Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Chemistry

Yüksek yoğunluklu Barkod Antikor Mikroarray Akışı-desen Rehberli Fabrikasyon

doi: 10.3791/53644 Published: January 6, 2016

Summary

Bu protokol hücre sinyal çalışmalar ve biyolojik belirteç tespiti potansiyel uygulamalar ile büyük ölçekli imalat, mültipleksli iki boyutlu DNA veya antikor dizisi, özetlemektedir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Antikor mikroarrayleri çok protein biyo-1-3 de dahil olmak üzere hedef proteinler, varlığını incelemek için yıllardır proteomik çalışmalarda kullanılmıştır. Bu alan şu anda böyle kütle spektrometresi (MS) gibi diğer yüksek verimli teknolojilerin büyük zorluklarla karşı karşıya olmasına rağmen, bu cihazlar diğer tahlillerde basit veri yorumlama ve kolay arayüzü göze başlıca nedeni, hala antikor mikrodizilerinin programı için oda bol. Son yıllarda, mikroçip iskelelerinin içine microarrays entegrasyonu antikor mikrodizisini 4-7 gelişmek için yeni bir fırsat sağladı. Örneğin, bir tek hücre mikroçip entegre barkod mikroarray hücre iletişim çalışmaları 8,9 kullanılmıştır. Bu teknoloji mevcut diğer mikroarray teknolojilere kıyasla belirgin avantajları vardır. Geleneksel mikroarray Elemen kullanılan tipik 150 mikron boyutunda çok daha küçük 10-100 um en dizi öğelerine sahipts. Daha küçük dizi elemanlarının yapımında sistematik bir akım-desen yaklaşımlar kullanılarak elde edilir ve bu da tek hücreli salgılanan proteinleri ve hücre içi proteinleri tespit kompakt mikrodiziler yol açmaktadır. Bir başka avantaj, basit bir alet içermeyen kurulum kullanılmasıdır. En laboratuarlar ve küçük şirketler mikrodizin çekirdek tesisleri erişmek mümkün olmayabilir, çünkü bu özellikle önemlidir. Bu barkod antikor mikrodizileri deney hacmi geliştirilmiş özelliği geleneksel sandviç enzim-bağlı immünosorbent deneyi ile karşılaştırılabilir yüksek hassasiyet ve özgüllük (ELISA 8) elde ederken tek hücreler üzerinde oldukça çoğaltılmış çok katlı testleri gerçekleştirmek için kullanılabilir. Bu teknoloji tümör hücrelerini 13 glioblastoma 9-11 proteinleri, T hücreleri 12 tespit ve dolaşımdaki sayısız uygulamaları bulmuştur. Alternatif olarak, barkod DNA mikrodizileri yalnız taklit eden için nöronların ve astrositlerin hassas konumlandırma kullanılmıştırBeyin dokusunda 14 in vivo montajını ing.

Bu protokol, sadece deneysel adımlar ve akışkan numunelerde biyomarkerların tespiti potansiyel uygulamalar vardır, iki boyutlu (2-D) barkod antikor mikroarray birikmesi bloklar ve tek hücre odaklanır. Teknoloji adresli, tek sarmallı tek boyutlu (1-D) DNA mikro-dizisi dayanan cam yüzeylerde mekansal desenli ortogonal oligonükleotidler kullanılarak oluşturulabilir. Paralel akış kanalları akış desen aşamasında kullanılan zaman 1-D desen oluşturulur ve böyle bir model 1-D, Evrensel Ürün Kodu (UPC) barkod görsel olarak benzer ayrı bantlar olarak görünür. 2-D (n x m) antikor dizisinin yapım - 2-B Quick Response (QR) matris kod anımsatan - daha karmaşık desenlendirme stratejilerini gerekiyor, ancak daha yüksek bir yoğunluğa 8,15 olarak antikorların immobilizasyonu sağlar. Uydurmaikinci dik ilk şekil iki DNA model verme adımları gerektirir. Bu iki desen kesişme noktaları dizisi n x m unsurlarıdır. Stratejik akış desen kullanılan tek şeritli DNA (ssDNA) dizileri seçerek belirli bir dizideki her eleman belirli bir adresi atanır. Bu mekansal referans mikrodizi slayt floresan sinyalleri ayırt gereklidir. SsDNA dizisi (İDEAL 16), DNA tarafından kodlanan bir antikor kütüphanesi olarak bir platform oluşturan tamamlayıcı DNA-antikor konjugatları dahil edilmesi yoluyla bir antikor dizisine dönüştürülür.

Bu video protokol iki yönlerde hazırlanması dahil nxm antikor dizileri polidimetilsiloksan (PDMS) barkod kalıpları, akış-desen oluşturma ssDNA antikor oligonükleotid İDEAL konjugatlarının hazırlanması ve 3 içine 3 x 3 DNA dizisi dönüştürülmesi önemli adımları açıklamaktadırx 3 antikor dizisi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dikkat: Bu protokolde kullanılan çeşitli kimyasallar tahriş edici ve ciltle temas halinde zararlıdır. Malzeme güvenlik bilgi formlarını (MSDS) başvurun ve bu protokolü uygulamadan önce uygun kişisel koruyucu ekipman giyin. Aşama (1.1.1) 'da kullanılan pirana çözeltisi yüksek ölçüde aşındırıcı olan ve ajitasyon ile aside yavaş yavaş peroksit eklenmesiyle hazırlanmalıdır. Davlumbaz aşırı dikkatli bu çözüm anlaştım. Uygun göz koruması ve aside dayanıklı eldiven kullanın. Trimetilklorosilan (TMCS) (1.1.6) daha sonra, isteğe bağlı bir aşamada kullanılan aşındırıcı, tutuşabilir bir kimyasaldır. Davlumbaz bu kimyasal Kolu.

Not: partiküler madde ile bulaşmayı en aza indirmek için bir temiz oda barkod slayt imalat ve kritik akış desen işlemleri gerçekleştirin. Toz partikülleri portları ve PDMS kalıp mikrokanallar engellemek ve akış-desenlendirme engel olabilir.

Tek dimensiona 1. İnşaatl DNA Barkod Slide

  1. Barkod akış modelleri için SU-8 master hazırlanması
    Not: dik akış modelleri için çizimler (Şekil 1A-B), bilgisayar destekli tasarım (CAD) yazılımı kullanılarak oluşturulur. Bu modeller krom photomask işlenir. Maskenin Saydam alanlar SU-8 master özelliklerine karşılık gelmektedir.
    1. 96 ° C'ye kadar ısıtıldı 1% 30 H2O 2 (pirana çözeltisi): iyice 3 H 2 SO 4 oluşan bir karışım içinde, bir silikon gofret (100 mm çapında) temizleyin. Iyonu giderilmiş su ve izopropil alkol ile gofret yıkayın, bir nitrojen üfleme tabancası ile kurutuldu.
    2. Gofret SU-8 2025 fotorezist yaklaşık 4 ml dökün. Muntazam 3000 rpm'de 30 saniye daha sonra, 500 rpm'de 10 saniye boyunca gofret photoresist'i yaymak için programlanabilir bir sıkma kaplayıcı kullanın. Bu ~ 25 um bir kalınlığı olan bir fotorezist tabakası meydana getirir. Yavaş yavaş durmadan önce yavaşlaması eğirme izin - Bu mai içinGofret yüzeyinde eşit kaplama ntain.
    3. Daha sonra 65 ° C 'de 1 dakika süre ile bir sıcak plaka üzerinde, kaplanmış gofret, fırında 95 ° C'de 5 dakika daha karıştırıldı. Bu adım kaplama katılaşmaya sağlar. 5 dakika boyunca oda sıcaklığına soğutun.
    4. Fotorezist ceket krom maskesi (Şekil 1C) yerleştirin. 20 sn için yakın-UV ışığı (350-400 nm, pozlama enerjisi 150-160 mJ / cm2) maske özellikleri Açığa.
      Not: krom maske tasarımı 50 mikron adımlı 20 mikron genişliğinde her biri 20 kanal içerir. Kanal zıt ucuna şeklinin bir ucundan sarma. Toplamda, 20 kanal 40 mm ~ bir uzunluğa ve yaklaşık 20 mm'lik bir genişliği olan bir dikdörtgen alanı kapsar. Her bir kanal, bir girişi ve bir çıkışı karşılık gelen iki dairesel özellikleri tarafından taarruz altında kalır. Giriş ve çıkışları değiştirilebilir.
    5. 95 ° C 'de 5 dakika süre ile bir sıcak plaka üzerinde ortaya gofret fırında. Yavaş yavaş oda sıcaklığına soğumaya bırakın.
    6. Ajitasyon ile SU-8 geliştirici gofret daldırın5 dakika karıştırıldı. Izopropil alkol ve ardından taze SU-8 geliştirici küçük bir kısmı ile gofret, yıkayın. Bir azot darbe tabancası kullanarak gofret kurutun. Sabit fırında 30 dakika süreyle 200 ° C bir sıcak plaka üzerindeki bir gofret, gofret oda sıcaklığına yavaş yavaş soğumaya bırakın.
      Not: beyaz film, bu adımda yıkamadan sonra gözlemlenmesi durumunda geliştirme daha uzun bir süre ile ifa edilebilir.
      İsteğe bağlı: 10 dakika boyunca kapalı bir Petri kabındaki buhar trimetilklorsilan maruz kaldığında SU-8 ana Silanize.
  2. PDMS barkod kalıbının hazırlanması
    1. 4.0 g kür maddesi ile 40.0 gr silikon elastomer tabanı birleştirin. 10 dakika boyunca şiddetli bir şekilde ön-polimer karışımı karıştırın. Vakum altında 20 dakika boyunca gazdan arındırın.
      Not: 1 (baz: sertleştirici madde) kütle oranı, genel bir kural olarak, 10 kullanır.
    2. Barkod deseni SU-8 master ile silikon gofret içeren bir Petri kabı içine prepolimerin dökün. PDMS karışımının yüksekliği yaklaşık 7.5 mm veya üzerinde olmalıdır. Petr karışım gaz çıkışınaikinci bir kez daha sonra PDMS tedavisi için izin vermek için 75 ° C'de 1 saat süre ile bir karışım fırında kalan kabarcıklarını çıkarmak için i çanak.
      Not: adım PDMS kalıp deliklerden pim / tüp sokulması üzerine PDMS-cam bağı çok fazla gerginlik eklemekten kaçının yukarıda ~ 7.5 mm PDMS levhanın yeterli kalınlığının korumak veya önemlidir (1.3.3.1)
    3. Bir neşter kullanılarak, dikkatli bir barkod kalıp özellikleri içerir ve gofret slab soyma PDMS levhanın alanı çevresinde kesti.
    4. PDMS barkod kalıbın istenilen şekil elde etmek için döşemenin kenarlarını kırpın. Dalgıç biyopsi yumruk kullanarak kalıp içinden 20 delik (1.0 mm çapında) Punch. Delikler barkod desen dairesel özellikleri ile uyumlu olduğundan emin olun. Bu delikler giriş ve çıkışları olarak hizmet vermektedir.
  3. Poli-L-lizin tek boyutlu desen (PLL)
    1. Bir azot darbe silah kullanarak bir poli-L-lizin kaplı cam slayt yüzeyinde türlü tozdan arındırın. Attach temiz bir cam slayt PDMS kalıp. Kalıp ve slayt kenarlar hizalanmış emin olun.
    2. PDMS kalıp ve PLL kaplı slayt arasındaki bağı güçlendirmek için 75 ° C'de 1.5 saat fırında. Bu arada, (0,5 mm'lik bir iç çapa ve 1,5 mm'lik bir dış çapa sahip olan 4-inçlik parçalar halinde 3-), esnek, polietilen boru 20 adet hazırlar.
      Not: boru parçalarının sayısı PDMS barkod kalıpta girişi sayısı karşılık gelir. Boru çift bir basınç regülatörü ile donatılmış bir azot gazı tankına PDMS barkod kalıp kanalları ile hizmet vermektedir.
    3. Borunun her parçasının bir amaçla, paslanmaz çelikten içi boş pim (1 mm çapında) ekleyin. Aspire steril filtrelenmiş borunun en az 1 cm çözeltisi ile dolana kadar, poli-L-lisin iğne yoluyla çözeltisi.
      1. PDMS barkod kalıbın (Şekil 1E) girişlerine (çözelti ile doldurulmuş boru bağlı) işaretçilerini sabitleyin. Borular diğer ucunu iliştirinbir basınç ayarlı azot tankı set-up. Çözelti, en az 6 saat boyunca 0.5-1 psi'lik bir basınç aralığı ile kalıp içinden akmasına izin verir.
        Not: Tüm akış desen prosedürleri için (1.3.3) adımına bakın.
  4. SsDNA 14 Tek boyutlu desen
    Not: daha sonraki kademelerde kullanım fosfat tamponlu tuzlu su (PBS) 137 mM NaCI, 10 mM Na-2 HPO 4, ve 2 mM KH 2 PO 4 tampon, pH 7.4 hazırlanır.
    1. PBS içinde 2 mM bis (sülfosuksinimidil) suberat (BS3) çözeltisi hazırlayın. PBS veya aşırı saf su içinde A, B, ve C ssDNA (5'-amin, 80 nükleotid değiştirilmiş) 300 uM solüsyonları hazırlayın.
      Not: N-hidroksisukinimid esteri kolayca hidroliz uğrar çünkü hazırlandıktan sonra yaklaşık 30 dakika içinde BS3 solüsyonu kullanın.
    2. 2 mM bis 2,5 ul (sulfosuccinim 300 uM, B veya C ssDNA 2.5 ul birleştirinHer bir kanal. A, B, ve C, DNA PBS içinde idyl) suberat sırasıyla kanal 1, 2 için belirtilen ve 3 vardır. Bu emir ayrıca 3 kanal (Şekil 2A) kalan setleri uygulanır.
    3. Gerçekleştirmek adım (1.3.3). Bu kez, paslanmaz çelik pimleri ile ve polietilen boru içine 5-ul BS3 / DNA çözümleri aspire, nitrojen kaynağına daha sonra çift PDMS kalıp. BS3 / DNA solüsyonu yaklaşık 40 dakika süreyle veya kanallar dolu saatlere kadar barkod kalıp akmasına izin verin.
    4. Bir kez tüm kanallar doldurulur akış durdurma, daha sonra 2 saat boyunca oda sıcaklığında barkod BS3 / DNA çözeltisi inkübe edin. Çözüm kurumasına izin vermeyin. 75 ° C'de 1 saat süre ile bağlanmış barkod slayt PDMS kalıp Bake.
      Not: sonraki akış desen adımlarla uyumu kolaylaştırmak için, barkod slaytta kanal desen kenarları ana hatlarıyla olabilir. Bu dikkatle elmas Scrib kullanılarak cam yüzeyi çizilmeye yapılıre cam slayt alt hizalama işaretlerini üretmek için. Protokolün sonraki aşamalarında Uyum mikroskop altında kontrol edilebilir.
    5. Barkod slayt PDMS kalıp çıkarın. Aşırı saf su ile bir kez ve SDS üç kez% 0.01 ile hafifçe slayt yıkayın.
      1. Bir mikroskop lamı eğiren kullanarak barkod slayt kurulayın. Daha sonraki kullanım için temiz bir 50-ml santrifüj tüpü içinde barkod slayt saklayın.

Barkod Slide One boyutlu Desen 2. Doğrulama

Not: Bu doğrulama protokolü ayrıca müteakip akış desen adımlarla kalitesini değerlendirmek kullanılmak üzere adapte edilebilir.

  1. Slayt Engelleme
    1. PBS içinde% 1 sığır serum albümini (BSA) hazırlayın. Kullanımdan önce 0,45 um şırınga filtre ile bu çözüm filtre. Bir jel yükleme ucu kullanarak, barkod sürgünün bir kenarına% 1 BSA çözeltisi 50 ul geçerlidir.
    2. % 1 BSA solut inkübeoda sıcaklığında 1 saat için ve iyon.
  2. Siyanin 3 (Cy3) ile enkübasyon, tamamlayıcı DNA ile konjüge edilmiş
    1. Bir ucunda Cy3 konjüge edilmiş bir A kokteyli ', B' ve C 'oligonükleotidleri hazırlayın. 'B' ve C 'A sekansları, sırasıyla A, B, ve C tamamlayıcı niteliktedir. Cy3-DNA çalışma konsantrasyonu,% 0.1 BSA içinde 0,05 uM'dir.
    2. Pipetleme slayt BSA çözüm çıkarın, daha sonra slayt aynı kenarında DNA kokteyl solüsyon 30 ul uygulayın. 1 saat boyunca oda sıcaklığında slayt üzerinde Cy3-DNA kokteyl inkübe edin. Photobleaching Cy3 parçasını korumak için karanlıkta bu kuluçka adımı gerçekleştirin.
  3. Floresans yoğunluğunu analizi
    1. PBS- son olarak Cy3-DNA kokteyl üzerinden pipet ve% 1 BSA PBS slayt yıkayın ve (1 p50 parça saf su ile sanat PBS). Bir eğiren kullanarak slayt kurulayın.
    2. Bir floresan mikroskop veya mikrodizi tarayıcı kullanılarak floresan (Şekil 2B) gözlemleyin. Bir mikrodizi tarayıcı kullanırken, 532 nm, 5 mikron piksel boyutu,% 15 photomultiplier tüp (PMT) 450 de kazanç ve güç lazer emisyon dalga boyu ayarlayın.

2-boyutlu (3x3), DNA Dizisi 14 3. Fabrikasyon

  1. PDMS barkod kalıbının hazırlanması
    1. Başka bir SU-8 ana oluşturmak için prosedür (1.1) gerçekleştirin, ancak bu kez dik ilk tasarım olduğu için bir akış deseni ile krom maske kullanın. Dik deseni ile yeni bir PDMS kalıp oluşturmak için prosedür (1.2) gerçekleştirin.
  2. SsDNA'nın İki boyutlu akış desenlendirme
    1. 3 x 3 dizi için, A'-i B'-ii 150 uM stok çözümleri, C'-iii A'-iv, B'-v, C'-vi, vii A'-B hazırlamak% 3 BSA / PBS '-viii ve C'-ix DNA arasında değişir. Bu oligonükleotidler "köprü diziler" (Şekil 2A) olarak hizmet etmektedir. Oligonükleotid çözümleri (Çözümler 1 ila 3) çalışma konsantrasyonu her bir oligonükleotid için 50 uM olacak şekilde birleştirir. Tablo 1'de verilen kılavuzu kullanın.
    2. 0.5-1 psi 1 saat 20 kanala% 3 BSA / PBS engelleme çözümü Akış.
    3. Akış Solutions 1 sırasıyla 2 ve kanal 1, 2 içine 3 ve 3,. 3 kanal daha sonraki setleri için bu siparişi izleyin. Akış genelde yaklaşık 40 dakika içinde tamamlandı. DNA hibridize izin vermek için 2 saat süre ile oda sıcaklığında DNA çözümleri inkübe edin.
    4. Melezleşmemiş DNA kaldırmak için 0.5-1 psi 1 saat 20 kanala% 3 BSA / PBS engelleme çözümü Akış. PDMS kütüğün soyun ve% 3 BSA içinde cam slayt daldırılarak elde edilen DNA mikro-dizi slayt yıkama / PBS kez ve iki kez PBS ile seyreltilmiş PBS (1 kısım PBS ve 50 parça saf su) eklenmiştir. DBir mikroskop lamı eğiren kullanarak slayt ry.
    5. I Cy3-konjüge edilmiş olduğu 'ila ix' bölümü 2. oligonükleotitlerin bölgesindeki benzer ikinci bir doğrulama adımı (Şekil 2C) uygulayın. Daha sonraki kullanım için bir 50-ml santrifüj tüpü içinde 3 x 3 dizisi slayt saklayın.
      Not: DNA mikrodizi ay için bir kurutucuda oda sıcaklığında saklanabilir.

Bir Antikor Array içine 3 x 3 DNA Array 4. Dönüşüm

  1. Antikor-oligonükleotid (İDEAL) konjugatlarının hazırlanması
    1. 200 mM süksinimidil-4-formilbenzoat (S-4FB) ve susuz N, 40 mM süksinimidil-6-hydrazinonicotinamide (S-HyNic), N-dimetilformamid (DMF) oluşan çözeltiler hazırlayın.
    2. PBS içinde antikorlarla 7 ayrı solüsyonları (1 mg / ml) 'ye kadar hazırlayın.
      Not: Antikor stok solüsyonları sodyum azid bakteriyostatik içeriyorsa, spin tuzsuzlaştırma c kullanarak PBS ile tampon değişimi gerçekleştirmek7 kDa molekül ağırlığı kesmesi (MWCO) ile olumns.
    3. I, 'ii' iii 'iv' v ', vi' ve VII 'DNA ayrı 400 mcM çözüm hazırlayın. Bir oligonükleotid dizisi, her bir yakalama antikoru atama. Mikrosantrifüj tüpler DMF 12.25 ul 400 mcM DNA 40 ul birleştirin ve iyice karıştırın aşağı doğru döndürün.
      1. Her bir DNA / DMF çözeltisine, DMF içinde 200 mM S-4FB 2.3 ul ekle. Yakalama antikor her 100 mikrogram için, DMF 40 mM S-HyNic 2.25 ul ekleyin.
    4. Oda sıcaklığında 4 saat boyunca antikor / S-HyNic ve DNA / S-4FB çözümler inkübe edin.
    5. Antikor-DNA birleştirme reaksiyonunun hazırlanmasında, pH 6'da sitrat tamponu ile yıkanarak yeni spin tuz giderme sütunlar (her bir antikor için, her bir DNA solüsyonu için bir tane ve bir) hazırlar.
    6. İnkübasyondan 4 saat sonra, her antikor / S-HyNic ve DNA / S-4FB çözümü için tampon değişimi. S-4FB-konjuge birleştirin VII' oligonükleotidleri. Oda sıcaklığında 2 saat süre ile inkübe karışımları.
    7. Reaksiyon O / N 4 ° C'de inkübe edin.
  2. Antikor-oligonükleotid (İDEAL) Konjügatların saflaştırılması
    Not: antikor oligonükleotidlerin saflaştırılması Bir Superose 6 10/300 GL kolonu ile donatılmış standart bir FPLC sistemi üzerinde hızlı protein sıvı kromatografisi (FPLC) gerçekleştirmek için.
    1. 280 nm FPLC sistemi UV detektörü dalga boyu ayarlayın. Aşırı S-4FB-DNA'dan antikor oligonükleotidlerin ayırmak için 0.3 ml / dk'da PBS (pH 7.4) izokratik akışını kullanın.
    2. Konjugatı içeren fraksiyonlar havuzu ve 10 kDa'lık bir MWCO filtre kullanılarak spin 150 ul bir hacme kadar fraksiyonlar konsantre edilir.
  3. Antikorların İki boyutlu desen
    1. Microchambers veya mikro-kuyuları bize başka PDMS kalıp hazırlayınadımda ing fabrikasyon işlemleri (1,2). PDMS kalıp bağışıklık için nanoliter kuyu mikrolitre içerebilir.
      Not: akışkan numunelerde genel Biyomarker tespiti için birden fazla kuyu ile bir PDMS kalıp dizi slayt ile birleştirilir. PDMS kalıp özellikleri sistem çalışılan bağlıdır. Örneğin, tek bir hücre deneylerden elde edilen proteinlerin tespiti 0,15-nl hacimli microchambers ihtiva eden bir PDMS kalıp ile gerçekleştirilebilir.
    2. (İsteğe bağlı) desenli yüzey hidrofil kılmak 1.5 dakika plazmaya PDMS kalıp temizleme (18 W) Konu. Önce plazma temizleme, doğrudan 3 x 3 dizi slayt bağlı olan tüm diğer yüzeyleri engellemek için yapışkan bant kullanın.
      Not: Aşama (4.3.2) isteğe bağlıdır, ancak PDMS kalıp, tek bir hücre deneylerinde kullanılmak için düşünülmüştür, genellikle gerçekleştirilir.
    3. 3 x 3 dizi slayt PDMS kalıp Mate, daha sonra PBS içinde% 1 BSA ile bloke slayt. Oda sıcaklığında 1 saat süreyle inkübe edin. Meanwhile, antikor oligonükleotid konjügatlarının bir kokteyl (200 ul nihai hacim) hazırlar. Her konjügat çalışma konsantrasyonu 1% BSA / PBS içinde 10 ug / ml 'dir.
    4. Daha sonra bu şekilde bir antikor dizisine bir DNA dizisi, dönüştürme konjugatları oligonükleotid parçası 3 x 3 diziler belirli noktalar ile hibridize izin 37 ° C 'de 1 saat süreyle inkübe antikor oligonükleotid kokteyl ekleyin.
    5. Temiz ve slayt kuru adımı tekrarlayın (3.2.4). Antikor dizisi derhal kullanılması durumunda en yüksek hassasiyet elde edilebilir. Uzun süreli depolama hassaslık kaybına neden olabilir.
  4. Proteinlerin tespit edilmesi
    1. Rekombinant proteinleri sulandırmak veya filtrelenmiş hücre örneği hazırlamak.
    2. Özel tasarlanmış yongası ile mikrotertibi Mate ve 1 saat PBS içinde% 3 BSA ile yüzeyi engeller. Daha sonra BSA çözeltisi kaldırmak ve örnekleri uygulamak ve 2 saat süre ile inkübe edilir.
    3. PBS içinde% 3 BSA kullanarak örnekleri yıkayın üç kez birsonra ürün veri sayfasında tarafından sağlanan bir konsantrasyonda tespit antikorlar ekleyin d. 2 saat süreyle inkübe edin.
    4. PBS içinde üç kez% 3 BSA ile saptama antikorları yıkayın ve daha sonra 1 saat boyunca inkübasyon takip 1 ug / ml'de -streptavidin siyanin 5 (Cy5) ekleyin.
    5. Temiz ve tarama için slayt kuru adımı tekrarlayın (3.2.4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

PDMS kalıplar (Şekil 1A-1B) için tasarımlar CAD programı (AutoCAD) kullanılarak çizildi. Akış desenlendirme, yatay diğeri dikey için özellik kanalları gösterilen iki tasarımlar. Her tasarımın sol ve sağ parçaları simetriktir; ya onları girişleri veya çıkışları olabilir. 20 kanalın her biri tüm yol diğer ucunda bir ucundan virajlı. Her tasarımın bir krom photomask (Şekil 1C) yazılıdır. Bir gofret fabrikasyon SU-8 ana Şekil 1D gösterilmiştir. PLL ya da DNA'nın akış model oluşturmanın kolaylaştırmak için, PDMS kalıbı, bir nitrojen gazı akışı kurulumu (Şekil 1E) bağlanmıştır.

Bu protokolde kullanılan üç akış desen adımlar vardır. Sonraki adımlar oligonükleotid çözümlerini tanıtmak hem olurken ilk adım, cam tabaka üzerinde PLL hareketsiz. Tablo 1, oligonucle olarakÇözümler 1-3 otide bileşimleri verilmiştir. Her oligonükleotid çalışma konsantrasyonu 50 uM ve her solüsyonunun toplam hacmi 39 ul'dir. Bu çözümler, her bir oligonükleotit stok çözeltisi (150 uM) 13 ul birleştirilmesi ile hazırlanır.

Desenli DNA mikroarray birimleri tekrarlayan ve tüm cam slayt boyunca bitişiktir. 3 x 3 mikroarray'ler için maksimum yoğunluk tek cam slayt yaklaşık 400.000 noktalar olduğunu. Ticari DNA mikroarray Side-by-side karşılaştırma teknolojimiz Cy3 bağlama tamamlayıcı DNA'lar etiketli zaman yaklaşık 5 kat daha duyarlı olduğunu ortaya koymaktadır. Desenli DNA'lar birden tekrarlar arasında ~% 5 değişimi ile nispeten homojen bulunmaktadır. Biyolojik örneklerin protein içeriği ölçerken bu özellikler bizim teknoloji yüksek miktar yeteneğini söz veriyorum. Buna ek olarak, akış kanalı tasarımı ile kombinasyon halinde DNA'ların ortogonalite flexibili teklifgeometrilerin çeşitli (Şekil 2D) olarak desenlendirme ty.

Şekil 3C'de gösterildiği gibi DNA-antibadi konjugatların (Şekil 3B) ile hibridizasyon yoluyla bir antikor dizisine bir DNA dizisini dönüştürme sonra, elde edilen antikor paneli esas sandviç ELISA platformu vasıtasıyla çoğaltılmış çok katlı tespitinde kullanılır. Sandviç ELISA olarak, biyotinile edilmiş algılama (ikincil) antikorlar çekilen proteinlere bağlanan ve fluorofor-konjuge streptavidin ile müteakip etiketleme flüoresan'a bağlı tespiti (Şekil 3C-E) sağlar. Proteinler gösterir <cam slayt (Şekil 3D) diğer ucunda bir ucundan 10,% değişim tespiti. 3 x 3 dizi ile, biz referans olarak tek dizi öğesinin atarken, 7 proteinlere kadar tespit edebiliyoruz (Cy3 etiketli) ve negatif kontrol olarak başka unsur. Örneğin, bir tek hücreli bir deney için gerçekleştirilirtümör çalışmaları, proteinler, interlökin-6 (IL-6), matriks metalopeptidaz 9 (MMP9), hepatosit büyüme faktörü (HGF), vasküler endotelyal büyüme faktörü (VEGF), interlökin-8 (IL-8), ve makrofaj göçü önleme faktörü tek bir hücreden (MIF) (Şekil 3E) eş zamanlı olarak tespit edilebilir.

Ayrıca çeşitli konsantrasyonlarda rekombinant proteinleri kullanılarak sistemi kalibre. Şekil 3F de, bir araya getiren proteinler, interferon-y için kalibrasyon eğrileri (IFN-γ), tümör nekroz faktörü α (TNF α), interlökin-13 (IL-13), tümör nekroz faktörü β (TNF β), granzim B, interlökin -4 (IL-4) ve interlökin-8 (IL-8) 'da gösterilmiştir. Algılama hassasiyeti daha da alt-tabaka üzerinde DNA'lar ve muhtemelen antikor daha yüksek seviyede olan yuvalı plakalar üzerinde, geleneksel sandviç ELISA ile verilene benzer.

Barkod antibody mikrodizi akışkan örneklerinde hem de tek hücrelerde biyomarkerları tespit etmek için kullanılabilir. Tek hücreli bir analizi, bu protokol odak olmadığı için, biz sadece sitokin tespiti 3 x 3 antikoru mikrodizisinin uygulama örneği göstermektedir. Antikor yüzey işaretleyici etkileşimleri sayesinde, farklılaşma 8 küme (CD8) pozitif hücreler mikroarray elemanları (Şekil 3G, üstüne bir PDMS çip) birine yakalanan ve elementlerin geri kalanı (salgılanan sitokinler tespit etmek için kullanılan Şekil 3H). Bu hücre yakalama yöntemi ile, "hücre dizileri" oluşturulabilir. Bu dizi, yakalama tekniği aynı zamanda her bir ELISA deneyine tabi hücre sayısı üzerinde kontrol sağlar. Tespit edilen proteinler, özellikle tek hücrelere pertained böylece hücrelerin fiziksel microchambers izole edildi. Şekil 3H de, her gösterildiği microchamber kapsüllenmesini sağlamak için 16 mikro-dizi elemanları ile donatılmış olmasıTam 3 x 3 mikroarray seti.

figür 1
Şekil 1. Tasarım ve akış tabanlı DNA desenlendirme için PDMS barkod kalıplarının imalatı. Paneli (A) yatay ve dikey tek boyutlu barkod desenleri AutoCAD çizimleri gösterir. Panel (B) (A) 'den üst üste yatay ve dikey barkod modellerini gösterir. Yeşil kutular ayrık 3 x 3 dizileri ile desenli alanları içine alın. SU-8 ana imalatı için (C) Krom maske. (D) bir silikon gofret fabrikasyon SU-8 ana. (E) Akış desenlendirme için Set-up. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 2, Şekil 2. İnşaat ve 3 x 3 DNA dizisinin doğrulama. Bu rakam Wang, J. ve ark., 2012, Nano Lett 12 tarafından, "Glioblastoma Multiforme Kanser Hücreleri Applications ile Hücre-Hücre Etkileşimi Fonksiyonları miktarlarının" modifiye edilmiş . Amerikan Kimya Derneği tarafından Copyright 2012. Izniyle uyarlanmıştır. DNA akış desen adımlar için (A) Şema. 1D barkod (dikey bir çizgi ile takip) seçilen bir alanda 20 kanal (B) Floresans şiddeti profili. Cy3-konjüge edilmiş oligonükleotitler doğrulama için DNA dizileri ile melezlendi. Ikinci DNA model verme adımı tamamlandıktan sonra, Cy3 konjüge edilmiş DNA ile doğrulanmış dizilerin (C), flüoresan yoğunluğu profili. (D) Farklı fl Alternative floresan desenlerstratejiler-desen ow. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
3 x 3 mikrodizisinin Şekil 3. uygulamaları. (A) Şema antikor oligonükleotid İDEAL konjugatlarının sentezi için. Antikor-oligonükleotid eşlenikleri ile hibridizasyon yoluyla bir antikor dizisi, DNA dizisinin dönüştürülmesi için (B) Şema. Bir sandviç ELISA platformda 3 x 3 mikrodizisi kullanılması için (C) Şema. Bu rakam Wang, J. ve ark., 2012, Nano Lett 12 tarafından, "Glioblastoma Multiforme Kanser Hücreleri Applications ile Hücre-Hücre Etkileşimi Fonksiyonları miktarlarının" modifiye edilmiştir. Telif 20Amerikan Kimya Derneği tarafından 12. Izniyle uyarlanmıştır. Panel (D), bir Cy5 kanalı altında üretilen bir floresans okuma gösterir. Bu 6 proteinleri tespit edilen bir sandviç ELISA deneyinde karşılık gelir. Paneli (E) bir uzaklaştırdınız-in Cy3 ve Cy5 kanalları altında 3 x 3 dizi okuma profiline. Panel (F) rekombinant proteinleri sandviç ELISA kalibrasyon eğrilerini gösterir. Panel (G) dizideki antikorları ile bağlanarak hücreleri yakalayarak oluşturulan bir "hücre dizisi" gösterir. Panel (H) mikroçip içinde microchambers ile üst üste algılama sonucunu gösterir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

1
Çözüm Oligonükleotid Kompozisyon
A'-i B'-ii, iii C'-
2 A'-iv, B'-v, C'-vi
3 A'-vii, viii B'-, C'-ix

DNA Akış Desenlendirme için Çözümler 1-3 Tablo 1. Bileşimi.

Demirleme diziler
A ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Dizileri Bridging
A'-i TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-ii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-iv TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Doğrulama için Cy3-konjüge edilmiş oligonükleotitler
A ' TACGGACTTAGCTCCAGGAT
B ' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
ben' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
vi ' TCCGACGCAACAATAGGGCA
'vii CCTGCTCGACAACTAGAAGA
'viii CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: keep-together.within-sayfa =" 1 "> Tablo 2. DNA akış desen kullanılan Diziler.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Akış desen tasarımı 2-D mikrotertibi imalatı ilk kritik adımdır. Bir cam substrat üzerinde iki çakışan DNA desenleri oluşturmak için, ilk tasarım özellikleri, ikinci kanal (Şekil 1A-B) olan dik olmalıdır. Tasarımları da mikrotertibin aşağı uygulamalarını düşünün. Tek bir hücre analizi durumunda, mikro-dizi, bu nedenle kanal boyutları 2-D dizileri aynı hizaya microchambers uyumlu yapılır microchambers içine tek hücre proteinleri tespit etmek için kullanılır. Her tasarım Fotoşablonlarda oluşturulur ve standart fotolitografi teknikleri, bir silikon göbek (Şekil 1C-D) SU-8 kanal özellikleri imal etmek için kullanılır. Bu kalıp PDMS için master olarak hizmet vermektedir. Kalıp imal edildikten sonra, bu PLL kaplı slayta yapıştırılmış ve daha sonra bir azot gazı akışı kurulumu (Şekil 1E) ile birleştirilir. Set-up bizkullanımı basit ve kolay bir şekilde bir basınç-regüle nitrojen gazı kaynağı ile bir laboratuar dahil olma avantajına sahiptir. Biz bir azot gazı tanka bağlı ucuz çoklu 3-yollu vana bir montaj kullanın. Desen hava akış kalıptan cam slayt ayrılmasından kaçınmak için düşük basınçlarda (0,5-1 psi) muhafaza edilmelidir. PDMS kalıp içinde sızıntılar desen bütünlüğünü bozabilir.

Bu protokol DNA akış desen adımlar özenle seçilmiş dik dizilerinin (Şekil 2A) ile ssDNA'yı kullanmaktadır. Öncesinde akış-desenleme, bu oligonükleotidlerden benzersiz diziler çapraz konuşma yokluğu için test edilmelidir. Çapraz konuşmak için basit bir test bizim protokolde tanıtmak onaylama prosedürü (Adım 2) değiştirerek yapılır. Bunun yerine bir kokteyl ile tamamlayıcı DNA, Cy3-etiketli, tamamlayıcı dizinin sadece bir tip sürgünün seçilmiş bir bölge için her seferinde kullanılan birden fazla ilgiliDNA dizileri immobilize edilir. DNA, çapraz konuşma yokluğunda sadece (1-D, DNA dizisi için), bir şerit ya da (2-D, DNA dizisi için), bir nokta, bir Cy3 filtre altında floresan gerekmektedir. İyice valide dik dizilerin örnekleri Malzeme ve Ekipmanları Tablo bulunabilir. İlk DNA desenlendirme adımı "çapa" oligonükleotid üç çeşit tanıttı. Bu 80-nt dizileri iki eşsiz 20-mer sekansların ile dönüşümlü olarak iki 20-mer, poli-A bölgesinin oluşmaktadır. Bu bağlantı sekanslarına 5'-amin modifikasyonu amin to-amin BS3 aracılık ettiği PLL ile 17 çapraz bağlanması için gereklidir. Ikinci DNA model verme aşaması, bir çapraz bağlayıcı gerekli değildir. Bu adım kısmen ankraj dizileri ile melezleşme "köprü" oligonükleotidler tanıttı. Her 60-nt köprü dizisi bir çapa bir dizi, bir 20-mer, poli-A aralayıcı ve benzersiz bir 20-mer dizisini tamamlayıcı bir 20-mer bölgesinden oluşur. DNA dizileri Doğrulama (Figure 2B-C) desen adımlarla kalitesini değerlendirmek için ve çapraz bulaşmayı 14 sağlamak için her türlü DNA akış desen aşamasından sonra yapılır. Bu DNA, desenleri ile hibridize Cy3-konjüge edilmiş oligonükleotid probları sokulmasıyla gerçekleştirilir. Floresan analizi için Adım (2.3.2) 'de belirtilen parametreler ile DNA kalıpları mikrotertibi kullanılarak yapılan aşağı bağışıklık duyarlılığını en üst düzeye çıkarmak için en az 40,000 au floresan yoğunluklarına göstermelidir. Doğrulama sırasında farklı Cy3-DNA setleri stratejik kullanımı dolayısıyla 8 adımlarını DNA desenlendirme esnekliğini gösteren, alternatif desen (Şekil 2B) yol açar. Kaçakları ya da (örneğin toz parçacıkları gibi) mekanik engellerden neden olabilir üniforma desenleri elde etmek için başarısızlık akış desen adımlarla karşılaştı.

Antikor-oligonükleotid İDEAL konjugatlarının hazırlanması th bir başka önemli bir adımdırprotokoldür. Antikorların seçimi, inceleme konusu biyolojik sistem tarafından belirlenir. Konjugasyon olarak kullanılan oligonükleotidler, DNA dizisi üzerinde sabitlenmiş olan tamamlayıcı dizilerine sahip olmalıdır. S-4FB ve S-HyNic bağlayıcıların stok çözeltileri taze olarak hazırlanmış ve hidrolizini önlemek için nemden tutulmalıdır. Bizim konjügasyon protokolünde kullanılan inkübasyon süreleri antikorlar ve DNA üzerinde arzu edilen da getirmektedir için yeterince uzundur. Nihai birleştirme reaksiyonu, sadece FPLC ile reaksiyona girmeyen, S-4FB-konjuge oligonükleotidler kaldırarak söndürülür. Böylece, FPLC arıtma konjugasyonunu tamamladıktan hemen sonra yapılmalıdır. Protokolde tarif edilen sistem, daha düşük akış oranları (0,2-0,25 ml / dakika) ile FPLC gerçekleştirirken, aynı zamanda çözünürlüğü artırmak için kullanılabilir. Eşlenikler daha dar ve daha yüksek bir DNA tepe (17-20 mi elüsyon hacmi) önce görüntülenen geniş bir pik (yaklaşık 9-15 ml elüsyon hacmi) halinde elüt edilmiştir. Biz çözüm depolamak önermiyoruzaşırı S-4FB-DNA konjugatların bu fazla işlevselleştirilmiş DNA ile konjugasyon sırasında antikorda antijen bağlayıcı siteler kaybına yol açabilir, çünkü. İDEAL birleşimleri kullanılarak sandviç ELISA hassasiyeti, özgüllük ve tekrarlanabilirliği önceki çalışmalarda gösterilmiştir. 8,9,11,12,16 antikor DNA konjugatları kalitesini belirlemek üzere, birleşmeler oluşturmak için DNA dizileri üzerinde inkübe edilebilir Daha sonra protein saptaması (Şekil 3F) için kalibrasyon eğrileri oluşturmak için sandviç ELISA deneylerinde kullanılan antikor dizisi. Bu kalibrasyon eğrileri oluşturmak için, geleneksel bir sandviç ELISA kit içinde temin rekombinant proteinler kullanılabilir. Yüksek kaliteli konjugatlarının kullanılması kitinin ile karşılaştırılabilir doğrusal aralıkları ve alt deteksiyon sınırlarına yol açması gerekmektedir. Bir örnek olarak, bir antikor dizisinde sandviç ELISA için INFγ ve TNFa için en düşük sınır (Şekil 3F) ~ 50-100 mg / ml, ve consisten olanGeleneksel sandviç ELISA kiti için ürün veri sayfasında belirtilen ~ 15-1,000 pg / ml doğrusal algılama aralığı ile t. Aşağı sandviç ELISA deneylerinde elde edilen zayıf sinyal okuma DNA dizisi, alternatif eşlenik çözümlerinde aşırı DNA müdahalesi, ya da, antikorları ile ssDNA'larının eksik konjugasyon düşük kaliteli isnat edilebilir.

Antikor dizisinde sandviç ELISA gerçekleştirmek için Binbaşı endişeler reaktifler arasında ve sinyal gerçek biyolojik olayları yansıtıp yansıtmadığını çapraz konuşma sayılabilir. Bu protokolde kullanmak dik DNA'lar iyice% 0.1'den daha az çapraz konuşmak için onaylanmıştır. Bu nedenle immunoassay aşamasında gözlemlenen herhangi bir cross-talk antikorları ELISA reaktifleri esas olduğunu. Dizideki antikorlar arasında çapraz konuşma için test gerçek örnekler üzerinde tahlilleri uygulanmadan önce yapılmalıdır. Bir antikor paneli oluşturulmuştur sonra, bir kaç sandviç ELISA kontrol deneyleri perf olmalıdıralgılama antikorlar olmadan antijenler olmadan 1., 2., ve 3. Tespit antikorlar ve etiketleme reaktifleri sadece aşağıdaki koşullarda ormed. Cross-talk immüno aşamasında gözlenirse, antikor çiftleri ve / veya ELISA reaktif değiştirilmelidir. Bu geleneksel ELISA kitleri ticari olarak temin edilebilen antikor kullanımı dizi-bazlı sandviç ELISA tekniği uygulanabilirliğini garanti etmez dikkat edilmelidir.

Bu teknolojinin yararları ucuz bir imalat, minyatür boyutu ve tasarım esnekliği vardır. Bizim fabrikasyon protokol antikor dizilerin birçok kullanıcı mevcut olmayabilir mikroarray gözcü gerekmez. Akış desenlendirme set-up kolayca basit laboratuvarlarda monte edilebilir. Fotolitografi için aletleriyle donatılmış olmayan laboratuvarlar için, protokolde sunduğumuz CAD tasarımları mikroüretim hizmetleri sunan şirketlere iletilebilir. Geleneksel mikrotertibi içine KüçülmeBizim protokol ile fabrikasyon kompakt dizi tek hücreli Deneylerde kullanılan mikroçipler ile uyumluluk sağlar. Bizim protokol ilk olarak bir antikor dizisine dönüştürmeden önce bir ssDNA dizi olarak dizinin üretimini sahiptir. SsDNA'larının ile ön desen bir takım avantajlara sahiptir. İlk olarak, ssDNA ve böylece ssDNA desenli slaytlar önemli ölçüde bozulma 8,16 olmaksızın en az 6 ay boyunca bir desikatör içinde saklanabilir, antikorlar ile karşılaştırıldığında, kimyasal olarak daha stabildir. İkincisi, bizim yaklaşım bir son kullanıcıya sadece mikrotertibin değişiklik olmadan bir çözüm birlikte selektif konjugatlarını karıştırarak gerekli tahlilleri, seçme esnekliği sunar; Tersine, bilinen bir protein / antikor dizileri için önceden tasarlanmış ve bir alt-tabaka üzerine tespit, böylece tahliller değişimi en başından itibaren protein / antikor desenleme / baskı gerektirecektir. Temsili çalışmalar yüksek verimlilik barkod antikor mikroarray kullanımını göstermektedir detectiotek hücre birden fazla sayıdaki sinyal proteininin n. Akım paterni tasarımları ve / veya kullanılan oligonükleotid desenlendirme çözümleri değiştirilerek, dizi düzenleri çok sayıda keşfedilebilir. Bu uygulamanın bir örneği olarak, tek hücreler fonksiyonel proteinler incelenebilir. Tek hücreli analizi için çip ~ 8700 microchambers, tam 3 x 3 antikor dizisi (Şekil 3H) ile uyumlu her gibi birçok kapsar. Böyle bir set-up yüksek verimli tespiti için izin verir. Microchambers kültürlenen hücreler tarafından salgılanan proteinler, bu dizi tarafından tespit edilebilir. Çok yönlü bir mikrodizi tasarımı da diğer jenerik bileşenlerin 8,15 ile mikrodizisi birleştirdikten sonra serum, hücre lizatlarında ve tek hücre proteinlerinin çoğaltılmış çok katlı algılanmasına olanak verir. Protein tespiti ek olarak, 3 x 3 antikor dizisi, aynı zamanda yakalama hücreleri (Şekil 3G) yararlıdır.

Bu yaklaşımın temel dezavantajı ekledi compl olduğunuGeleneksel microarrays imalatı ile karşılaştırıldığında exity. Fabrikasyon dizinin özel uygulamalar göz önünde bulundurarak desenlendirme ve dizi tasarım stratejileri dikkatle kavramsallaştırma olmalıdır. Bu yaklaşım aynı zamanda çapraz konuşmak için doğrulama prosedürleri ve testler de dahil olmak üzere kritik bir takım adımlar gerektirir. 3 x 3 dizi bizim protokolünü kullanarak bir seferde 7 proteinleri tespit sınırlıdır inşa edilmiştir. Ancak, bu sınır büyük diziler oluşturarak aştı edilebilir. Burada yer protokolü 3 x 3 microarrays üretimi ile sınırlı değildir. Biz başarıyla 5 x 5 mikroarray'ler ve dizi öğelerinin diğer boyutlarını imal etmek mümkün olmuştur. Prensip olarak, diğer nx m dizileri sürece ön DNA desenli bir dizi oluşturmak için kullanılan oligonükleotid setleri dizi elemanları arasındaki çapraz karışmayı önlemek ortogonal olan benzer teknikler kullanılarak imal edilebilir. Genişletilmiş dizilerin oluşturulması akışı patterni elde edilirng n ssDNA'nın türleri ikinci desen adım için ssDNA dizileri köprüleme n x m izledi birinci DNA desenlendirme adım için çapa. Köprüleme sekansları A'-i E'-xxv iken kullanılmaktadır Örneğin, bir 5 x 5 dizi oluşturmak için, E bağlantı sekansları, A, kullanılabilmektedir. Bu sadece tek bir DNA akış desenlendirme adımını kullanılmıştır olmasına rağmen akış desenlendirme işlemini otomatikleştirmek, bir robot platformu 18 geliştirilmiştir. Iki adım arasındaki geçiş, ilk desen aşamasından sonra ilk PDMS kalıp soyulması elle gerekebilir ise prensip olarak aynı platformu olacağını yıkama izledi ve slayt (bu adımı kurutma, dik akış desenlendirme ikinci adımında uzatılabilir dik odaklı ikinci desenlendirme adımı kolaylaştırmak için başka bir PDMS kalıp ile slayt çiftleşme önce) yaklaşık 10 dakika sürer.

Biz desenli bir nxm dizi imalatı için detaylı prosedürler tartışıldıproteomik çalışmalar ve hücre sinyal gelecekteki uygulamalar için büyük söz sahibidir yüksek yoğunluklu, az antikorlar. Burada sunulan protokol de başka amaçlar için daha ayrıntılı DNA / antikor dizileri inşası için bir rehber olarak hizmet edebilir.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).
Yüksek yoğunluklu Barkod Antikor Mikroarray Akışı-desen Rehberli Fabrikasyon
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).More

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter