Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

QTL-kartläggning och CRISPR / Cas9 redigering för att identifiera en läkemedelsresistensgen i Published: June 22, 2017 doi: 10.3791/55185

Summary

Detaljer presenteras om hur QTL-kartläggning med en genomsekvensbaserad genetisk karta kan användas för att identifiera en läkemedelsresistensgen i Toxoplasma gondii och hur detta kan verifieras med CRISPR / Cas9-systemet som effektivt redigerar ett genomiskt mål, i detta fall Drogresistensgen.

Abstract

Vetenskaplig kunskap är i grunden kopplad till tillgänglig teknologi och metoder. Denna artikel kommer att presentera två metoder som möjliggör identifiering och verifiering av en läkemedelsresistensgen i Apicomplexan parasit toxoplasma gondii , metoden för kvantitativ trait lokalisering (QTL) kartläggning med användning av en genomsättningssekvens för hela genomsekvensen (WGS) och metoden Av klyvda regelbundet interspaced kort palindromisk repetition (CRISPR) / Cas9-baserad genredigering. Införandet av QTL-kartläggning gör att man kan testa om det finns en korrelation mellan en genomisk region och en fenotyp. Två dataset krävs för att köra en QTL-skanning, en genetisk karta baserad på avkommet från ett rekombinant kors och en kvantifierbar fenotyp som utvärderas i var och en av detta kors avkomma. Dessa dataset formateras sedan för att vara kompatibla med R / qtl-programvara som alstrar en QTL-skanning för att identifiera betydande loci korrelerade med fenotypen. Även om detta i hög grad kan begränsa sökningen wIndrag av möjliga kandidater, QTLs spannar regioner som innehåller ett antal gener, från vilka kausalgenen behöver identifieras. Att ha WGS av avkomman var kritisk för att identifiera orsaksmedelsresistensmutationen på gennivå. Efter identifiering kan kandidatmutationen verifieras genom genetisk manipulation av läkemedelskänsliga parasiter. Den mest enkla och effektiva metoden att genetiskt modifiera T. gondii är CRISPR / Cas9-systemet. Detta system bestod av bara 2 komponenter som båda kodades på en enda plasmid, en enda styr-RNA (gRNA) innehållande en 20 bp sekvens komplementär till det genomiska målet och Cas9-endonukleaset som genererar en dubbelsträngs DNA-paus (DSB) vid målet, Reparation av vilket möjliggör införande eller radering av sekvenser runt brytplatsen. Denna artikel innehåller detaljerade protokoll för att använda CRISPR / Cas9-baserade genomredigeringsverktyg för att verifiera genen som är ansvarig för sinfunginresistens och för att konstruera transgena parasiter.

Introduction

Värdena bestämmer omfattningen av en parasiternas prevalens. Vissa parasiter har mycket specifika värdkrav som begränsar området från vilket de hittas, andra är generalister. En sådan generalist är Toxoplasma gondii ( T. gondii) . Denna parasit finns över hela världen eftersom den kan infektera alla däggdjur och många fåglar. Människor är också mottagliga och det uppskattas att ungefär 1/3 av den globala befolkningen har smittats. Lyckligtvis kontrollerar ett robust immunsvar normalt parasitens tillväxt, men i situationer där immunförsvaret äventyras kan parasiten växa okontrollerat och orsaka sjukdomar, ofta encefaliska. Även denna parasit kan orsaka medfödda sjukdomar om tidigare oinfekterade kvinnor smittas under graviditeten eftersom de saknar immunförsvar för att snabbt begränsa parasitens spridning. Dessutom finns det en börda av okulär toxoplasmos som kan leda till synförlust 1 . För dessa reasoNs T. gondii har blivit ett fokus för studier, och på grund av de många molekylära metoder som utvecklats för sin studie, en modell för Apicomplexan-parasiter. Två metoder som kommer att diskuteras här är kartläggning av kvantitativ egenskap lokalisering (QTL) och kluster regelbundet interspaced kort palindroma repetitioner (CRISPR) / Cas9 genredigering. QTL-kartläggning och CRISPR / Cas9-redigering är respektive fram- och bakåtgenetiska metoder som har använts i tidigare studier för att identifiera och / eller karakterisera T. gondii virulensgener. Här kombineras dessa metoder för att identifiera och bekräfta funktionen av en senfunginresistens (SNF r ) gen, TgME49_290860 och dess orthologer (antecknad som SNR1 ) 2 .

Fastän T. gondii kan infektera ett stort antal mellanliggande värdar, måste det passera och infektera tarmepitelceller från en felid för att slutföra livscykeln. Katter är de definitiva värdarna av parasiten där sExamma steg produceras och genetisk rekombination via meios uppstår. För att utföra en QTL-studie måste man skapa ett genetiskt kors, och i fallet med toxoplasma innebär det att man passerar två olika parasitstammar som skiljer sig åt i ett fenotypiskt drag, föräldrafläckarna, genom en katt för att producera rekombinant avkomma 3 . Före matning till katter är föräldrastammarna resistenta mot separata läkemedel för att möjliggöra effektivare identifiering av rekombinanter genom dubbelt läkemedelsval av avkomman 4 . Tre droger har använts i T. gondii för detta ändamål; Fluoroxibribos (FUDR) för vilken uracilfosforibosyltransferas ( UPRT ) är resistensgenen 5 , adenosin-arabinosid (ARA) för vilken adenosinkinas ( AK ) är resistensgenen 6 och sinfungin (SNF) för vilken resistensgenen var okänd 7 . Flera genetiska kors har varitSkapades för T. gondii , men endast 24 avkomma från ME49-FUDR r X VAND-SNF r- korset genotyperades genom användning av helt genom-sekvensering (WGS) 8 . Detta öppnade möjligheten att kartlägga och identifiera SNF-resistensgenen med användning av detta kors, eftersom VAND-föräldern blev gjort resistent mot kemisk mutagenes av den läkemedelskänsliga VAND (VAND-SNF s ) -stammen och VAND-referensgenomet sekvenserades med användning av VAND- SNF s- stammen vilket möjliggör identifiering av alla polymorfier mellan avkomman WGS och VAND-SNFs referensgenomet, inklusive den ärftliga föräldra VAND-SNF r- mutationen som gjorde några av de avkommande senfungin resistenta.

För att identifiera den kausal enkla nukleotidpolymorfismen (SNP) i SNF r- avkomman kan flera beräkningsbaserade open source-resurser användas för att analysera data. För att skapa den genetiska kartan för ME49-FUDR r X VAND-SNF r över REDHORSE programvarusupport 9 har utvecklats som använder WGS-anpassningar av föräldrarna och avkomman för att noggrant detektera genomiska positioner för genetiska övergångar. Denna kartläggningsinformation kan sedan kombineras med fenotypiska data (SNF r i avkomman) för att formatera en dataset som är kompatibel med "qtl" -paketet 10 i den statistiska programmeringsprogrammet R där en QTL-sökning kan köras för att avslöja betydande loci korrelerade med fenotyp. För att identifiera kausal SNP som befinner sig inom QTL-locuset kan WGS-läsarna av avkomman anpassas individuellt till det senfungin-känsliga VAND-genomet med användning av Bowtie 2-anpassningsprogrammet 11 från vilket SNP kan anropas med hjälp av VarScan mpileup2snp-variant-ringsprogrammet 12 . Med hjälp av dessa SNP kan QTL-locuset sedan skannas för polymorfier som är närvarande i SNF- r men inteI SNF: s avkomma. Med det kausal SNP som identifieras i den kodande regionen hos en gen kan genetisk modifiering av den sökande SNFr-genen utföras i en SNFs-stam för att verifiera läkemedelsresistansfunktionen.

CRISPR / Cas9 genometredigeringssystemet etablerades nyligen i Toxoplasma 13 , vilket gav viktiga verktyg för undersökning av den komplexa biologin hos denna parasit, särskilt för genetiska studier i icke-laboratorie anpassade stammar. På grund av den högaktiva aktiviteten för icke-homologa slutförbindelser (NHEJ) i WT- toxoplasma- celler är målmedelsmodifiering svår att uppnå, eftersom exogent infört DNA är slumpmässigt integrerat med genomet vid extremt hög frekvens 14 . För att öka framgångsgraden för lokalspecifik modifiering har olika metoder använts för att öka effektiviteten hos homolog rekombination och / eller minskaE NHEJ aktivitet 15 , 16 . Ett av dessa tillvägagångssätt är CRISPR / Cas9-systemet. Jämfört med andra metoder är CRISPR / Cas9-systemet effektivt för att införa platsspecifika modifieringar och är lätt att designa 13 , 17 , 18 . Dessutom kan den användas i någon Toxoplasma- stam utan extra modifikation av parasiten 13 , 19 .

CRISPR / Cas9-systemet härstammar från det adaptiva immunsystemet av Streptococcus pyogenes , som använder det för att försvara invasionen av mobila genetiska element, såsom fag 20 , 21 , 22 . Detta system använder det RNA-styrda DNA-endonukleas-enzymet Cas9 för att introducera dubbelsträngs DNA-paus (DSB) i målet, vilket därefter repeterasAntingen av den felaktiga NHEJ att inaktivera målgener genom korta indelmutationer eller genom homologdirekt rekombination för att förändra mållocuset exakt som utformat 23 , 24 . Målspecifikiteten bestäms av en liten RNA-molekyl som heter singelstyrd RNA (gRNA), som innehåller en individuellt utformad 20 nt-sekvens som har 100% homologi med mål-DNA 22 . GRNA-molekylen innehåller också signaturer som kännetecknas av Cas9 som styr nukleaset till målplatsen, vilket inkluderar en speciell Protospacer-angränsande motiv (PAM, sekvensen är NGG) 25 , 26 . Därför arbetar gRNA-molekylen och PAM-sekvensen för att bestämma Cas9-klyvningsstället i genomet. Man kan enkelt ändra gRNA-sekvensen för att rikta olika ställen för klyvning.

När CRISPR / Cas9-systemet utvecklades först i ToxopLasma användes en enda plasmid som uttrycker Cas9-nukleaset och gRNA-molekylen för att introducera DSB vid målsättningsstället 13 , 17 . Det har visat sig att CRISPR / Cas9-systemet drastiskt ökar effektiviteten av platsspecifik genommodifiering, inte enbart genom homolog rekombination, men också icke-homolog integration av exogent DNA 13 . Det gör detta i vildtypstammar som innehåller NHEJ-aktivitet. Därför kan detta system användas i väsentligen vilken som helst Toxoplasma- stam för effektiv genomredigering. I ett typiskt experiment co-transfekteras den målspecifika CRISPR-plasmiden och DNA-fragmentet som används för modifiering av målet i parasiter. Om DNA-fragmentet som användes för modifiering av målet innehåller homologa sekvenser till mål-locuset kan homolog rekombination användas för att reparera DSB introducerad av CRISPR / Cas9 för att möjliggöra exakt modifiering av målet. Å andra sidan, om intDNA-fragmentet innehåller inte en homolog sekvens, den kan fortfarande integreras i CRISPR / Cas9-riktningsplatsen. Den senare används ofta för att störa gener genom införande av selekterbara markörer eller komplementära mutanter vid loci som tillåter negativt urval 13 . Här fungerar SNR1- locus som ett exempel för att visa hur CRISPR / Cas9 kan användas för genavbrott och generering av transgena parasiter.

Protocol

1. Bedöm SNF r i avkomman till ME49-FUDR r x VAND-SNF r Cross

OBS: T. gondii är en obligatorisk intracellulär parasit och tachyzoitsteget växer lätt i vävnadsodling.

  1. För att odla T. gondii- parasiten behåller de dem i sammanflyttande monoflakkultur från humanforeskinfibroblast (HFF) som utsöndras till T25-kolvar med Dulbecco's Modified Eagle's Medium (DMEM) -medium kompletterat med 10% fetalt bovint serum (FBS) (D10 media) vid 37 ° C C och 5% CO2.
    OBS: Se protokoll 1.1 Anmärkning i kompletterande fil 1 .
  2. För att testa enskilda avkommakloner för sinfunginresistens växer varje klon till hög parasitdensitet i en T25 HFF-kolkolv i 2-3 d, tills majoriteten av parasiterna börjar lysa värdcellerna.
  3. Skrapa monoskiktet med en cellskrapa och skicka parasitlösningen genom en 10 ml spruta / 22 G trubbig nål 2-3x tO lyser värdcellerna som frisätter parasiter. Lösningen kan dras tillbaka upp i sprutan för flera nålpassager.
  4. Filtrera parasitlösningen i ett nytt koniskt rör genom ett membran med porstorlek på 3 μm för att avlägsna HFF-celler och cellulära skräp.
  5. Räkna parasiterna på en hemocytometer och bestäm antalet parasiter per ml.
  6. Genom att använda en pipettor, skicka 2,5 x 10 5 parasiter till en ny T25 HFF-kolvkolv innehållande D10-media med 0,3 μM arbetskoncentration av sinfunginläkemedlet.
  7. Växt parasiterna vid 37 ° C och 5% CO2 för 7-10 d.
  8. Betyg avkomma för tillväxtfenotypen i sinfunginläkemedel. Observera monoskiktet under ett inverterat faskontrastmikroskop och värdera 0 för ingen tillväxt (sinfuskinkänslig), poäng 1 för tillväxt och lys av monolag (motståndskraft mot sinus).
    OBS: Se protokoll 1.8 Anmärkning i kompletterande fil 1 .

2. REn QTL-skanning av SNF r- fenotypen i R / qtl

OBS! Se protokoll 2 Anmärkning i kompletterande fil 1 .

  1. Installera programvaruspråket R på en lokal dator. Se 27 .
  2. Kör R och installera paketet 'qtl'. Endera gör det från alternativet R GUI-gränssnittet 'Paket-> Installera paket (er)', eller kör följande kommando från R-kommandoraden (den första symbolen ">" i varje exempel anger början på ett kommando, inte att vara kopieras):
    > install.packages ( "qtl")
    OBS! När R och "qtl" -paketet har installerats, finns det två sätt att köra R / qtl, från R-kommandoraden eller med ett grafiskt användargränssnitt som kallas J / qtl 28 : se 29 för att ladda ner J / QTL. Detta protokoll kommer att tillhandahålla kommandoradssyntaxen R / qtl med enstaka hänvisning till ekvivalentfunktionen i J / qtl.
  3. Ladda paketet "qtl":
    > Bibliotek (qtl)
    OBS! Se protokoll 2.3 Anmärkning i kompletterande fil 1 för datasetformat och nedladdningar.
  4. Ladda datasetfilen till R / qtl.
    1. För "csv" -format (Se: Datafil 1):
      > SNFR <- read.cross (format = "csv", fil = "$ PATH / Rqtl-SNFR.csv", genotyper = c ("0", "1"), na.strings = c ("-") , ConvertXdata = FALSE)
    2. Eller för "gary" format (Se: Data File 2):
      > SNFR <- read.cross (format = "gary", dir = "$ PATH", chridfile = "chrid.txt", mnamesfile = "mname.txt", mapfile = "markerpos.txt", genfile = "genotype. Txt ", phefile =" phenos.txt ", pnamesfile =" phenonames.txt ", convertXdata = FALSE)
      Där $ PATH är katalogvägen till filen / filerna som innehåller qtl-datasetet. Till exempel: / Användare / HotDiggityDog / QTLfiles
      OBS: Filerna kan också laddasEd till J / qtl med tidigare kommandon med alternativet "Infoga kommentar eller kommando" eller ladda data med GUI-filen "File-> Load Cross Data".
  5. Beräkna sannolikheter för kartan:
    > SNFR <- calc.genoprob (SNFR, steg = 2.0, off.end = 0.0, error.prob = 1.0E-4, map.function = "haldane", stepwidth = "fixed")
  6. Kör en enkelskanning med en binär fördelning av sinfunginresistensfenotypen över alla kromosomer:
    > SNFR.scan <- scanone (cross = SNFR, chr = c ("Ia", "Ib", "II", "III", "IV", "V", "VI", "VIIa", "VIIb "," VIII "," IX "," X "," XI "," XII "), feno.col = c (1), modell =" binär ", metod =" em ")
    OBS! Om du kör VIR-fenotypen använder du alternativet "model =" normal ".
  7. Kör 1000 permutationer för att beräkna signifikans tröskelvärden och sedan attrIbute permutationerna till SNFR.scan-variabeln:
    > SNFR.scan.permutations <- scanone (cross = SNFR, chr = c ("Ia", "Ib", "II", "III", "IV", "V", "VI", "VIIa" "VII", "VIII", "IX", "X", "XI", "XII"), feno.col = c (1), modell = "binär", metod = "em", n.perm = 1000, perm.Xsp = FALSE, verbose = FALSE)
    > Attr (SNFR.scan, "pheno.col") <- c (1)
    OBS! Steg 2,5 till 2,7 kan köras i J / qtl med "Analys-> Huvudskanning-> Kör en QTL Genome Scan" -alternativ.
  8. Plottar skanningsresultaten:
    > Plot (SNFR.scan, gap = 0, bandcol = "grå")
    OBS: Plottet som produceras i J / qtl är interaktivt.
    1. Plotta skanningsresultaten för bara kromosom IX, kromosomen med högsta toppen:
      > Plot (SNFR.scan, chr = c ("IX"), gap = 0, bandcol = "grå", show.marker.names = TRUE)
    2. Visa alla markörpositioner och LOD-poäng från enkelsökningen:
      > SNFR.scan
    3. Visa tröskelresultatet av permutationstestet:
      > Översikt (SNFR.scan.permutations)
    4. Visa endast de markörer som är större än tröskelvärdet alpha = .05 (taget från föregående utgång):
      > SNFR.scan [SNFR.scan $ lod> 2,68,]
    5. Visa markörerna med högsta LOD-poäng på varje kromosom:
      > Sammanfattning (SNFR.scan)
    6. Visa de markörer som har det högsta LOD-värdet (taget från föregående utgång):
      > SNFR.scan [SNFR.scan $ lod> = 6,57,]
      OBS: Se protokoll 2.13 Anmärkning i kompletterande fil 1 .

    3. Identifiera orsakssamfundet SNF r Mutation med WGS Läs från avkomman

    OBS! Se protokoll 3 Anmärkning i kompletterande fil 1 .

    1. Justera WGS läser av enskilt avkomma till den senfungin-känsliga VANDEN(VAND-SNF s ) föräldragenomet.
      OBS: Hämta VAND-referensgenomet (SNF s ) från NCBI Assembly AEYJ00000000.2 och WGS läser (.sra-filer) för 24 avkomma från NCBI SRA PRJNA258152. Ladda ner även följande program: Bowtie2 11 , NCBI SRA Toolkit, SAMtools 30 , VarScan 12 och MUMMER 31 .
      1. Skapa ett Bowtie 2-kompatibelt index från VAND-referensgenomet FASTA-filen med hjälp av bowtie2-build-programmet, här namnet indexet "VAND":
        > Bowtie2-build GCA_000224845.2_TGVAND_v2_genomic.fna VAND
      2. Konvertera SRA-formaterade WGS-läsfiler till FASTQ-filer med snabbkodning med alternativet --split-filer för parade läsningar (filen SRR1555372.sra för avkomma P1_14VB kommer att användas som exempel):
        > Fastq-dump -split-filer SRR1555372.sra
        OBS! Kör detta och alla följande kommandon i protokoll 3.1 för alla 24avkomma.
      3. Justera WGS läser till referensgenomet med hjälp av bowtie2 med utgång till en SAM (.sam) -fil och alternativet -end-to-end:
        > Bowtie2 -x VAND -1 SRR155372_1.fastq -2 SRR1555372_2.fastq -S SRR155372.sam - ända till slutet
      4. Konvertera .sam-filen till en BAM-fil (.bam):
        > Samtools visa -bS SRR155372.sam> SRR155372.bam
      5. Sortera .bam-filen:
        > Samtools sort SRR155372.bam SRR155372.sort
      6. Indexera den sorterade .bam-filen:
        > Samtools index SRR155372.sort.bam
    2. Ring SNP för avkomman med VarScan
      OBS: Se protokoll 3.2 Anmärkning i kompletterande fil 1 .
      1. Konvertera alla indexerade BAM-filer (.sort.bam) till en pileupformaterad fil med samtools mpileup med referensfilen VAND genom, alla avkommor .sort.bam-filer och mata ut till en fil med namnet AllProgeny-mpileup.txt:
        > Samtools mpileup -f GCA_000224845.2_TGVAND_v2_genomic.fna SRR1555599.Sort.bam SRR1555372.sort.bam SRR1555660.sort.bam SRR1555672.sort.bam SRR1556052.sort.bam SRR1556122.sort.bam SRR1556192.sort.bam SRR1556194.sort.bam SRR1556195.sort.bam SRR1556199.sort.bam SRR1556200. Sort.bam SRR1556202.sort.bam SRR1556203.sort.bam SRR1556274.sort.bam SRR1556276.sort.bam SRR1556278.sort.bam SRR1556395.sort.bam SRR1556396.sort.bam SRR1556397.sort.bam SRR1556398.sort.bam SRR1556399. Sort.bam SRR1556400.sort.bam SRR1556401.sort.bam SRR1556402.sort.bam> AllProgeny-mpileup.txt
      2. Ring alla SNPs med programmet VarScan mpileup2snp med filen AllProgeny-mpileup.txt, läsavläsning av 5, minsta variantfrekvens över läser av .8, ett p-värde av .01 och utmatning till filnamn AllProgeny-SNPs. Text:
        > Java -jar VarScan.jar mpileup2snp AllProgeny-mpileup.txt --min-täckning 5 --min-var-freq .8 --p-värde .01> AllProgeny-SNPs.txt
        OBS! AllProgeny-SNPs.txt-filen är en flikavgränsad textfil som används i protokoll 3.4 för att lokaliseraKausal SNP.
    3. Hitta VAND-genomkoordinater som motsvarar koordinaterna för ME49-baserade QTL-locus
      OBS! Se protokoll 3.3 Anmärkning i kompletterande fil 1 .
      1. Använd MUMmer nucmer-programmet för att anpassa ME49-genomet (tillgängligt för nedladdning från ToxoDB.org 32 ) och VAND-referensgenomfilen (utdata går till filen out.delta):
        > Nucmer ToxoDB-28_TgondiiME49_Genome.fasta GCA_000224845.2_TGVAND_v2_genomic.fna
      2. Använd programmet MUMMER show-coords för att få koordinaterna för de två genominriktningarna, utdata till en fil med namnet ME49vsVAND-coords.txt:
        > Show-coords out.delta> ME49vsVAND-coords.txt
        OBS: Filen ME49vsVAND-coords.txt kan användas för att hitta VAND contigs och positioner som motsvarar QTL-locus; Markörer MV359 till MV366 belägen på ME49 kromosom IX mellan 3,187,537 till 4,202,258 bp. Det finns två VAND contigs som spänner över motsvarighetenOnding QTL locus; KN044604.1: 657.441-1 bp och KN042501.1: 430.910-41.870 bp (båda contigsjusteras bakåt till ME49-kromosomen).
    4. Bedöm avkomma SNPs placerade inom QTL-locus för SNP som ärvade endast i SNF r- avkomman
      OBS! Se protokoll 3.4 Anmärkning i kompletterande fil 1 .
      1. Granska datafil 3 för att identifiera orsaksmutationen lokaliserad inom QTL-locus. Skanna data för ett mönster där SNF r- avkomman har en SNP och SNF s inte (möjlig för att avkomma SNPs erhölls i jämförelse med referensgenomet för VAND-SNF s ). Detta bör endast resultera i ett läge med detta mönster, position 348130 på VAND contig KN042501.1.
      2. Se rad 6604 i datafil 3 ( figur 3 ).
        OBS: Se protokoll 3.4.2 Anmärkning i kompletterande fil 1 .

    4. Verifiering av identifierade träffar av CRISPR / Cas9-Medierad geninaktivering.

    ANMÄRKNING: För att bekräfta det kausal SNP som identifierats genom QTL-kartläggning och WGS SNP-analys, måste motsvarande genetiska förändringar göras i en WT SNFs bakgrund och den resulterande fenotypen som undersöks. I fallet med sinfunginresistens resulterar den ansvariga mutationen i inaktivering av SNRl- genen genom tidig uppsägning 2 . Därför kan störningar av SNR1 användas för bekräftelse. Här tillhandahålls ett detaljerat protokoll för användning av CRISPR / Cas9 inducerad indelmutationer för att störa SNR1 för att visa sitt engagemang i sinfunginresistens ( Figur 4 ).

    1. SNR1- specifik CRISPR-plasmidkonstruktion
      OBS! Se protokoll 4.1 Anmärkning i kompletterande fil 1 för att erhålla plasmider och kartor.
      1. Hämta den genomiska sekvensen för målgenen ( SNR1 , TGME49_290860) från ToxoDB 32 .
      2. Använd onlineverktyg som E-CRISP 33 för att designa specifika gRNAs. Ta inte med PAM-sekvensen (NGG) i gRNA.
        OBS: Se protokoll 4.1.2 Anmärkning i kompletterande fil 1 .
      3. Syntes primer för att konstruera den målspecifika CRISPR-plasmiden.
        1. Enligt konstruktionen från steg 4.1.2 syntetiserar två primrar för att ändra UPRT- målsökande gRNA i den ursprungliga CRISPR-plasmiden till den valda gRNA-sekvensen genom platsriktad mutagenes.
          OBS: Sekvenserna för dessa två primers är följande: gRNA-Fw: NNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC (N20 är den målspecifika gRNA-sekvensen) och gRNA-Rv: AACTTGACATCCCCATTTAC 2 .
      4. Utför de site-directed mutagenes reaktionerna.
        1. Användning av UPRT- inriktning på CRISPR-plasmiden (pSAG1 :: CAS9-U6 :: sgUPRT) som mall och de två primrarna som anges ovan, utför site-directed mutagenesreaktionerEnligt tillverkarens instruktioner.
          ANMÄRKNING: Använd följande cykelförhållanden för PCR: 98 ° C under 1 min, följt av 25 cykler av 98 ° C under 10 s, 55 ° C i 30 s och 72 ° C i 5 min, följt av slutlig förlängning under 2 min Vid 72 ° C.
      5. Transformera mutagenesprodukterna som innehåller de GOI-specifika CRISPR-plasmiderna till E. coli- kompetenta celler genom kemisk transformation enligt leverantörens protokoll (se tabeller över material ). Växa transformanterna på lysogen-buljong (LB) -plattor innehållande ampicillin (100 | ig / ml) vid 37 ° C. Därefter väljer du 2-4 kloner och odlar dem individuellt i 5 ml LB-medium kompletterat med 100 μg / ml ampicillin i 12-16 timmar.
        1. Extrahera plasmider från kulturerna med hjälp av ett DNA-isoleringskit och analysera dem genom DNA-gelelektrofores för att kontrollera storleken av plasmiderna (förväntad plasmidstorlek är 9674 bp, använd den ursprungliga CRISPR-plasmiden som cKONTROLL). Använd M13-Rev-primern (5'-CAGGAAACAGCTATGACC) för att sekvensera plasmiderna för att bekräfta den målspecifika gRNA-sekvensen.
          1. När väl positiva kloner identifierats, lagra båda plasmid-DNA vid -20 ° C och motsvarande bakteriekultur vid -80 ° C för framtida användning.
            OBS: CRISPR-plasmiden som ska användas för transfektion bör lösas i avjoniserat vatten och koncentrationen bestäms genom spektrofotometri eller en alternativ metod.
    2. Parasittransfektion.
      OBS: Allmänna metoder för odling av T. gondii i HFF-celler i D10-medium har beskrivits tidigare 34 .
      1. Två till tre dagar före transfektion, tillsätt tillräckligt med parasiter till en T25-kolv innehållande ett konfluent HFF-cellmonolag (0,5-1 x 106 för typ 1-stammar, 1-2 x 10 6 för andra stammar) för att uppnå 70-80% HFF-cell Lysis inom 2-3 d.
      2. ExamiNe kulturen under ett inverterat faskontrastmikroskop, när HFF-monoskiktet är 70-80% lyserat av parasiterna. Ta försiktigt bort mediet med en pipett och tvätta cellerna från flaskytan med 5 ml cytomixbuffert (120 mM KCl, 0,15 mM CaCl2, 10 mM K2HP04 / KH2P04 pH = 7,6, 25 mM HEPES, 2 MM EDTA, 5 mM MgCl2, pH = 7,6). Därefter överför parasitlösningen till ett 15 ml koniskt rör.
        OBS: Se protokoll 4.2.2 Anmärkning i kompletterande fil 1 .
      3. Passera parasitlösningen genom en 10 ml spruta / 22 G trubbig nål 2-3x.
      4. Filtrera parasitlösningen i ett nytt koniskt rör genom ett membran med porstorlek på 3 μm för att avlägsna HFF-celler och cellulära skräp.
      5. Pellera de filtrerade parasiterna genom centrifugering vid 400 xg under 10 minuter.
      6. Häll av supernatanten och resuspendera de pelleterade parasiterna med 10 ml cytomixbuffert, ta en 10 μl alikvot till detHämma parasitkoncentrationen med en hemocytometer och pellets resten genom centrifugering vid 400 x g under 10 min.
      7. Ta bort supernatanten och resuspendera pelleten i cytomixbuffert för att erhålla en densitet av 4 x 107 parasiter / ml.
      8. Blanda 250-300 μL parasitlösning (1-1,3 x 10 7 parasiter) med 7,5 μg CRISPR-plasmid, 6 μL ATP (100 mM) och 6 μL glutation (GSH) (250 mM) i en kuvett med 4 mm gap.
      9. Elektroporera parasiterna 35 . Inkludera en separat elektroporation som en negativ kontroll, i vilken en CRISPR-plasmid är riktad någon annanstans, såsom UPRT- målsökande CRIPSR-plasmid.
        OBS! Elektroporationsinställningarna är beroende av enheten. För elektroporatorn som anges i Materialen använd 4 mm gapskuvetter. Följande protokoll rekommenderas: 1.700 V, 176 μs pulslängd, 2 pulser med 100 ms intervall.
    3. Bestäm frekvensen hos sinfina resistaNce efter CRISPR-inriktning.
      1. Frö HFF-celler till täckglas placeras i 24-brunnsplattor 3-4 d före elektroporering så att de är sammanflöde vid tiden för transfektion i 4.2.
        1. Trypsinera HFF-cellerna från en konfluent T25-kolv och tillsätt därefter 12 ml D10-medium och blanda väl.
        2. Lägg en täckglas på varje brunn i en brunn med 24 brunnar och alikvot 500 μL HFF-celllösning till varje brunn. Inkubera plattan vid 37 ° C i 3 4 d för att låta cellerna växa tills de är sammanflöde.
          OBS! Celler från en T25-kolv är tillräckliga för att frö en 24-brunnsplatta.
        3. Tillsätt 50 μL elektroporerad parasitlösning från steg 4.2.9 i en brunn i en brunn med 24 brunnar innehållande en täckplåst sådd med sammanflytande HFF-celler. Överför resten av elektroporerad parasitlösning till en T25-kolv sålad med sammanflytande HFF-celler.
      2. Bedöm effektiviteten vid transfektion.
        1. Växa cellerna i 24-brunnsplattan i 24 timmarOch fixera sedan cellerna (värdceller och parasiter) med 500 μl 4% formaldehyd för att kontrollera uttrycket av Cas9-GFP genom immunofluorescerande analys (IFA).
        2. Probe cellerna med en anti-GFP antikropp och en Toxoplasma specifik antikropp (som anti-TgALD) för att märka totala parasiter. Se antikroppsbladet för den rekommenderade utspädningen (vanligtvis är 1: 1000 tillräcklig för IFA). Om antikropparna är okonjugerade, använd två olika sekundära antikroppar konjugerade med fluorescerande färgämnen för att märka de primära antikropparna.
        3. Observera de märkta cellerna på ett fluorescerande mikroskop med filter som är lämpliga för de sekundära fluorescerande färgämnena. Få transfektionseffektivitet genom att dividera antalet GFP-positiva parasiter med antalet totala parasiter.
          OBS: De två antikropparna som används för IFA bör komma från två olika värdarter, till exempel med kombinationen av anti-GFP och kanin anti-TgALD.
      3. Bestäm fKrav på sinfunginresistens hos transfekterade parasiter.
        1. För de transfekterade parasiterna som odlas i T25-kolvarna, odla dem i 2-3 d tills det kommer naturlig utstrålning. Därefter samlar parasiterna, stumma nålens lysa värdceller för att släppa intracellulära parasiter och rena dem genom filtrering genom membran med porstorlek på 3 μm. Räkna parasiterna med en hemocytometer för att uppskatta densiteten.
        2. Lägg till renade parasiter i 6-brunnsplattor fröna med sammanflytande HFF-celler: För den första raden (3 brunnar) tillsätt 200 parasiter / brunn och odla dem i vanligt D10-medium (2 ml / brunn); För den andra raden, lägg till 5000 parasiter / brunn och odla dem i D10-medium innehållande 0,3 μM sinfungin.
        3. Placera tallrikarna i en 5% CO2-inkubator och odla parasiterna vid 37 ° C 8-10 d utan störning så att plack bildas. Lös proverna med 70% etanol (2 ml / brunn) och fläcka monoskiktet med 0,1% kristallviolett (2 ml / brunn). Tvätta brunnarna med vatten för att visualiseraPlackarna (klara zoner) som bildas av parasittillväxt.
          OBS: Den negativa kontrollen bör behandlas på samma sätt sida vid sida.
      4. Beräkna hastigheten för CRISPR-inducerad sinfunginresistens.
        1. Hämta det genomsnittliga antalet (X) av plack från brunnar som inte innehåller något läkemedel och beräkna parasitlivabiliteten som X / 200. Hämta medelvärdet (Y) av plack från brunnar innehållande sinfungin för att beräkna graden av CRISPR-inducerad sinfunginresistens enligt följande:
          Ränta för CRISPR-inducerat motstånd = 200 x Y / (5000 x X x transfektionseffektivitet)
          OBS: Transfektionseffektivitet erhålls från 4.3.2.
    4. Undersök de indelmutationer som induceras av CRISPR / Cas9
      1. Växa de elektroporerade parasiterna från avsnitt 4.2.9 i en T25-kolv sålad med HFF-celler i 2 d vid 37 ° C. Därefter ersätt mediet med 5 ml D10-medium innehållande 0,3 μM sinfungin (selektionsmedium).
        1. Håll parasiterna i urvalsmedium i minst 3 passager tills den resistenta poolen blir stabil (indikerad genom frånvaro av parasittillväxt i den negativa kontrollgruppen, men robust parasittillväxt i försöksgruppen).
      2. Subklon den senfunginresistenta poolen för erhållande av klonstammar.
        1. Samla nyutrustade parasiter, rena genom 3 μm membranfiltrering och subklon i 96-brunnsplattor utsöndrade med sammanflytande HFF-celler i 150 pl D10-medium. Växa subkloningskulturerna i en CO2-inkubator vid 37 ° C i 7 - 10 d utan att störa plattorna.
          OBS! Se protokoll 4.4.2.1 Anmärkning i S kompletterande fil 1 .
      3. Kontrollera plattorna med 96 brunnar under ett inverterat faskontrastmikroskop för att leta efter brunnar som bara innehåller en plack. Markera sådana brunnar och överför sedan cellerna från varje brunn till 24-brunnsplattor utsatta med HFF-celler med användning av en pipett.
      4. <Li> När 80-90% av HFF-cellerna i en brunn lyseras, skörda parasiterna (ca 500 μl) och passera 50 μL parasitlösning till en ny brunn för att bibehålla stammen. Använd resten (≈ 450 μL) för att extrahera genomiskt DNA för PCR-amplifiering.
        1. För genomisk DNA-isolering från SNF r- klonen är parasiterna (små mängder av HFF-cellföroreningar tolererbara) vid 1000 xg under 10 min. Tvätta de pelleterade parasiterna med fosfatbuffrad saltlösning (PBS) en gång och pelleten dem igen. Isolera genomiskt DNA från pelleterade celler med användning av ett kommersiellt kit eller genom kokning. Resuspendera parasiter i 50-100 μl PBS.
          OBS: Utför PCR för att erhålla ett fragment av SNR1- genen för sekvensering. Använd följande primers för att amplifiera SNRl-locus 2 : SNR1-Amp-Fw: 5 'CCGACCACAA CAATTTTC och SNR1-Amp-Rv: 5'GACGTGATTCACTTTTTTACAGACAGAC. Använd högfidelitets DNA-polymeraser. Förstärka WT-locus för kontrolländamål.
      5. Utför tHan PCR med 20 | il reaktionsvolym och kör den med följande program: 98 ° C i 1 min, följt av 30 cykler av 98 ° C under 10 s, 55 ° C i 30 s och 72 ° C i 2,5 min, följt av Slutlig förlängning under 2 min vid 72 ° C.
        OBS: Sequence PCR-produkterna med följande primers: SNR1-Seq1: 5 'GCC ACA TGC TTT AGC GTG, SNR1-Seq2: 5' TCC TCT CCA TCA CGG GTT GG, SNR1-Seq3: 5 'GCA AGA GCC GCG TGA CG , SNRl-Seq4: 5 'CTC TCC CGC GGT CGA G, SNRl-Seq5: 5' GCA CCG TCC GCA AGC och SNR1-Seq6: 5 'CCG GAA GGT GAA TCG TTC TTC.
      6. Jämför sekvenserna av SNR1- gen från senfunginresistenta mutanter till den hos WT-stammen med hjälp av ett sekvensjusteringsverktyg.
        OBS! Se kompletterande fil 2 protokoll 5 för detaljer om användningen av negativt urval på SNR1- locus för genetisk komplementering eller transgen belastning.

Representative Results

Denna artikel beskriver i detalj flera metoder som kan användas i följd för att identifiera en gen som är ansvarig för läkemedelsresistens ( Figur 1 ). De 24 avkommorna från ME49-FUDR r X VAND-SNF r- korset utvärderades för resistens mot läkemedelssinfungin som beskrivs i protokoll 1. Med användning av den genetiska kartan och SNF r- fenotypen från avkomman kördes en QTL-scan i R / Qtl - protokoll 2 ( figur 2 ). Detta resulterade i en signifikant topp på kromosom IX som spände ungefär 1 Mbp. Det är i denna region som orsaksmutationen ligger.

För att identifiera orsakssamlingen, läser WGS från avkomman som anpassades till VAND-SNFs referensgenomet med användning av Bowtie2 - Protocol 3.1, kallades SNPs med användning av VarScan mpileup2snp - protokoll 3.2 och QTL-locuset i VAND-genomet identifierades med användning av MUMmer - ProtocOl 3.3. Avkomma SNPs i QTL-locuset extraherades och skannades för ett mönster där SNF r- avkomman har en SNP och SNFs inte, vilket är genomförbart för att avkomma SNPs erhölls genom jämförelse med referensgenomet för VAND-SNF ( Figur 3 ) . Endast en SNP matchade detta mönster som resulterar i ett tidigt stoppkodon i en förmodad aminosyratransportgen som heter SNR1 .

Bekräftelse att SNR1 är SNF r- resistensgenen utfördes med användning av CRISPR / Cas9-systemet. En ny CRISPR / Cas9-plasmid konstruerad för T. gondii -genredigering gjordes innehållande en gRNA som riktar sig mot SNRl- genen nära SNF- r- mutationen identifierad i avkomman - protokoll 4 ( figur 4A ). Den SNRl- riktade CRISPR / Cas9-plasmiden elektroporerades till en SNFs-WT-parasitstam och resistenta mutanter erhölls när kultHärdad i 0,3 μM sinfungin. Inga SNF r- parasiter erhölls när elektroporerade med UPRT-riktade CRISPR / Cas9-plasmiden. Flera SNF r CRISPR-mutanter klonades och regionen kring SNRl- gRNA-målet sekvenserades. Varje mutant hade en indel som störde den kodande sekvensen av SNRl- genen ( Figur 4B ). Denna metod kan också användas för att infoga en målkonstruktion i SNR1- locus via NHEJ ( Figur 5) eller genom HR ( Figur 6 ) - Kompletterande fil 2 .

Figur 1
Figur 1: Schematiskt arbetsflöde för experiment som skisseras i protokollen. Huvudstegen för att identifiera och bekräfta SNF r- genen med hjälp av ME49-FUDR r X VAND-SNF r- korset visas med hänvisning till lämpliga protokoll som anges i tHans artikel. Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: R / qtl Kommandon för att köra QTL-skanning på SNF r- fenotypen. Kommandon som beskrivs i protokoll 2 kördes i R med hjälp av qtl-paketet. Representativa kommandon och plot visas. Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Plats för orsakssnabb SNP. Avkomma WGS läser var inriktad på VAND-SNF s referensgenomet med Bowtie 2, SNPs heter med VarScan och motsvarande Ing VAND QTL locus identifierad med MUMmer. SNP: er placerade inom QTL-locus importerades till ett kalkylblad och kausala SNP identifierades. SNF r avkomma (gul), SNF s avkomma (grön), SNF r SNP (röd) (se datafil 3 ). Vänligen klicka här för att se en större version av denna figur.

Figur 4
Figur 4: Bekräftar SNR1 som SNF-gen genom att använda CRISPR / Cas9. ( A ) CRISPR / Cas9 inducerad indelmutationer (grön) i SNRl- locus. ( B ) Representativa indeler i SNR1 orsakad av två olika SNR1- specifika CRISPR-plasmider (C5 respektive C6). RH är WT-stammen och C5 och C6 är SNF- r- mutanter. (B är hämtad från referensS = "xref"> 2). Vänligen klicka här för att se en större version av denna figur.

Figur 5
Figur 5. Insertions-mutagenes med användning av CRISPR / Cas9. ( A ) Infogning av komplementära eller transgena gener i SNRl- stället genom CRISPR / Cas9-medierad platsspecifik integration. Två möjliga orienteringar av den infogade DHFR * -mingenen och de primers som användes för identifiering, F1 / 2 och R1 / 2 representerar primerställena för oligos som används i diagnostiska PCR. ( B ) Diagnostiska PCR av en snr1 :: DHFR * klon, RH används som en WT-kontroll. PCR av GRA1p ingår som en kontroll som kontrollerar kvaliteten på genomiskt DNA som mallar. Asterisker anger banor med ospecificerade band (Figur 5B är hämtad från referensCe 2 ). Vänligen klicka här för att se en större version av denna figur.

Figur 6
Figur 6: Gene Knockout med CRISPR / Cas9. En klassisk design för CRISPR / Cas9-medierad homolog genutbyte i T. gondii . Orienteringen av införd transgen är fixerad i detta fall. F1 / R1, F2 / R2 och F3 / R3 representerar primerställena för oligos som används i diagnostiska PCR. Vänligen klicka här för att se en större version av denna figur.

Datafil 1: ME49-FUDR r X VAND-SNF r Korsfil fEller använd i R / qtl, "csv" Format. En .csv-fil som kan laddas in i R / qtl med formatet = "csv". Vänligen klicka här för att ladda ner den här filen.

Datafil 2: (chrid txt, genotype txt, markerpos.txt, mname.txt, phenonames.txt och phenos.txt). ME49-FUDR r X VAND-SNF r Korsfiler för användning i R / qtl, "gary" Format. Sex .txt-filer som kan laddas i R / qtl med formatet = "gary". Vänligen klicka här för att ladda ner den här filen.

Datafil 3. Kalkylark med avkomma SNP över SNF r Vänligen klicka här för att ladda ner den här filen.

Kompletterande fil 1: Ytterligare protokolldetaljer. Vänligen klicka här för att ladda ner den här filen.

Kompletterande fil 2: Protokoll 5 - Användning av negativt urval på SNR1-platsen för genetisk komplementering eller transgenisk stamkonstruktion. Vänligen klicka här för att ladda ner den här filen.

Discussion

Dessa protokoll presenterar flera metoder som vid kombination tillåter identifiering av en läkemedelsresistensgen i T. gondii . Två i synnerhet var integrerade i projektet, den relativt erfarna metoden för QTL-kartläggning och den nyligen utvecklade metoden för CRISPR / Cas9-genredigering. Lander och Botstein publicerade sitt inflytelserika papper 1989 och demonstrerade QTL-kartläggning som korrelerar genetiska loci med fenotyper 36 . Senast 2012 beskriver Dounda och Charpentier CRISPR / Cas9-editeringssystemet i Streptococcus pyogenes 22 som snabbt anpassades som ett genetiskt verktyg i många olika modeller, inklusive T. gondii 13 , 17 . Båda metoderna var användbara här, där QTL-kartläggning definierade locus som innehöll läkemedelsresistensmutationen som slutligen identifierades med användning av WGS-baserad SNP-detektering och CRISPR / Cas9-redigering gav mig Ans för att bekräfta SNR1 är den genfinnande narkotikaresistensgenen.

ME49-FUDR r X VAND-SNF r- korset 8 ursprungligen utvecklades för att förhöra en virulensfenotyp 19 , men föräldrastammarna råkade också ha en ytterligare fenotypisk skillnad för vilken kausala genen inte var känd, sinus-motstånd i VAND-föräldern. Detta belyser en fördel med kors genom att de kan återställas när ytterligare fenotypiska skillnader i föräldrarna observeras. Detta var fallet för ett annat Toxoplasma- kors, typ 2 x typ 3, där flera gener inblandade i virulens hittades genom att kartlägga flera fenotyper 37 , 38 , 39 , 40 . Hittills har fyra olika T. gondii- kors beskrivits och används för att kartlägga gener som är ansvariga för fenotyperSs = "xref"> 8 , 37 , 41 , 42 , som alla har potential att återanvändas för att kartlägga nya fenotyper för vilka den genetiska grunden är okänd. Längs dessa linjer har genomerna för 62 T. gondii- stammar som representerar den kända globala genetiska mångfalden sekvenserats 43 . Nya kors kan göras från denna pool för stammar som skiljer sig åt intressanta fenotyper. Efter att ha framhävt fördelarna med QTL-kartläggning måste det sägas att generering av ett kors inte är ett mindre företag. Det finns andra metoder som kan användas för att identifiera orsakssgener. En kraftfull teknik använder kemisk mutagenes för att skapa mutanter som kan screenas för fenotyper. För att hitta orsakssgenen kan mutanter antingen kompletteras med kosmidbibliotek 44 eller genomreekventeringsmetoder kan användas för att hitta orsaksmutationen 45 . För moRe på detta, se två JoVE artiklar av Coleman et al. Och Walwyn et al. Som beskriver dessa tillvägagångssätt 46 , 47 .

Många av stegen som leder till identifieringen av den kausal SNF r- mutationen (protokoll 2 och 3) är beroende av beräkningsmetoder som utförs med programvara som är fritt tillgänglig för akademisk användning. Detaljerade kommandon för varje steg tillhandahålls och när körning med de korrekta filerna tillåter användaren att återskapa de dataset som är nödvändiga för att hitta orsakssystemet SNF r SNP. Tänk på att en del av syntaxen i kommandona hänvisar till filnamn eller katalogstruktur ($ PATH) som kan ändras till användarinställningen. Även om de kommandon som ges här helt enkelt inte utesluter hur man kan analysera ett kors med QTL-analys och WGS-baserad SNP-identifiering, är de tillräckligt omfattande för att upprepa experimentet som beskrivs i denna artikel och borde tillåta användaren att bli m Malm som är bekant med hur dessa metoder utnyttjas stegvis.

Fastän QTL-kartläggning och WGS-sekvensbaserad SNP-detektion var tillräcklig för att identifiera en kandidat SNF- r- gen behövs ytterligare experiment för att bekräfta sin roll i läkemedelsresistens. Detta kan övertygande visas genom genavbrott eller knockout-tekniker, vilka båda kan uppnås genom att använda CRISPR / Cas9 genredigering. Detaljerade metoder för att använda CRISPR / Cas9 för att antingen generera indelmutationer eller införa transgena konstruktioner i en målgen i T. gondii ges. Den målspecifikitet som CRISPR / Cas9 tillhandahåller ökar effektiviteten hos genredigeringen över traditionella metoder. Dessutom har denna ökning effektivt gjort det möjligt att använda icke-laboratorieanpassade stammar för genetiska studier som tidigare var svåra att modifiera 13 . Även om CRISPR / Cas9 redan i sin linda har använts för att göra genstörningarLass = "xref"> 2 , 13 , 17 , 18 , 48 , 49 , taggen gener 17 och gör genutslag 16 , 19 , 50 , 51 , 52 , 53 , 54 i T. gondii , lovande att vara ett användbart verktyg För många andra studier i framtiden.

Upptäckten att SNR1- inaktivering leder till sinfuskresistens gör SNR1- locus till en lovande plats för transgeninsättning eller genetisk komplementering. För att maximera framgången med att använda CRISPR / Cas9-medierad geninriktning för att styra integrationen av transgen i SNRl- locuset, bör följande aspekter beaktasRöd under experimentell design. Först rekommenderas en selektionsmarkör att inkluderas i den transgena konstruktionen för att öka effektiviteten av belastningskonstruktionen. Om en markeringsmarkör ingår, kan både positivt och negativt urval användas, vilket resulterar i att nästan 100% av de dubbelt valda parasiterna är transgena med GOI integrerad på SNR1- locus. Om däremot den transgena konstruktionen inte innehåller ytterligare selekterbara egenskaper och bygger på negativt urval vid SNRl- locus, beror effektiviteten av framgångsrik transgenes i stor utsträckning på effektiviteten av samtransfektion av CRISPR-plasmiden och den transgena konstruktionen.

För det andra, även om CRISPR / Cas9-medierad platsspecifik integration av ett icke-homologt DNA-fragment ofta användes för komplementering och transgenes bör det noteras att orienteringen av införandet inte kan garanteras i sådana fall som någon riktning är möjlig. Detta kan orsaka problemMs till vissa applikationer. Till exempel, för att komplementera en mutant med olika gen alleler är det svårt att säkerställa att alla alleler sätts in i samma orientering, och avvikelser i orientering kan orsaka expressionsskillnader. För denna typ av applikation rekommenderas DNA-konstruktioner med sekvenser som är homologa med SNRl- locuset, vilket kommer att driva den korrekta integrationsorienteringen ( Figur 6 ).

För det tredje är förhållandet mellan CRISPR-plasmiden och den transgena DNA-molekylen kritisk för framgångsrik transgenstamkonstruktion under transfektion. Detta förhållande måste anpassas enligt urvalsstrategierna. Följande riktlinjer rekommenderas: 1) Om den transgena konstrukten innehåller en läkemedelsresistent markör och motsvarande läkemedel är det enda valet som används för att generera transgena parasiter, dvs sinfungin inte används, det föreslagna molära förhållandet mellan den transgena konstruktionen och CRISPR-plasmanId är 1: 5. Användning av mer CRISPR-plasmid i detta fall ökar sannolikheten för att parasiter som erhåller den transgena konstruktionen också kommer att erhålla CRISPR-plasmiden, därför är de läkemedelsresistenta parasiterna mer sannolikt att markören sätts in på CRISPR-målningsstället. Om förhållandet reverseras, kommer de flesta parasiter som mottar den transgena konstruktionen inte att få CRISPR-plasmiden. Som en konsekvens erhåller den stora majoriteten av läkemedelsresistenta parasiter den transgena konstruktionen genom slumpmässig integration som inte är associerad med CRISPR / CAS9-medierad platsspecifik införing. 2) Om den transgena konstruktionen innehåller en läkemedelsresistent markör och motsvarande läkemedel används tillsammans med sinfungin för att välja transgena parasiter är det föreslagna molförhållandet mellan den transgena konstruktionen och CRISPR-plasmiden 1: 1. Denna strategi ger den högsta effektiviteten av transgena stamkonstruktioner. 3) Om den transgena konstruktionen inte innehåller en valbar tillverkare, förlita sig på negativt urvalGenom sinfungin ensam för att erhålla transgena parasiter är det föreslagna molförhållandet mellan den transgena konstruktionen och CRISPR-plasmiden 5: 1. Skälen till denna design är densamma som i den första riktlinjen ovan. Eftersom både pyrimetamin och sinfungin användes för selektion i protokoll 5 sattes förhållandet mellan DHFR * mini-gen och den SNRl- riktade CRISPR-plasmiden som 1: 1.

Tillsammans har de metoder som beskrivs här en detaljnivå som inte kunde överföras i den ursprungliga publikationen som identifierade SNR1 2 . Dessa protokoll; Speciellt bör kommandoradssyntaxen, sekventiell layout av de använda programmen och användningen av CRISPR / Cas9 hjälpa framtida ansträngningar att identifiera nya gener som är ansvariga för fenotyper.

Acknowledgments

Vi vill tacka L. David Sibley och Asis Khan för deras bidrag till den ursprungliga publikationen som dessa protokoll bygger på. Detta arbete finansierades av National Institute of Health grant AI108721.

Materials

Name Company Catalog Number Comments
T25 flasks Corning 430639
Human Foreskin Fibroblasts (HFF) ATCC SCRC-1041
T. gondii ME49 strain ATCC 50840
T. gondiiVAND strain ATCC PRA-344
DMEM (No Sodium Bicarbonate) Life Sciences 12800017
Sodium Bicarbonate Sigma Aldrich S5761
HEPES Sigma Aldrich H3375
Fetal Bovine Serum (FBS) Premium Grade VWR International 97068-085
L-Glutamine  200 mM Sigma Aldrich G7513
Gentamicin (10 mg/mL) Life Technologies  15710064
Cell Scraper for Flasks VWR International 10062-904
Syringe 10 mL BD 309604
Blunt needles 22 G x 1" BRICO Products BN2210
Nuclepore Filter 3.0 µm, 25 mm GE Healthcare 110612
Swin-Lok Filter Holder 25 mm GE Healthcare 420200
Hemacytometer Propper MFG 90001
Sinefungin Enzo Life Sciences 380-070-M001
The R Foundation https://www.r-project.org/
J/qtl The Churchill Group http://churchill.jax.org/software/jqtl.shtml
Bowtie2 John Hopkins University http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
NCBI SRA Toolkit NCBI http://www.ncbi.nlm.nih.gov/Traces/sra/?view=toolkit_doc
SAMtools Wellcome Trust Sanger Institute http://www.htslib.org/
VarScan Washington University, St Louis http://varscan.sourceforge.net/
MUMmer JCVI & Univ Hamburg http://mummer.sourceforge.net/
pSAG1::CAS9-U6::sgUPRT Addgene Plasmid #54467 T. gondii CRISPR plasmid to cut the UPRT gene
pSAG1::CAS9-U6::sg290860-6 Addgene Plasmid #59855 T. gondii CRISPR plasmid to cut the TG*_290860 SNR1 gene
pUPRT::DHFR-D Addgene Plasmid #58528 Template for DHFR* mini gene
Q5 Site-Directed Mutagenesis Kit  New England Biolabs E0552S
QIAprep Spin Miniprep Kit QIAGEN 27106
NanoDrop 2000 Thermo Scientific ND-2000
LB Broth Fisher Scientific DF0446-07-5
Potassium chloride Sigma Aldrich P9541
Calcium chloride Sigma Aldrich 746495
Potassium phosphate monobasic Sigma Aldrich P9791
Potassium phosphate dibasic Sigma Aldrich P5504
EDTA Sigma Aldrich E5134
Magnesium chloride Sigma Aldrich M1028
Adenosine triposhpate (ATP) Sigma Aldrich A6419
L-glutathione (GSH) Sigma Aldrich G4251
ECM 830 Electroporation System BTX 45-0002
Electroporation Cuvette  4 mm Harvard Apparatus 45-0126
Crytal Violet Alfa Aesar B21932-14
6-well TC plate Corning 353046
24-well TC plate Corning 353935
Cover glass 12 mm round VWR International 89015-724
96-well TC plate Corning 353075
Gibson Assembly Cloning Kit (Multi-fragment) New England Biolabs E5510S
Q5 High-Fidelity Polymerase  New England Biolabs M0491S
Pyrimethamine TCI AMERICA P2037-1G Use cuation when using pyrimethamine resistant parasites - see Protocol

DOWNLOAD MATERIALS LIST

References

  1. Dubey, J. P. The history of Toxoplasma gondii--the first 100 years. J Eukaryot Microbiol. 55, (6), 467-475 (2008).
  2. Behnke, M. S., Khan, A., Sibley, L. D. Genetic Mapping Reveals that Sinefungin Resistance in Toxoplasma gondii Is Controlled by a Putative Amino Acid Transporter Locus That Can Be Used as a Negative Selectable Marker. Eukaryot Cell. 14, (2), 140-148 (2015).
  3. Dubey, J. P. History of the discovery of the life cycle of Toxoplasma gondii. Int J Parasitol. 39, (8), 877-882 (2009).
  4. Pfefferkorn, L. C., Pfefferkorn, E. R. Toxoplasma gondii: genetic recombination between drug resistant mutants. Exp Parasitol. 50, (3), 305-316 (1980).
  5. Donald, R. G., Roos, D. S. Insertional mutagenesis and marker rescue in a protozoan parasite: cloning of the uracil phosphoribosyltransferase locus from Toxoplasma gondii. Proc Natl Acad Sci U S A. 92, (12), 5749-5753 (1995).
  6. Sullivan, W. J. Jr Insertional tagging of at least two loci associated with resistance to adenine arabinoside in Toxoplasma gondii, and cloning of the adenosine kinase locus. Mol Biochem Parasitol. 103, (1), 1-14 (1999).
  7. Khan, A. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acids Res. 33, (9), 2980-2992 (2005).
  8. Khan, A. NextGen sequencing reveals short double crossovers contribute disproportionately to genetic diversity in Toxoplasma gondii. BMC Genomics. 15, (1), 1168 (2014).
  9. Shaik, J. S., Khan, A., Beverley, S. M., Sibley, L. REDHORSE-REcombination and Double crossover detection in Haploid Organisms using next-geneRation SEquencing data. BMC Genomics. 16, (1), 133 (2015).
  10. Arends, D., Prins, P., Jansen, R. C., Broman, K. W. R/qtl: high-throughput multiple QTL mapping. Bioinformatics. 26, (23), 2990-2992 (2010).
  11. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9, (4), 357-359 (2012).
  12. Koboldt, D. C. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Res. 22, (3), 568-576 (2012).
  13. Shen, B., Brown, K. M., Lee, T. D., Sibley, L. D. Efficient gene disruption in diverse strains of Toxoplasma gondii using CRISPR/CAS9. MBio. 5, (3), e01114 (2014).
  14. Fox, B. A., Ristuccia, J. G., Gigley, J. P., Bzik, D. J. Efficient gene replacements in Toxoplasma gondii strains deficient for nonhomologous end joining. Eukaryot Cell. 8, (4), 520-529 (2009).
  15. Huynh, M. H., Carruthers, V. B. Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryot Cell. 8, (4), 530-539 (2009).
  16. Wang, J. L. The Past, Present, and Future of Genetic Manipulation in Toxoplasma gondii. Trends Parasitol. (2016).
  17. Sidik, S. M., Hackett, C. G., Tran, F., Westwood, N. J., Lourido, S. Efficient genome engineering of Toxoplasma gondii using CRISPR/Cas9. PLoS One. 9, (6), e100450 (2014).
  18. Sugi, T., Kato, K., Weiss, L. M. An improved method for introducing site-directed point mutation into the Toxoplasma gondii genome using CRISPR/Cas9. Parasitol Int. (2016).
  19. Behnke, M. S. Rhoptry Proteins ROP5 and ROP18 Are Major Murine Virulence Factors in Genetically Divergent South American Strains of Toxoplasma gondii. PLoS Genet. 11, (8), e1005434 (2015).
  20. Barrangou, R. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 315, (5819), 1709-1712 (2007).
  21. Garneau, J. E. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature. 468, 67-71 (2010).
  22. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  23. Cong, L. Multiplex genome engineering using CRISPR/Cas systems. Science. 339, (6121), 819-823 (2013).
  24. Mali, P. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  25. Jiang, F., Zhou, K., Ma, L., Gressel, S., Doudna, J. A. STRUCTURAL BIOLOGY. A Cas9-guide RNA complex preorganized for target DNA recognition. Science. 348, (6242), 1477-1481 (2015).
  26. Nishimasu, H. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  27. The R Project for Statistical Computing. Available from: https://www.r-project.org (2016).
  28. Smith, R., Sheppard, K., DiPetrillo, K., Churchill, G. Quantitative trait locus analysis using J/qtl. Methods Mol Biol. 573, 175-188 (2009).
  29. The Churchill Group. J/qtl. http://churchill.jax.org/software/jqtl.shtml (2013).
  30. Li, H. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  31. Kurtz, S. Versatile and open software for comparing large genomes. Genome Biol. 5, (2), (2004).
  32. Gajria, B. ToxoDB: an integrated Toxoplasma gondii database resource. Nucleic Acids Res. 36, (Database issue), D553-D556 (2008).
  33. Heigwer, F., Kerr, G., Boutros, M. E-CRISP: fast CRISPR target site identification. Nat Methods. 11, (2), 122-123 (2014).
  34. Roos, D. S. Molecular genetic tools for the identification and analysis of drug targets in Toxoplasma gondii. Curr Top Microbiol Immunol. 219, 247-259 (1996).
  35. Soldati, D., Boothroyd, J. C. Transient transfection and expression in the obligate intracellular parasite Toxoplasma gondii. Science. 260, (5106), 349-352 (1993).
  36. Lander, E. S., Botstein, D. Mapping mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics. 121, (1), 185-199 (1989).
  37. Saeij, J. P. Polymorphic secreted kinases are key virulence factors in toxoplasmosis. Science. 314, (5806), 1780-1783 (2006).
  38. Saeij, J. P. Toxoplasma co-opts host gene expression by injection of a polymorphic kinase homologue. Nature. 445, (7125), 324-327 (2007).
  39. Rosowski, E. E. Strain-specific activation of the NF-kappaB pathway by GRA15, a novel Toxoplasma gondii dense granule protein. J Exp Med. 208, (1), 195-212 (2011).
  40. Reese, M. L., Zeiner, G. M., Saeij, J. P., Boothroyd, J. C., Boyle, J. P. Polymorphic family of injected pseudokinases is paramount in Toxoplasma virulence. Proc Natl Acad Sci U S A. 108, (23), 9625-9630 (2011).
  41. Taylor, S. A secreted serine-threonine kinase determines virulence in the eukaryotic pathogen Toxoplasma gondii. Science. 314, (5806), 1776-1780 (2006).
  42. Behnke, M. S. Virulence differences in Toxoplasma mediated by amplification of a family of polymorphic pseudokinases. Proc Natl Acad Sci U S A. 108, (23), 9631-9636 (2011).
  43. Lorenzi, H. Local admixture of amplified and diversified secreted pathogenesis determinants shapes mosaic Toxoplasma gondii genomes. Nat Commun. 7, 10147 (2016).
  44. Gubbels, M. J. Forward genetic analysis of the apicomplexan cell division cycle in Toxoplasma gondii. PLoS Pathog. 4, (2), e36 (2008).
  45. Farrell, A. A DOC2 protein identified by mutational profiling is essential for apicomplexan parasite exocytosis. Science. 335, (6065), 218-221 (2012).
  46. Coleman, B. I., Gubbels, M. J. A genetic screen to isolate Toxoplasma gondii host-cell egress mutants. J Vis Exp. (60), (2012).
  47. Walwyn, O. Forward genetics screens using macrophages to identify Toxoplasma gondii genes important for resistance to IFN-gamma-dependent cell autonomous immunity. J Vis Exp. (97), (2015).
  48. Rugarabamu, G., Marq, J. B., Guerin, A., Lebrun, M., Soldati-Favre, D. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion. Mol Microbiol. 97, (2), 244-262 (2015).
  49. Varberg, J. M., Padgett, L. R., Arrizabalaga, G., Sullivan, W. J. Jr TgATAT-Mediated alpha-Tubulin Acetylation Is Required for Division of the Protozoan Parasite Toxoplasma gondii. mSphere. 1, (1), (2016).
  50. Zheng, J., Jia, H., Zheng, Y. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int J Parasitol. 45, (2-3), 141-148 (2015).
  51. Long, S., Wang, Q., Sibley, L. D. Analysis of Noncanonical Calcium-Dependent Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using CRISPR/Cas9. Infect Immun. 84, (5), 1262-1273 (2016).
  52. Wang, K. Identification of Novel O-Linked Glycosylated Toxoplasma Proteins by Vicia villosa Lectin Chromatography. PLoS One. 11, (3), e0150561 (2016).
  53. Yang, M., Zheng, J., Jia, H., Song, M. Functional characterization of X-prolyl aminopeptidase from Toxoplasma gondii. Parasitology. 1-7 (2016).
  54. Zhang, W. Analysis of the virulence determination mechanisms in a local Toxoplasma strain (T.gHB1) isolated from central China. Parasitol Res. (2016).
QTL-kartläggning och CRISPR / Cas9 redigering för att identifiera en läkemedelsresistensgen i<em&gt; Toxoplasma gondii</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Shen, B., Powell, R. H., Behnke, M. S. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii. J. Vis. Exp. (124), e55185, doi:10.3791/55185 (2017).More

Shen, B., Powell, R. H., Behnke, M. S. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii. J. Vis. Exp. (124), e55185, doi:10.3791/55185 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter