde de PDMS a un tanque de gas de nitrógeno equipado con un regulador de presión.
    3. Para un extremo de cada trozo de tubo, adjuntar un acero inoxidable pasador hueco (1 mm de diámetro). Aspirar esterilizada por filtración de poli-L-lisina solución a través de la clavija, hasta por lo menos 1 cm de la tubería se llena con la solución.
      1. Apriete los pernos (conectados a la tubería solución lleno) a las entradas del código de barras del molde de PDMS (Figura 1E). Conecte el otro extremo de los tubos deun tanque de nitrógeno a presión regulada set-up. Dejar que la solución fluya a través del molde usando un rango de presión de 0,5 a 1 psi durante al menos 6 h.
        Nota: Consulte el paso (1.3.3) para todos los procedimientos de flujo de modelado.
  4. Patrón unidimensional de ssDNA 14
    Nota: El tampón fosfato salino (PBS) utilizado en las etapas posteriores se prepara a partir NaCl 137 mM, 10 mM Na 2 HPO 4, y 2 mM KH 2 PO 4. El pH del tampón es 7,4.
    1. Preparar mM bis suberato (BS3) Solución 2 (sulfosuccinimidil) en PBS. Preparar 300 mM de soluciones A, B, C y ssDNA (5'-amina modificado, a 80 nucleótidos) en PBS o agua ultrapura.
      Nota: Utilice la solución BS3 dentro de aproximadamente 30 minutos después de la preparación, porque el éster -hidroxisuccinimida N somete fácilmente a la hidrólisis.
    2. Combinar 2,5 l de 300 mM A, B, o C ssDNA con 2,5 l de bis 2 mm (sulfosuccinimidyl) suberato en PBS para cada canal. A, B, y C de ADN se designan a los canales 1, 2 y 3, respectivamente. Esta orden también se aplica al resto de grupos de 3 canales (Figura 2A).
    3. Realice el paso (1.3.3). Esta vez, aspirar las soluciones BS3 / ADN 5-mu l a través de pasadores de acero inoxidable y en el tubo de polietileno, a continuación, acoplar el molde de PDMS para la fuente de nitrógeno. Dejar que la solución BS3 / DNA fluya a través del molde de código de barras para aproximadamente 40 min o hasta que se llenan en los canales.
    4. Detener el flujo una vez que todos los canales están llenos, entonces se incuba la solución BS3 / ADN en el código de barras a RT durante 2 hr. No permita que la solución se seque. Hornee el molde de PDMS con tobogán de códigos de barras conectado durante 1 hora a 75 ° C.
      Nota: Para facilitar la alineación en los pasos de flujo de modelado posteriores, los bordes del patrón de canal en la diapositiva de código de barras pueden ser descritos. Esto se hace por el rascado cuidadosamente la superficie de vidrio usando un scrib diamantee para generar marcadores de alineación en la parte inferior del portaobjetos de vidrio. La alineación en las últimas etapas del protocolo se puede comprobar con un microscopio.
    5. Retire el molde de PDMS de la diapositiva de código de barras. Lavar el portaobjetos suavemente con 0,01% de SDS de una vez tres veces con agua ultrapura.
      1. Seque el portaobjetos de código de barras usando un spinner portaobjetos de microscopio. Almacenar la corredera de código de barras en un tubo de centrífuga de 50 ml limpio para su posterior uso.

2. Validación del patrón unidimensional en la diapositiva de código de barras

Nota: Este protocolo de validación también puede ser adaptado para su uso en la evaluación de la calidad de los pasos de modelado de flujo posteriores.

  1. El bloqueo de la corredera
    1. Preparar 1% de albúmina de suero bovino (BSA) en PBS. Filtrar esta solución a través de un filtro de jeringa de 0,45 micras antes de su uso. Utilizando una punta de carga de gel, aplique 50 l de solución de BSA al 1% a un borde de la corredera de código de barras.
    2. Incubar la solut BSA 1%ion durante 1 hora a temperatura ambiente.
  2. La incubación con Cyanine 3 (Cy3) y conjugado con ADN complementario
    1. Preparar un cóctel de A ', B', y los oligonucleótidos C 'conjugado con Cy3 en un extremo. Las secuencias de A ', B' y C 'son complementarias a las de A, B, y C, respectivamente. La concentración de trabajo de la ADN-Cy3 es de 0,05 M en 0,1% de BSA.
    2. Retire la solución de BSA de la diapositiva con la pipeta, a continuación, aplicar 30 l de la solución de cóctel de ADN en el mismo borde de la diapositiva. Incubar el cóctel Cy3-DNA en el portaobjetos a temperatura ambiente durante 1 hr. Realice este paso de incubación en la oscuridad para proteger el resto de Cy3 photobleaching.
  3. Análisis de la intensidad de fluorescencia
    1. Pipetear a cabo el cóctel Cy3-DNA y lavar el portaobjetos en 1% de BSA, PBS, y finalmente en PBS diluido (1 parte PBS con 50 partes de agua ultrapura). Seque el portaobjetos utilizando una ruleta.
    2. Observar la fluorescencia (Figura 2B), utilizando un microscopio de fluorescencia o un escáner de microarrays. Cuando se utiliza un escáner de microarrays, ajuste la longitud de onda de emisión láser de 532 nm, el tamaño de píxel a 5 micras, tubo fotomultiplicador (PMT) de ganancia a 450 y la potencia en un 15%.

3. Fabricación de la matriz de 2 dimensiones ADN (3x3) 14

  1. Preparación del molde de código de barras PDMS
    1. Realizar el procedimiento de (1.1) para construir otra SU-8 maestro, pero esta vez utilice una máscara de cromo con un patrón de flujo perpendicular a la de la primera diseño. Realice el procedimiento de (1.2) para la construcción de un nuevo molde de PDMS con el patrón perpendicular.
  2. Patrones de flujo bidimensional de ssDNA
    1. Para una matriz de 3 x 3, se preparan 150 M soluciones madre de A'-i, B'-ii, C'-iii, A'-iv, B'-v, C'-vi, A'-vii, B'ADN -VIII y C'-ix en el 3% de BSA / PBS. Estos oligonucleótidos sirven como "secuencias de puente" (Figura 2A). Se combinan las soluciones de oligonucleótidos (Soluciones 1 a 3) tal que la concentración de trabajo es de 50 m para cada oligonucleótido. Utilice la guía proporcionada en la Tabla 1.
    2. Flujo 3% de BSA / PBS solución de bloqueo en todos los 20 canales durante 1 hora a 0,5 a 1 psi.
    3. Soluciones de flujo 1, 2 y 3 en los canales 1, 2, y 3, respectivamente. Siga este orden para los conjuntos subsiguientes de 3 canales. Flujo lo general se realiza en torno a 40 min. Incubar las soluciones de ADN a temperatura ambiente durante 2 h para permitir que el ADN para hibridar.
    4. Flujo 3% de BSA / PBS solución de bloqueo en todos los 20 canales durante 1 hora a 0,5 a 1 psi para eliminar ADN no hibridado. Despegue la losa de PDMS, y lavar el microarray de ADN resultante de diapositivas por inmersión de la lámina de vidrio en 3% BSA / PBS una vez y PBS dos veces, seguido por PBS diluido (1 parte de PBS y 50 partes de agua ultrapura). reri o la diapositiva utilizando una ruleta portaobjetos de microscopio.
    5. Realizar una segunda etapa de validación (Figura 2C) similar a la de la sección 2. Utilice oligonucleótidos i 'a IX' que se conjugan con Cy3. Almacenar el 3 x 3 diapositiva matriz en un tubo de centrífuga de 50 ml para su uso posterior.
      Nota: El microarrays de ADN se puede almacenar a temperatura ambiente en un desecador durante meses.

4. La conversión de la matriz de ADN 3 x 3 en una matriz de anticuerpos

  1. Preparación de anticuerpos de oligonucleótidos (DEAL) conjugados
    1. Preparar soluciones de 200 mM succinimidil-4-formilbenzoato (S-4FB) y 40 mM succinimidil-6-hidrazinonicotinamida (S-HYNIC) en anhidro N, N-dimetilformamida (DMF).
    2. Preparar hasta 7 soluciones separadas de anticuerpos de captura (1 mg / ml) en PBS.
      Nota: Si las soluciones de anticuerpos de valores contienen azida de sodio bacteriostático, realizar intercambio de tampón con PBS mediante desalación giro columns con 7 kDa de peso molecular de corte (MWCO).
    3. Preparar separadas 400 M soluciones de i ', ii', iii ', iv', v ', vi', y el ADN vii. Asigne a cada anticuerpo de captura de una secuencia de oligonucleótidos. Combine 40 l de ADN M 400 con 12,25 l de DMF en tubos de microcentrífuga y girar hasta mezclar bien.
      1. Para cada solución de ADN / DMF, agregar 2.3 l de 200 mM S-4FB en DMF. Por cada 100 g de anticuerpo de captura, añadir 2,25 l de 40 mM de S-HYNIC en DMF.
    4. Incubar las soluciones / S-HYNIC y el ADN / S-4FB de anticuerpos durante 4 horas a RT.
    5. En la preparación para la reacción de acoplamiento ADN-anticuerpo, preparar nuevas columnas de desalación giro (uno para cada solución de ADN y uno para cada anticuerpo) lavándolas con tampón citrato a pH 6.
    6. Después de 4 h de incubación, realizar intercambio de tampón para cada anticuerpo / solución de ADN / S-4FB S-HYNIC y. Combine el S-4FB conjugado vii 'con los conjugados anticuerpo-S-HYNIC. Incubar las mezclas durante 2 horas a temperatura ambiente.
    7. Se incuba la reacción de O / N a 4 ° C.
  2. Purificación de anticuerpos de oligonucleótidos (DEAL) conjugados
    Nota: Para purificar los conjugados anticuerpo-oligonucleótido, lleve a cabo la cromatografía líquida rápida de proteínas (FPLC) en un sistema estándar de FPLC equipado con una columna Superose 6 10/300 GL.
    1. Ajuste la longitud de onda de detector UV del sistema FPLC a 280 nm. Utilice flujo isocrático de PBS (pH 7,4) a 0,3 ml / min para separar los conjugados anticuerpo-oligonucleótido de la 4FB-ADN-S exceso.
    2. Reunir las fracciones que contienen el conjugado y concentrar las fracciones a un volumen de 150 l utilizando filtros de espín con una kDa MWCO 10.
  3. Patrón bidimensional de anticuerpos
    1. Preparar otro molde de PDMS con microcámaras o nosotros los micro pozosing procedimientos de fabricación en el paso (1.2). El molde de PDMS puede contener microlitros a los pocillos de nanolitros para inmunoensayos.
      Nota: Para la detección de biomarcadores en general en muestras de fluidos, un molde de PDMS con múltiples pozos se acopla con la diapositiva matriz. Las características del molde de PDMS dependen del sistema en estudio. Por ejemplo, la detección de proteínas a partir de experimentos de células individuales se puede realizar con un molde de PDMS que contiene microcámaras con volúmenes de 0,15-nl.
    2. (Opcional) Se somete el molde de PDMS al plasma limpieza (18 W) durante 1,5 minutos para rendir su hidrófila superficie modelada. Antes de la limpieza de plasma, utilizar cinta adhesiva para bloquear todas las otras superficies que se unen directamente al 3 x 3 array de diapositivas.
      Nota: Paso (4.3.2) es opcional, pero se lleva a cabo por lo general cuando el molde de PDMS es para uso en experimentos de células individuales.
    3. Mate el molde de PDMS con el 3 x 3 array de diapositivas, a continuación, bloquear la corredera con 1% de BSA en PBS. Incubar durante 1 hora a RT. Meanwhile, preparar un cóctel (200 l de volumen final) de conjugados anticuerpo-oligonucleótido. La concentración de trabajo de cada conjugado es de 10 mg / ml en 1% BSA / PBS.
    4. Añadir el cóctel de anticuerpo-oligonucleótido, a continuación, se incuba durante 1 hora a 37 ° C para permitir que el resto de los conjugados de oligonucleótido para hibridarse con puntos específicos en los 3 x 3 arrays, convirtiendo de este modo la matriz de ADN a una matriz de anticuerpos.
    5. Repita el paso (3.2.4) para limpiar y secar la diapositiva. La sensibilidad más alta se puede conseguir si la matriz anticuerpo se utiliza inmediatamente. Almacenamiento prolongado puede provocar la pérdida de sensibilidad.
  4. La detección de proteínas
    1. Reconstituir proteínas recombinantes o preparar una muestra de células filtrada.
    2. Mate de la micromatriz con un chip de diseño personalizado, y bloquear la superficie con 3% de BSA en PBS durante 1 hr. A continuación, retire la solución de BSA, y aplicar las muestras y se incuba durante 2 horas.
    3. Lavar las muestras usando 3% de BSA en PBS tres veces, unad luego añadir anticuerpos de detección a una concentración proporcionada por la ficha técnica del producto. Incubar durante 2 horas.
    4. Lavar los anticuerpos de detección por 3% de BSA en PBS tres veces, y luego añadir Cyanine 5 (Cy5) -estreptavidina a 1 g / ml, seguido de incubación durante 1 hr.
    5. Repita el paso (3.2.4) para limpiar y secar la corredera para la exploración.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los diseños de los moldes de PDMS (Figura 1A-1B) se extrajeron utilizando un programa CAD (AutoCAD). Dos diseños que se muestran los canales de función para el patrón de flujo, uno horizontal y otro vertical. Las partes izquierda y derecha de cada diseño son simétricos; cualquiera de ellos podría ser entradas o salidas. Cada uno de 20 canales es sinuoso de un extremo todo el camino hasta el otro extremo. Cada diseño se imprime en una fotomáscara cromo (Figura 1C). La fabricado SU-8 maestro en una oblea se muestra en la Figura 1D. Para facilitar el flujo-patrones de PLL o ADN, el molde de PDMS se acopló a un flujo de gas nitrógeno configuración (Figura 1E).

Hay tres pasos de flujo de modelado utilizados en este protocolo. El primer paso PLL inmoviliza en el sustrato de vidrio, mientras que los pasos sucesivos tanto introducir soluciones de oligonucleótidos. En la Tabla 1, la oligonuclese dan composiciones otide de Soluciones 1-3. La concentración de trabajo de cada oligonucleótido es de 50 mM y el volumen total de cada solución es de 39 l. Estas soluciones se preparan mediante la combinación de 13 l de cada solución de oligonucleótido de stock (150 mM).

Las unidades de microarrays de ADN estampados son repetitivas y adyacente a través de todo el portaobjetos de vidrio. Por 3 x 3 microarrays, la densidad máxima es de unos 400.000 puntos en una diapositiva de cristal. Comparación lado a lado con microarrays de ADN comercial revela que nuestra tecnología es aproximadamente 5 veces más sensible al enlazar con Cy3 etiquetados ADN complementarios. Los ADN estampados son relativamente uniforme con la variación ~ 5% a través de múltiples repeticiones. Esas características prometen la capacidad alta cuantificación de nuestra tecnología al medir el contenido de proteínas de muestras biológicas. Además, la ortogonalidad de ADN en combinación con el diseño del canal de flujo ofrecen la flexibility de patrones en una variedad de geometrías (Figura 2D).

Después de convertir la matriz de ADN en una matriz de anticuerpos a través de la hibridación con conjugados anticuerpo-ADN (Figura 3B), el panel de anticuerpos resultante se utiliza en la detección multiplexada, principalmente a través de la plataforma de sándwich ELISA, como se muestra en la Figura 3C. En ELISA de tipo sándwich, detección de anticuerpos (secundarios) biotinilados se unen a las proteínas capturadas, y su posterior marcado con estreptavidina-fluoróforo conjugado permite para la detección basada en fluorescencia (Figura 3C-E). Detección de proteínas shows <10% de variación desde un extremo hasta el otro extremo del portaobjetos de vidrio (Figura 3D). Con la matriz de 3 x 3, que son capaces de detectar hasta 7 proteínas, mientras que la asignación de un elemento matriz como referencia (Cy3 etiquetados) y otro elemento como control negativo. Por ejemplo, en un experimento de una sola célula a cabo duranteestudios tumorales, las proteínas de la interleucina-6 (IL-6), la matriz metalopeptidasa 9 (MMP9), factor de crecimiento de hepatocitos (HGF), factor de crecimiento vascular endotelial (VEGF), la interleucina-8 factor de (IL-8), y migración de macrófagos inhibitoria (MIF) de una sola célula se puede detectar simultáneamente (Figura 3E).

También calibramos el sistema utilizando proteínas recombinantes en diversas concentraciones. En la Figura 3F, curvas de calibración para las proteínas recombinantes de interferón-γ (IFN-gamma), α factor de necrosis tumoral (TNF-a), la interleucina-13 (IL-13), factor de necrosis tumoral β (beta TNF), granzima B, interleucina se muestran -4 (IL-4), y la interleucina-8 (IL-8). La sensibilidad de la detección es bastante similar a la de ELISA sándwich convencional sobre placas de pocillos, incluso con una mayor carga de anticuerpos AND y posiblemente sobre el sustrato.

El antibod código de barrasy microarray puede ser utilizado para detectar biomarcadores en muestras de fluidos, así como en células individuales. Desde el análisis de una sola célula no es el foco de este protocolo, simplemente ejemplificó la aplicación de los microarrays de anticuerpos 3 x 3 en la detección de citoquinas. A través de las interacciones anticuerpo-marcador de superficie, grupo de diferenciación 8 (CD8) fueron capturados células positivas en uno de los elementos de microarrays (Figura 3G; un chip de PDMS en la parte superior), y el resto de los elementos se utilizaron para detectar citocinas secretadas ( Figura 3H). Con este método la captura de células, se pueden formar "arrays de células". Esta técnica de captura de matriz también permite el control sobre el número de células sometidas a cada experimento ELISA. Las células se aislaron físicamente en las microcámaras de modo que las proteínas detectadas se referían a determinadas células individuales. En la Figura 3H, se muestra que cada una microcámara está equipado con 16 elementos de microarrays para garantizar la encapsulación deun completo 3 x 3 conjunto de microarrays.

Figura 1
Figura 1. Diseño y fabricación de moldes de PDMS de código de barras para el ADN patrón basado en el flujo. Panel (A) muestra los dibujos de AutoCAD para los patrones de códigos de barras unidimensionales horizontales y verticales. Panel (B) muestra los patrones de códigos de barras horizontales y verticales superpuestas de (A). Cajas verdes encierran áreas modeladas con discretos 3 x 3 matrices. Máscara (C) Chrome para fabricar el maestro SU-8. (D) SU-8 maestro fabricado sobre una oblea de silicio. (E) Puesta en marcha de los patrones de flujo. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2 Figura 2. Construcción y validación de una matriz de ADN 3 x 3. Esta cifra se ha modificado de "cuantificar Funciones de interacción célula-célula con aplicaciones a las células de glioblastoma multiforme cáncer", de Wang, J. et al., 2012, Nano Lett 12 . Derecho de autor 2012 por la Sociedad Americana de Química. Adaptado con permiso. (A) Esquema de los pasos de flujo de ADN de modelado. Perfil (B) La intensidad de fluorescencia de 20 canales en un área seleccionada (trazada por una línea vertical) del código de barras 1D. Oligonucleótidos conjugado con Cy3 se hibridaron con los arrays de ADN para la validación. (C) perfil de intensidad de fluorescencia de las matrices validadas con el ADN Cy3-conjugado después de completar el segundo paso del patrón de ADN. (D) patrones fluorescentes alternativos desde diferentes flestrategias de modelado ujo. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. Aplicaciones del 3 x 3 de microarrays. (A) Esquema de la síntesis de conjugados anticuerpo-oligonucleótido DEAL. (B) Esquema para la conversión de la matriz del ADN en una matriz de anticuerpos a través de la hibridación con conjugados anticuerpo oligonucleótido. (C) Esquema para utilizar el 3 x 3 de microarrays en una plataforma de ELISA sándwich. Esta cifra se ha modificado de "cuantificar Funciones de interacción célula-célula con aplicaciones a las células de glioblastoma multiforme cáncer", de Wang, J. et al., 2012, Nano Lett 12. Derechos de autor 2012 por la Sociedad Americana de Química. Adaptado con permiso. Panel (D) muestra una lectura de fluorescencia generada bajo un canal de Cy5. Esto corresponde a un sándwich ELISA que detecta experimento 6 proteínas. Panel (E) es un zoom en el perfil de una matriz de lectura 3 x 3 en canales Cy3 y Cy5. Grupo (F) muestra las curvas de calibración de sandwich ELISA para proteínas recombinantes. Grupo (G) muestra un "conjunto de células" formado por la captura de células a través de la unión con los anticuerpos de la matriz. Panel (H) muestra el resultado de la detección superpuesta con microcámaras en un microchip. Por favor haga clic aquí para ver una versión más grande de esta figura.

1
Solución Composición de oligonucleótidos
A'-i, B'-ii, C'-iii
2 A'-iv, B'-v, C'-vi
3 A'-vii, viii-B', C'-ix

Tabla 1. Composición de Soluciones 1-3 para ADN Flow Patrón.

Secuencias de anclaje
LA ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
segundo GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
do GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Salvando las secuencias
Ai TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-ii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-iv TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Oligonucleótidos conjugado con Cy3 para la validación
LA' TACGGACTTAGCTCCAGGAT
SEGUNDO' TAGGCATGATTCAATGAGGC
DO' TAGCGATAGTAGACGAGTGC
yo' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
vi ' TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: keep-together.within-page =" 1 "> Cuadro 2. Las secuencias de ADN utilizados en flow-patrón.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Diseño del patrón de flujo es el primer paso crítico en la fabricación de los microarrays 2-D. Para generar dos patrones de ADN superpuestas sobre un sustrato de vidrio, las características de canal del primer diseño deben ser perpendiculares a las de la segunda (Figura 1A-B). Los diseños también consideran que las aplicaciones posteriores de los microarrays. En el caso del análisis de una sola célula, el microarray se utiliza para detectar proteínas a partir de células individuales encerradas en microcámaras, por lo tanto, las dimensiones del canal se hacen compatibles con las microcámaras que se alinean con las matrices 2-D. Cada diseño se representa en una fotomáscara y técnicas de fotolitografía estándar se utilizan para fabricar las características de canal en SU-8 sobre una oblea de silicio (Figura 1C-D). Esto sirve como maestro para PDMS moldeo. Una vez que el molde ha sido fabricado, que está unido a un portaobjetos recubierto con PLL y luego acoplado con un flujo de gas nitrógeno configuración (Figura 1E). El nos reglajesuso es sencillo y tiene la ventaja de ser incorporado fácilmente en cualquier laboratorio con una fuente de gas nitrógeno a presión regulada. Utilizamos un conjunto de múltiples válvulas de 3 vías de bajo costo conectados a un tanque de gas de nitrógeno. El flujo de aire para el patrón debe mantenerse a bajas presiones (0,5 a 1 psi) para evitar la delaminación de la lámina de vidrio del molde. Las fugas dentro del molde de PDMS pueden comprometer la integridad de los patrones.

Los pasos de modelado de flujo de ADN en este protocolo utilizan ssDNA con secuencias ortogonales cuidadosamente seleccionados (Figura 2a). Antes de flujo patrón, las secuencias únicas en estos oligonucleótidos debe ser probado por la ausencia de cross-talk. Una simple prueba de diafonía se realiza mediante la modificación del procedimiento de validación introducimos en nuestro protocolo (Paso 2). En lugar de utilizar un cóctel de Cy3-etiquetados ADN complementario, sólo un tipo de secuencia complementaria se utiliza a la vez para un área seleccionada de la diapositiva en la que múltiplesSecuencias de ADN se inmovilizan. En ausencia de ADN diafonía, sólo una raya (para la matriz de ADN 1-D) o un punto (para la matriz de ADN 2-D) deben ser fluorescentes bajo un filtro de Cy3. Ejemplos de secuencias ortogonales bien validados se pueden encontrar en la Tabla de Materiales y Equipos. El primer paso del patrón de ADN presenta tres tipos de oligonucleótidos "ancla". Estas secuencias de 80 nt se componen de dos regiones poli-A 20-mer que alternan con dos secuencias de 20-mer únicas. La modificación 5'-amina en estas secuencias de anclaje es necesario para-amina-a-amina de reticulación 17 con PLL mediada por BS3. La segunda etapa de modelado de ADN no requiere un reticulante. Este paso introduce oligonucleótidos "puente" que hibridan en parte, con las secuencias de anclaje. Cada secuencia de puente 60-nt consiste en una región de 20-mer complementarias a una secuencia de anclaje, un 20-mer de poli-A espaciador, y una secuencia de 20-mer único. Validación de los arrays de ADN (Figure 2B-C) se lleva a cabo después de cada paso de flujo de ADN patrón para evaluar la calidad de los pasos de modelado y para asegurar que no contaminación cruzada 14. Esto se realiza mediante la introducción de sondas de oligonucleótidos-Cy3 conjugado que se hibridan con los patrones de ADN. Con los parámetros especificados en el Paso (2.3.2) para el análisis de la intensidad de fluorescencia, los patrones de ADN deben exhibir intensidades de fluorescencia de al menos 40.000 au para maximizar la sensibilidad de los inmunoensayos aguas abajo realiza utilizando el microarray. El uso estratégico de los diferentes conjuntos de ADN Cy3 durante la validación da lugar a patrones alternativos (Figura 2D), lo que demuestra la flexibilidad de los patrones de ADN pasos 8. La imposibilidad de lograr patrones uniformes podrían resultar de fugas u obstrucciones mecánicas (tales como partículas de polvo) se encontró en los pasos de flujo de modelado.

La preparación de conjugados anticuerpo-DEAL oligonucleótidos es un paso crítico en la XXes el protocolo. La elección de los anticuerpos está dictada por el sistema biológico en estudio. Los oligonucleótidos usados ​​en la conjugación deben tener secuencias complementarias a las anclado en la matriz de ADN. Las soluciones madre de los conectores S-4FB y S-HYNIC deben ser recién preparados y mantenerse alejados de la humedad para evitar la hidrólisis. Los tiempos de incubación utilizadas en nuestro protocolo de conjugación son lo suficientemente largos para introducir las funcionalidades deseadas en los anticuerpos y ADN. La reacción de acoplamiento final solamente se inactiva mediante la eliminación de los que no han reaccionado oligonucleótidos S-4FB conjugados a través de FPLC. Por lo tanto, la purificación FPLC se debe realizar inmediatamente después de completar la conjugación. Al realizar FPLC con el sistema descrito en el protocolo, las tasas de flujo inferiores (0,2-0,25 ml / min) también pueden utilizarse para mejorar la resolución. Los conjugados se eluyeron como un pico ancho (volumen de elución de alrededor de 9 a 15 ml) que aparece antes de un pico de ADN más estrecho y más alto (17-20 de volumen de elución ml). No se recomienda almacenar solucionesde conjugados con S-4FB-ADN en exceso ya que esto puede conducir a la pérdida de los sitios de unión al antígeno del anticuerpo sobre la conjugación con exceso funcionalizado ADN. La sensibilidad, especificidad y reproducibilidad de los ELISA sándwich utilizando conjugados DEAL se ha demostrado en estudios previos. 8,9,11,12,16 Para evaluar la calidad de los conjugados anticuerpo-ADN, los conjugados pueden incubarse en arrays de ADN para generar el matriz de anticuerpos, que se utiliza posteriormente en experimentos de ELISA sándwich para generar curvas de calibración para la detección de proteínas (Figura 3F). Para generar estas curvas de calibración, se pueden usar proteínas recombinantes proporcionados en un kit de ELISA convencional sandwich. El uso de conjugados de alta calidad debería dar lugar a rangos lineales y límites más bajos de detección comparables con los del kit. A modo de ejemplo, los límites inferiores para INFγ y TNFa para ELISA sándwich en nuestra matriz de anticuerpos (Figura 3F) son ~ 50 a 100 pg / ml, y son consistent con el rango de detección lineal de ~ 15-1,000 pg / ml se indica en la ficha técnica del producto para el kit ELISA convencional sándwich. Poor lectura de señal obtenida en experimentos de ELISA sándwich aguas abajo podría atribuirse a la baja calidad de matriz de ADN, la interferencia del exceso de ADN en las soluciones de conjugado, o alternativamente, la conjugación incompleta de ssDNAs con anticuerpos.

Las principales preocupaciones para la realización de ELISA sándwich en la matriz de anticuerpo incluyen la diafonía entre reactivos y si la señal refleja los eventos biológicos reales. Los ADN ortogonales que utilizamos en este protocolo se han validado a fondo para tener menos de 0,1% diafonía. Por lo tanto cualquier diafonía observado en la etapa de inmunoensayo es principalmente de los anticuerpos y reactivos de ELISA. Las pruebas para la diafonía entre los anticuerpos de la matriz se debe realizar antes de realizar ensayos con las muestras reales. Una vez que se construye un panel de anticuerpos, unas pocas sándwich experimentos de control de ELISA deben ser perfOrmed con las siguientes condiciones: 1. Sin antígenos, 2. Sin anticuerpos de detección, y 3. Los anticuerpos de detección y únicamente reactivos de etiquetado. Si se observa la diafonía en la etapa de inmunoensayo, se deben sustituir los pares de anticuerpos y / o reactivos de ELISA. Cabe señalar que el uso de anticuerpos disponibles comercialmente de kits de ELISA convencionales no garantiza aplicabilidad a la técnica de sándwich de ELISA basado en la matriz.

Los méritos de esta tecnología incluyen la fabricación de bajo costo, tamaño miniatura, y la flexibilidad de diseño. Nuestro protocolo de fabricación no necesita un ayudante de microarrays que pueden no estar disponibles para muchos usuarios de arrays de anticuerpos. El patrón de flujo de la configuración se puede montar fácilmente en laboratorios simples. Para los laboratorios que no están equipados con instrumentos para la fotolitografía, los diseños CAD que ofrecemos en nuestro protocolo se le enviarán a las empresas que ofrecen servicios de microfabricación. Reducción de la micromatriz convencional enla matriz compacta fabricada con nuestro protocolo permite la compatibilidad con microchips utilizados en experimentos de una sola célula. Nuestro protocolo cuenta con la producción de la matriz como una matriz ssDNA primero antes de la conversión a una matriz de anticuerpos. Patrón preliminar con ssDNAs tiene una serie de ventajas. En primer lugar, ssDNAs son químicamente más estable en comparación con los anticuerpos, por tanto, las diapositivas ssDNA-modelado pueden ser almacenados en un desecador durante al menos 6 meses sin degradación significativa 8,16. En segundo lugar, nuestro enfoque ofrece un usuario final la flexibilidad de elegir los ensayos necesarios, simplemente mezclando los conjugados selectivos juntos en una solución sin excepciones de los microarrays; Por el contrario, proteína / arrays de anticuerpos convencionales son pre-diseñado y fija sobre un sustrato, por lo que el cambio de ensayos requerirían el patrón / de impresión de proteínas / anticuerpos desde el principio. Estudios representativos ilustran el uso de la micromatriz anticuerpo de código de barras en el alto rendimiento Detection de múltiples proteínas de señalización de las células individuales. Variando los diseños de patrones de flujo y / o las soluciones de modelado de oligonucleótidos utilizados, una multitud de diseños de matriz puede ser explorado. Como ejemplo de esta aplicación, las proteínas funcionales a partir de células individuales pueden ser estudiados. El chip para el análisis de una sola célula abarca tantos como ~ 8.700 microcámaras, cada uno alineado con una completa 3 x 3 matriz de anticuerpos (Figura 3H). Tal configuración permite la detección de alto rendimiento. Las proteínas secretadas por las células cultivadas en microcámaras pueden ser detectados por esta matriz. El diseño de microarrays versátil también permite la detección multiplexada de las proteínas de suero, lisados ​​de células, y las células individuales después de combinar la micromatriz con otros componentes genéricos 8,15. Además de la detección de proteínas, la matriz de anticuerpos 3 x 3 también es útil en las células captura (Figura 3G).

La principal desventaja de este enfoque es su compl añadidaexity en comparación con la fabricación de microarrays convencionales. Estrategias para modelar y para el diseño de matriz deben ser conceptualizados cuidadosamente teniendo en cuenta las aplicaciones específicas de la matriz fabricada. Este enfoque también requiere una serie de pasos críticos, incluidos los procedimientos de validación y pruebas de cross-talk. La matriz de 3 x 3 construyó utilizando nuestro protocolo se limita a la detección de 7 proteínas a la vez. Sin embargo, este límite puede ser superado mediante la creación de matrices grandes. El protocolo ofrecido aquí no se limita a la fabricación de 3 x 3 microarrays. Hemos sido capaces de fabricar con éxito 5 x 5 microarrays y otras dimensiones de elementos de la matriz. En principio, otras matrices m n x se pueden fabricar utilizando técnicas similares, siempre y cuando los conjuntos de oligonucleótidos utilizados en la creación de la matriz de ADN con dibujos preliminares son ortogonales para evitar la diafonía entre elementos de la matriz. La creación de matrices ampliadas se logra patterni flujong n tipos de ssDNA anclajes para la primera etapa de modelado de ADN, seguido de n x m puente secuencias de ssDNA para la segunda etapa de modelado. Por ejemplo, para crear una matriz de 5 x 5, secuencias de anclaje de A a E puede ser utilizado, mientras que las secuencias de puente A'-i a E'-xxv se utilizan. Para automatizar el proceso de patrones de flujo, una plataforma robótica se ha desarrollado 18 aunque esto sólo ha utilizado un solo DNA etapa de modelado de flujo. En principio, la misma plataforma se puede extender a la segunda etapa de los patrones de flujo perpendicular, mientras que la conmutación entre dos pasos puede requerir manualmente despegando el primer molde de PDMS después de la primera etapa de modelado, seguido de lavado y secado de la corredera (este paso se tomar alrededor de 10 min), antes del apareamiento la diapositiva con otro molde de PDMS para facilitar la segunda etapa de modelado orientado perpendicularmente.

Hemos discutido los procedimientos detallados para la fabricación de una matriz nxm modeladocon anticuerpos de alta densidad, lo que representa una gran promesa para futuras aplicaciones en estudios proteómicos y la señalización celular. El protocolo que se presenta aquí también puede servir como una guía para la construcción de más elaborados arrays de ADN / anticuerpo para otros fines.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).
Flow-patrón Fabricación guiada de alta densidad de códigos de barras de anticuerpos microarrays
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).More

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter