Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

QTL Mapping og CRISPR / Cas9 redigering for at identificere et lægemiddelresistensgen i Published: June 22, 2017 doi: 10.3791/55185

Summary

Der gives oplysninger om, hvordan QTL-kortlægning med et genomsekvensbaseret genetisk kort kan bruges til at identificere et lægemiddelresistensgen i Toxoplasma gondii og hvordan dette kan verificeres med CRISPR / Cas9-systemet, der effektivt redigerer et genomisk mål, i dette tilfælde Lægemiddelresistensgen.

Abstract

Videnskabelig viden er i bund og grund forbundet med tilgængelige teknologier og metoder. Denne artikel vil præsentere to metoder, der muliggør identifikation og verifikation af et lægemiddelresistensgen i Apicomplexan parasit toxoplasma gondii , metoden for kvantitativ trait lokalisering (QTL) kortlægning ved hjælp af et generisk genetisk kort med hele genomsekvens (WGS) og metoden Af klynget regelmæssigt interspaced kort palindromisk gentagelser (CRISPR) / Cas9-baseret genredigering. Tilgangen ved QTL-kortlægning gør det muligt at teste om der er en sammenhæng mellem en genomisk region (er) og en fænotype. To datasæt er påkrævet for at køre en QTL-scanning, et genetisk kort baseret på afkom af et rekombinant kryds og en kvantificerbar fænotype vurderet i hvert af afkom fra dette kryds. Disse datasæt formateres derefter for at være kompatible med R / qtl-software, der genererer en QTL-scanning for at identificere signifikante loci korreleret med fænotypen. Selvom dette i høj grad kan indsnævre søgningen wIndkomst af mulige kandidater, QTLs spænder regioner, der indeholder en række gener, hvorfra kausal genet skal identificeres. At have WGS af afkom var kritisk til at identificere den kausal medicinresistensmutation på genniveauet. Efter identifikation kan kandidatmutationen verificeres ved genetisk manipulation af lægemiddelfølsomme parasitter. Den mest enkle og effektive metode til genetisk modifikation af T. gondii er CRISPR / Cas9-systemet. Dette system omfattede kun 2 komponenter, som begge kodede på et enkelt plasmid, et enkelt styrings-RNA (gRNA) indeholdende en 20 bp sekvens komplementær til det genomiske mål og Cas9 endonukleasen, der genererer en dobbeltstrenget DNA-pause (DSB) ved målet, Reparation der tillader indsættelse eller sletning af sekvenser omkring pauseområdet. Denne artikel indeholder detaljerede protokoller til at anvende CRISPR / Cas9-baserede genomeedigeringsværktøjer til at verificere genet, der er ansvarligt for sinfunginresistens og at konstruere transgene parasitter.

Introduction

Værtsområde bestemmer omfanget af en parasiternes prævalens. Nogle parasitter har meget specifikke værtsbehov, der begrænser området, hvorfra de findes, andre er generalister. En sådan generalist er Toxoplasma gondii ( T. gondii) . Denne parasit findes over hele verden, da den kan inficere alle pattedyr og mange fugle. Mennesker er også modtagelige, og det anslås, at ca. 1/3 af den globale befolkning er blevet smittet. Heldigvis styrer en robust immunrespons normalt parasittenes vækst, men i situationer, hvor immunsystemet er kompromitteret, kan parasitten vokse ukontrolleret og forårsage sygdomme, ofte encephalic. Også denne parasit kan forårsage medfødte sygdomme, hvis tidligere uinficerede kvinder er inficeret under graviditeten, da de mangler immunhukommelse for hurtigt at begrænse parasittenes spredning. Derudover er der en byrde for okulær toksoplasmose, som kan resultere i synetab 1 . Til disse reasoNs T. gondii er blevet et fokus for studier og på grund af de mange molekylære metoder, der er udviklet til undersøgelsen, en model for Apicomplexan-parasitter. To metoder, der vil blive diskuteret her, er kvantitativ træk lokalisering (QTL) kortlægning og klynget regelmæssigt interspaced kort palindromisk gentagelser (CRISPR) / Cas9 gen redigering. QTL kortlægning og CRISPR / Cas9 redigering er henholdsvis fremadrettede og omvendte genetiske fremgangsmåder, der er blevet anvendt i tidligere undersøgelser for at identificere og / eller karakterisere T. gondii virulensgener. Her kombineres disse metoder til at identificere og bekræfte funktionen af ​​et SNFr-gen, TgME49_290860, og dets orthologer (annoteret som SNR1 ) 2 .

Selv om T. gondii kan inficere et bredt udvalg af mellemliggende værter, skal det passere igennem og inficere de tarmepitelceller af et felid for at fuldføre livscyklusen. Katte er de endelige værter af parasitten, hvor sExual stadier fremstilles, og genetisk rekombination via meiose forekommer. For at gennemføre en QTL undersøgelse skal man skabe et genetisk kryds, og i tilfælde af toxoplasma betyder det at passere to forskellige parasitstammer, der afviger i et fænotypisk træk, forældrenes pletter gennem en kat til fremstilling af rekombinant afkom 3 . Før de bliver fodret til katte, gøres forældresstammerne resistente over for separate lægemidler for at muliggøre mere effektiv identifikation af rekombinanter ved dobbeltmedicinsk selektion af afkom 4 . Tre stoffer er blevet brugt i T. gondii til dette formål; Fluorodeoxyribose (FUDR), for hvilken uracilphosphoribosyltransferase ( UPRT ) er resistensgenet 5 , adenosin arabinosid (ARA), for hvilket Adenosine Kinase ( AK ) er resistensgenet 6 og sinusfungin (SNF), for hvilket resistensgenet var ukendt 7 . Flere genetiske kryds har væretSkabt for T. gondii , men kun de 24 afkom af ME49-FUDR r X VAND-SNF r- krydset blev genotyperet ved anvendelse af fuldgenomsekvensering (WGS) 8 . Dette åbnede muligheden for kortlægning og identifikation af SNF-resistensgenet ved anvendelse af dette kryds, da VAND-forældre blev gjort modstandsdygtige ved kemisk mutagenese af den lægemiddelfølsomme VAND (VAND-SNF s ) -stamme, og VAND-referencegenomet blev sekventeret under anvendelse af VAND- SNF s- stamme, hvilket således muliggør identifikation af alle polymorfier mellem afkom WGS og VAND-SNFs referencegenomet, herunder den arvelige forældreløse VAND-SNF r- mutation, der gjorde nogle af de afkomne resistente for afkom.

For at identificere den kausale enkelt nukleotidpolymorfisme (SNP) i SNF r- avkommen, kan flere beregningsbaserede open source-ressourcer anvendes til at analysere dataene. For at oprette det genetiske kort til ME49-FUDR r X VAND-SNF r krydse REDHORSE software suite 9 blev udviklet, der bruger WGS-indstillinger af forældrene og afkom til nøjagtigt at detektere de genomiske positioner af genetiske krydsninger. Denne kortlægningsinformation kan derefter kombineres med de fænotypiske data (SNF r i afkom) for at formatere et datasæt, der er kompatibelt med 'qtl'-pakken 10 i den R statistiske programmeringssoftware, hvor en QTL-scan kan køres for at afsløre vigtige loci korreleret med fænotype. For at identificere det kausal SNP, der er placeret inden for QTL-locuset, kan WGS-aflæsningerne af afkommet tilpasses individuelt til det sinfungin-følsomme VAND-genom ved anvendelse af Bowtie 2-justeringsprogrammet 11, hvorfra SNP'er kan kaldes ved hjælp af VarScan mpileup2snp-variantopkaldsprogrammet 12 . Ved hjælp af disse SNP'er kan QTL-locussen derefter scannes for polymorfier, som er til stede i SNF r, men ikkeI SNF s afkom. Med det kausal SNP, der er identificeret i det kodende område af et gen, kan genetisk modifikation af det kandidat SNF r- gen udføres i en SNF s- stamme for at verificere lægemiddelresistensfunktionen.

CRISPR / Cas9 genometredigeringssystemet blev for nylig etableret i Toxoplasma 13 , som tilføjede vigtige værktøjer til udforskning af den komplekse biologi af denne parasit, især for genetiske undersøgelser i ikke-laboratorie-tilpassede stammer. På grund af den meget aktive ikke-homologe endeforbindelses (NHEJ) aktivitet i WT Toxoplasma- celler er målrettet genommodifikation vanskeligt at opnå, da eksogent indført DNA er tilfældigt integreret i genomet ved ekstrem høj frekvens 14 . For at øge succesfrekvensen for lokalspecifik modifikation har forskellige fremgangsmåder været anvendt til at øge effektiviteten af ​​homolog rekombination og / eller reducere thE NHEJ aktivitet 15 , 16 . En af disse fremgangsmåder er CRISPR / Cas9-systemet. Sammenlignet med andre metoder er CRISPR / Cas9-systemet effektivt til at indføre stedspecifikke modifikationer og er let at designe 13 , 17 , 18 . Derudover kan den anvendes i enhver Toxoplasma- stamme uden ekstra modifikation af parasitten 13 , 19 .

CRISPR / Cas9-systemet stammede fra det adaptive immunsystem af Streptococcus pyogenes , som bruger det til at forsvare invasionen af ​​mobile genetiske elementer, såsom fag 20 , 21 , 22 . Dette system anvender det RNA-styrede DNA-endonuclease-enzym Cas9 for at indføre dobbeltstrenget DNA-pause (DSB) i målet, som efterfølgende repaEnten af ​​det fejlbehæftede NHEJ for at inaktivere målgener gennem korte indelmutationer eller ved homologi-rettet rekombination for at ændre mållokalet præcis som designet 23 , 24 . Målspecificiteten bestemmes af et lille RNA-molekyle ved navn single-guide RNA (gRNA), som indeholder en individuelt designet 20 nt-sekvens, der har 100% homologi til mål-DNA'et 22 . GRNA-molekylet indeholder også signaturer genkendt af Cas9, der styrer nukleasen til målstedet, hvilket omfatter en særlig Protospacer tilstødende motiv (PAM, sekvens er 'NGG') 25 , 26 . Derfor arbejder gRNA-molekylet og PAM-sekvensen sammen for at bestemme Cas9-spaltningsstedet i genomet. Man kan nemt ændre gRNA-sekvensen for at målrette forskellige steder for spaltning.

Da CRISPR / Cas9-systemet først blev udviklet i ToxopLasma, blev et enkelt plasmid, der udtrykker Cas9-nukleasen og gRNA-molekylet, anvendt til at indføre DSB på målingsstedet 13 , 17 . Det har vist sig, at CRISPR / Cas9-systemet drastisk forøger effektiviteten af ​​stedspecifik genomgenmodifikation, ikke kun ved homolog rekombination, men også ikke-homolog integration af eksogent DNA 13 . Det gør det i wildtype stammer, der indeholder NHEJ aktivitet. Derfor kan dette system anvendes i i det væsentlige enhver toxoplasma- stamme til effektiv genomredigering. I et typisk eksperiment co-transficeres det målspecifikke CRISPR-plasmid og DNA-fragmentet, der anvendes til modifikation af målet, ind i parasitter. Hvis DNA-fragmentet, der anvendes til at modificere målet, indeholder homologe sekvenser til mål-locuset, kan homolog rekombination anvendes til at reparere DSB introduceret af CRISPR / Cas9 for at tillade præcis modifikation af målet. På den anden side, hvis intDNA-fragmentet ikke indeholder homolog sekvens, kan det stadig integreres i CRISPR / Cas9-målretningssiden. Sidstnævnte bruges ofte til at forstyrre gener ved indsættelse af selekterbare markører eller til at komplementere mutanter på loki, der tillader negativt valg 13 . Her tjener SNR1- locus som et eksempel for at vise, hvordan CRISPR / Cas9 kan anvendes til genafbrydelse og generering af transgene parasitter.

Protocol

1. Vurder SNF r i afkom af ME49-FUDR r x VAND-SNF r Kors

BEMÆRK: T. gondii er en obligatorisk intracellulær parasit, og tachyzoitfasen vokser let i vævskultur.

  1. For at dyrke T. gondii parasitten opretholdes de i sammenflydende monolagskultur fra Human Foreskin Fibroblast (HFF), der er podet til T25-flasker med Dulbecco's Modified Eagle's Medium (DMEM) -medium suppleret med 10% føtalt bovint serum (FBS) (D10-medier) ved 37 ° C C og 5% CO 2 .
    BEMÆRK: Se protokol 1.1 Bemærk i supplerende fil 1 .
  2. For at teste individuelle afkomskloner for sinfældningsresistens vokser hver klon til høj parasitdensitet i en T25 HFF-kultivorkolbe i 2-3 d, indtil flertallet af parasitterne begynder at lyse værtscellerne.
  3. Skrab monolaget med en celleskraber og send parasitopløsningen gennem en 10 ml sprøjte / 22 G stump nål 2-3x tO lyser værtscellerne, der frigiver parasitter. Løsningen kan trækkes tilbage op i sprøjten til flere nålepassager.
  4. Filtrer parasitopløsningen i et nyt konisk rør gennem en membran med porestørrelsen på 3 μm for at fjerne HFF-celler og cellulære affald.
  5. Tæl parasitterne på et hæmocytometer og bestem antallet af parasitter per ml.
  6. Brug en pipettor til at passere 2,5 x 10 5 parasitter til en ny T25 HFF-kulturflaske indeholdende D10-medier med 0,3 μM arbejdskoncentration af det oprindelige lægemiddel.
  7. Voks parasitterne ved 37 ° C og 5% CO 2 i 7-10 d.
  8. Score afkom for vækstfænotypen i sinfungine lægemiddel. Overhold monolaget under et inverteret fasekontrastmikroskop og scor 0 for ingen vækst (følsom følsom), score 1 for vækst og lysis af monolag (modstandsdygtigt over for svin).
    BEMÆRK: Se protokol 1.8 Bemærk i supplerende fil 1 .

2. RUn a QTL Scan af SNF r Phenotype i R / qtl

BEMÆRK: Se protokol 2 Bemærk i supplerende fil 1 .

  1. Installer programmeringssprogprogrammet R på en lokal computer. Se 27 .
  2. Kør R og installer pakken 'qtl'. Du kan enten gøre dette fra R GUI-grænsefladens indstilling 'Pakker-> Installer pakke (r)' eller kør følgende kommando fra R-kommandolinjen (det første ">" -symbol i hvert eksempel angiver begyndelsen af ​​en kommando, ikke at være kopieret):
    > install.packages ( "QTL")
    BEMÆRK: Når R og 'qtl' ​​-pakken er installeret, er der to måder at køre R / qtl, fra R-kommandolinjen eller ved hjælp af et grafisk brugergrænseflade (GUI) program kaldet J / qtl 28 : se 29 for at downloade J / QTL. Denne protokol vil give R / qtl kommandolinjens syntaks med lejlighedsvis reference til den tilsvarende funktion i J / qtl.
  3. Indlæs pakken 'qtl':
    > Bibliotek (qtl)
    BEMÆRK: Se protokol 2.3 Bemærk i supplerende fil 1 for datasætformat og downloads.
  4. Indlæs datasætfilen i R / qtl.
    1. For "csv" format (Se: Datafil 1):
      > SNFR <- read.cross (format = "csv", fil = "$ PATH / Rqtl-SNFR.csv", genotyper = c ("0", "1"), na.strings = c ("-") , ConvertXdata = FALSE)
    2. Eller til "gary" format (Se: Data File 2):
      > SNFR <- read.cross (format = "gary", dir = "$ PATH", chridfile = "chrid.txt", mnamesfile = "mname.txt", mapfile = "markørpos.txt", genfile = "genotype. Txt ", phefile =" phenos.txt ", pnamesfile =" phenonames.txt ", convertXdata = FALSE)
      Hvor $ PATH er katalogvej til filen / filerne, der indeholder qtl datasættet. For eksempel: / Brugere / HotDiggityDog / QTLfiles
      BEMÆRK: Filerne kan også indlæsesEd i J / qtl med de foregående kommandoer ved hjælp af indstillingen 'Indsæt kommentar eller kommando' eller indlæs dataene med GUI 'File-> Load Cross Data'.
  5. Beregn sandsynligheder for kortet:
    > SNFR <- calc.genoprob (SNFR, trin = 2.0, off.end = 0.0, error.prob = 1.0E-4, map.function = "haldane", stepwidth = "fixed")
  6. Kør en enkelt scanning ved hjælp af en binær fordeling af den senfungin resistente fænotype på tværs af alle kromosomer:
    > SNFR.scan <- scanone (cross = SNFR, chr = c ("Ia", "Ib", "II", "III", "IV", "V", "VI", "VIIa", "VIIb "," VIII "," IX "," X "," XI "," XII "), pheno.col = c (1), model =" binær ", metode =" em ")
    BEMÆRK: Hvis du kører VIR-fænotypen, skal du bruge 'model =' normal '' distributionsindstilling.
  7. Kør 1000 permutationer for at beregne signifikans tærskler og derefter attrIbute permutationerne til SNFR.scan variablen:
    > SNFR.scan.permutations <- scanone (cross = SNFR, chr = c ("Ia", "Ib", "II", "III", "IV", "V", "VI", "VIIa" "VIIb", "VIII", "IX", "X", "XI", "XII"), pheno.col = c (1), model = "binær", metode = "em", n.perm = 1000, perm.Xsp = FALSE, verbose = FALSE)
    > Attr (SNFR.scan, "pheno.col") <- c (1)
    BEMÆRK: Trin 2,5 til 2,7 kan køres i J / qtl med 'Analyse-> Hovedscanning-> Kør én QTL Genome Scan' mulighed.
  8. Plot scanningsresultaterne:
    > Plot (SNFR.scan, gap = 0, bandcol = "grå")
    BEMÆRK: Plottet produceret i J / qtl er interaktivt.
    1. Plot scanningsresultaterne for bare kromosom IX, kromosomet med højeste top:
      > Plot (SNFR.scan, chr = c ("IX"), mellemrum = 0, bandcol = "grå", show.marker.names = TRUE)
    2. Vis alle markørpositioner og LOD-score fra enkelt scanningen:
      > SNFR.scan
    3. Vis tærskelresultaterne af permutationstesten:
      > sammenfattende (SNFR.scan.permutations)
    4. Vis kun de markører, der er større end alfa = .05 tærskelværdien (taget fra den foregående output):
      > SNFR.scan [SNFR.scan $ lod> 2,68,]
    5. Vis markørerne med den højeste LOD score på hvert kromosom:
      > Resumé (SNFR.scan)
    6. Vis de markører, der har den maksimale LOD-scoreværdi (taget fra den foregående output):
      > SNFR.scan [SNFR.scan $ lod> = 6,57,]
      BEMÆRK: Se protokol 2.13 Bemærk i supplerende fil 1 .

    3. Identificer den årsagssammenhængende SNF r mutation ved hjælp af WGS læser fra afkom

    BEMÆRK: Se protokol 3 Bemærk i supplerende fil 1 .

    1. Juster WGS læses af individuel afkom til den senfungin-følsomme VAND(VAND-SNF s ) forældregenomet.
      BEMÆRK: Download VAND-referencegenomet (SNF s ) fra NCBI Assembly AEYJ00000000.2, og WGS læser (.sra filer) for de 24 afkom fra NCBI SRA PRJNA258152. Download også følgende programmer: Bowtie2 11 , NCBI SRA Toolkit, SAMtools 30 , VarScan 12 og MUMMER 31 .
      1. Opret et Bowtie 2-kompatibelt indeks fra VAND-referencegenomet FASTA-filen ved hjælp af bowtie2-build-programmet, her navngiver indekset "VAND":
        > Bowtie2-build GCA_000224845.2_TGVAND_v2_genomic.fna VAND
      2. Konverter SRA formaterede WGS læse filer til FASTQ filer ved hjælp af fastq-dump med optionen --split-filer til parrede læsninger (SRR1555372.sra filen til afkom P1_14VB vil blive brugt som et eksempel):
        > Fastq-dump --split-filer SRR1555372.sra
        BEMÆRK: Kør dette og alle følgende kommandoer i protokol 3.1 for alle 24afkom.
      3. Juster WGS læses til referencegenomet ved hjælp af bowtie2 med output til en SAM (.sam) fil og alternativet -end-to-end:
        > Bowtie2 -x VAND -1 SRR155372_1.fastq -2 SRR1555372_2.fastq -S SRR155372.sam - end-til-ende
      4. Konverter .sam filen til en BAM (.bam) fil:
        > Samtools view -bS SRR155372.sam> SRR155372.bam
      5. Sorter .amb-filen:
        > Samtools sort SRR155372.bam SRR155372.sort
      6. Indeks den sorterede .bam-fil:
        > Samtools indeks SRR155372.sort.bam
    2. Ring til SNP'er for afkom ved hjælp af VarScan
      BEMÆRK: Se protokol 3.2 Bemærk i supplerende fil 1 .
      1. Konverter alle indekserede BAM (.sort.bam) filer til en pileup formateret fil ved hjælp af samtools mpileup med VAND genet reference fil, alle afkom .sort.bam filer og output til en fil ved navn AllProgeny-mpileup.txt:
        > Samtools mpileup -f GCA_000224845.2_TGVAND_v2_genomic.fna SRR1555599.Sort.bam SRR1555372.sort.bam SRR1555660.sort.bam SRR1555672.sort.bam SRR1556052.sort.bam SRR1556122.sort.bam SRR1556192.sort.bam SRR1556194.sort.bam SRR1556195.sort.bam SRR1556199.sort.bam SRR1556200. Sort.bam SRR1556202.sort.bam SRR1556203.sort.bam SRR1556274.sort.bam SRR1556276.sort.bam SRR1556278.sort.bam SRR1556395.sort.bam SRR1556396.sort.bam SRR1556397.sort.bam SRR1556398.sort.bam SRR1556399. Sort.bam SRR1556400.sort.bam SRR1556401.sort.bam SRR1556402.sort.bam> AllProgeny-mpileup.txt
      2. Ring til alle SNP'er ved hjælp af programmet VarScan mpileup2snp ved hjælp af filen AllProgeny-mpileup.txt, minimumlæsedækning af 5, minimumsvariantfrekvens på tværs af læsninger af .8, en p-værdi på .01 og output til filnavne AllProgeny-SNPs. txt:
        > Java -jar VarScan.jar mpileup2snp AllProgeny-mpileup.txt --min-dækning 5 --min-var-freq .8 --p-værdi .01> AllProgeny-SNPs.txt
        BEMÆRK: AllProgeny-SNPs.txt-filen er en faneafgrænset tekstfil, som vil blive brugt i protokol 3.4 til at lokalisereDen kausal SNP.
    3. Find VAND-genomkoordinater, som svarer til koordinaterne for ME49-baseret QTL-locus
      BEMÆRK: Se protokol 3.3 Bemærk i supplerende fil 1 .
      1. Brug MUMmer nucmer-programmet til at justere ME49-genomet (tilgængeligt for download fra ToxoDB.org 32 ) og VAND-referencegenometfilen (output går til out.delta-filen):
        > Nucmer ToxoDB-28_TgondiiME49_Genome.fasta GCA_000224845.2_TGVAND_v2_genomic.fna
      2. Brug MUMMER show-koordinationsprogrammet til at opnå koordinaterne for de to genomretninger, output til en fil med navnet ME49vsVAND-coords.txt:
        > Visningskoordiner out.delta> ME49vsVAND-coords.txt
        BEMÆRK: ME49vsVAND-coords.txt filen kan bruges til at finde VAND contigs og positioner, der svarer til QTL locus; Markører MV359 til MV366 placeret på ME49 kromosom IX mellem 3,187,537 til 4,202,258 bp. Der er to VAND contigs der spænder overensOntel QTL locus; KN044604.1: 657.441-1 bp og KN042501.1: 430.910-41.870 bp (begge contigsjustering tilbage til ME49 kromosomet).
    4. Vurdere afkom SNP'er placeret inden for QTL locus for SNP'er, der er arvet kun i SNF r- afkom
      BEMÆRK: Se protokol 3.4 Bemærk i supplerende fil 1 .
      1. Gennemgå datafil 3 for at identificere årsagsmutationen placeret i QTL-locus. Scan dataene til et mønster, hvor SNF r- afkom har en SNP, og SNF'erne er ikke (gennemførlige, fordi afkom SNP'er blev opnået ved sammenligning med VAND-SNFs referencegenomet). Dette bør kun resultere i en position med dette mønster, position 348130 på VAND contig KN042501.1.
      2. Se række 6604 i datafil 3 ( figur 3 ).
        BEMÆRK: Se protokol 3.4.2 Bemærk i supplerende fil 1 .

    4. Verifikation af Identificerede Hits af CRISPR / Cas9-Medieret geninaktivering.

    BEMÆRK: For at bekræfte kausal SNP identificeret ved QTL kortlægning og WGS SNP analyse, skal de tilsvarende genetiske ændringer foretages i en WT SNF s baggrund og den resulterende fænotype undersøgt. I tilfælde af sinfunginresistens resulterer den ansvarlige mutation i inaktivering af SNR1- genet ved tidlig afslutning 2 . Derfor kan afbrydelse af SNR1 bruges til bekræftelse. Her gives en detaljeret protokol til anvendelse af CRISPR / Cas9 inducerede indelmutationer for at forstyrre SNR1 for at demonstrere dets involvering i sinfunginresistens ( Figur 4 ).

    1. SNR1- specifik CRISPR-plasmidkonstruktion
      BEMÆRK: Se protokol 4.1 Bemærk i supplerende fil 1 for at opnå plasmider og kort.
      1. Hent den genomiske sekvens for målgenet ( SNR1 , TGME49_290860) fra ToxoDB 32 .
      2. Brug onlineværktøjer som E-CRISP 33 til at designe målspecifikke gRNA'er. Indsæt ikke PAM-sekvensen (NGG) i gRNA'en.
        BEMÆRK: Se protokol 4.1.2 Bemærk i supplerende fil 1 .
      3. Syntetiser primere til konstruktion af det målspecifikke CRISPR-plasmid.
        1. Ifølge designet fra trin 4.1.2 syntetiseres to primere for at ændre UPRT- målretnings-gRNA'et i det oprindelige CRISPR-plasmid til den valgte gRNA-sekvens ved hjælp af stedrettet mutagenese.
          BEMÆRK: Sekvenserne af disse to primere er som følger: gRNA-Fw: NNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC (N20 er den målspecifikke gRNA-sekvens) og gRNA-Rv: AACTTGACATCCCCATTTAC 2 .
      4. Udfør de site-directed mutagenese reaktioner.
        1. Ved anvendelse af UPRT- målretningen CRISPR-plasmidet (pSAG1 :: CAS9-U6 :: sgUPRT) som skabelon og de to primere, der er anført ovenfor, udfører site-directed mutagenesereaktionerI henhold til producentens anvisninger.
          BEMÆRK: Brug følgende cykliske betingelser for PCR: 98 ° C i 1 min efterfulgt af 25 cykler på 98 ° C i 10 s, 55 ° C i 30 s og 72 ° C i 5 minutter efterfulgt af en endelig forlængelse i 2 min Ved 72 ° C.
      5. Transform mutageneseprodukter indeholdende de GOI-specifikke CRISPR-plasmider til E. coli- kompetente celler ved kemisk omdannelse ifølge leverandørens protokol (se Materialetabeller ). Væk transformanterne på lysogeneboksebæger (LB) plader indeholdende ampicillin (100 μg / ml) ved 37 ° C. Derefter udvælges 2-4 kloner og vokser dem individuelt i 5 ml LB-medium suppleret med 100 μg / ml ampicillin i 12-16 timer.
        1. Ekstraher plasmider fra kulturerne ved anvendelse af et DNA isolationssæt og analyser dem ved DNA-gelelektroforese for at kontrollere størrelsen af ​​plasmiderne (forventet plasmidstørrelse er 9674 bp, brug det originale CRISPR-plasmid som control). Brug M13-Rev primeren (5'-CAGGAAACAGCTATGACC) til at sekvensere plasmiderne for at bekræfte den målspecifikke gRNA-sekvens.
          1. Når først positive kloner er identificeret, gem begge plasmid-DNA ved -20 ° C og tilsvarende bakteriekultur ved -80 ° C til senere brug.
            BEMÆRK: CRISPR-plasmidet, der skal anvendes til transfektion, skal opløses i deioniseret vand og koncentrationen bestemmes ved spektrofotometri eller en alternativ metode.
    2. Parasit transfektion.
      BEMÆRK: Generelle metoder til dyrkning af T. gondii i HFF-celler i D10-medium er blevet beskrevet tidligere 34 .
      1. To til tre dage før transfektion, tilsæt nok parasitter til en T25 kolbe indeholdende et sammenflytende HFF-celle monolag (0,5-1 x 106 for type 1-stammer, 1-2 x 10 6 for andre stammer) for at opnå 70-80% HFF-celle Lysis inden for 2-3 d.
      2. ExamiNe kulturen under et inverteret fase kontrastmikroskop, når HFF monolaget er 70-80% lyseret af parasitterne. Fjern forsigtigt mediet med en pipette og vask cellerne ud af kolbeoverfladen med 5 ml cytomixpuffer (120 mM KCl, 0,15 mM CaCl2, 10 mM K2HP04 / KH2P04 pH = 7,6, 25 mM HEPES, 2 MM EDTA, 5 mM MgCl2, pH = 7,6). Efterfølgende overfør parasitopløsningen til et 15 ml konisk rør.
        BEMÆRK: Se protokol 4.2.2 Bemærk i supplerende fil 1 .
      3. Pas parasitopløsningen gennem en 10 ml sprøjte / 22 G stump nål 2-3x.
      4. Filtrer parasitopløsningen i et nyt konisk rør gennem en membran med porestørrelsen på 3 μm for at fjerne HFF-celler og cellulære affald.
      5. Pelleter de filtrerede parasitter ved centrifugering ved 400 xg i 10 minutter.
      6. Hæld supernatanten ud og resuspender de pelleterede parasitter med 10 ml cytomixpuffer, tag en 10 μl alikvot til detHæmme parasitkoncentrationen med et hæmocytometer og pellet resten ved centrifugering ved 400 x g i 10 minutter.
      7. Fjern supernatanten og resuspender pelleten i cytomixpuffer for at opnå en tæthed på 4 x 107 parasiter / ml.
      8. I en 4 mm hulskuvette blandes 250-300 μL parasitopløsning (1-1,3 x 10 7 parasitter) med 7,5 μg CRISPR-plasmid, 6 μL ATP (100 mM) og 6 μL glutathion (GSH) (250 mM).
      9. Elektroporere parasitterne 35 . Inkluder en separat elektroporation som en negativ kontrol, hvori et CRISPR-plasmid er målrettet et andet sted, såsom UPRT- målrettet CRIPSR-plasmid.
        BEMÆRK: Elektroporationsindstillingerne afhænger af enheden. For den elektroporator, der er anført i materialerne, skal du bruge de 4 mm kuvetter. Følgende protokol anbefales: 1.700 V, 176 μs pulslængde, 2 pulser med 100 ms interval.
    3. Bestem frekvensen af ​​sinfjernede resistaNce efter CRISPR målretning.
      1. Frø HFF-celler til dækglas placeres i 24-brøndsplader 3-4 d før elektroporering, så de er sammenflydende til tiden for at udføre transfektion i 4.2.
        1. Trypsiniser HFF-cellerne fra en sammenflydende T25-kolbe og efterfølgende tilsættes 12 ml D10-medium og blandes godt.
        2. Tilsæt en dæksel til hver brønd i en brønd med 24 brønde og alikvot 500 μL HFF-celleopløsning til hver brønd. Inkuber pladen ved 37 ° C i 3 4 d for at lade cellerne vokse indtil sammenflydende.
          BEMÆRK: Celler fra en T25 kolbe er nok til at frø en 24-brønds plade.
        3. Tilsæt 50 μL elektroporeret parasitopløsning fra trin 4.2.9 i en brønd med 24 brøndsplader indeholdende et dækslip frøet med sammenflydende HFF-celler. Overfør resten af ​​elektroporeret parasitopløsning til en T25-kolbe, der er podet med sammenflydende HFF-celler.
      2. Vurder effektiviteten af ​​transfektion.
        1. Væk cellerne i 24-brøndspladen i 24 timerOg efterfølgende fixer cellerne (værtsceller og parasitter) med 500 μl 4% formaldehyd for at kontrollere ekspressionen af ​​Cas9-GFP ved immunofluorescerende analyse (IFA).
        2. Probe cellerne med et anti-GFP antistof og et Toxoplasma- specifikt antistof (såsom anti-TgALD) til at mærke samlede parasitter. Se antistoffets produktark for den anbefalede fortynding (normalt er 1: 1.000 tilstrækkeligt til IFA'er). Hvis antistofferne er ukonjugerede, brug to forskellige sekundære antistoffer konjugeret med fluorescerende farvestoffer til at mærke de primære antistoffer.
        3. Overhold de mærkede celler på et fluorescerende mikroskop med filtre, der er egnede til de sekundære fluorescerende farvestoffer. Få transfektionseffektivitet ved at dividere antallet af GFP-positive parasitter med antallet af samlede parasitter.
          BEMÆRK: De to antistoffer, der anvendes til IFA, skulle komme fra to forskellige værtsarter, for eksempel ved anvendelse af kombinationen af ​​anti-GFP og kanin anti-TgALD.
      3. Bestem fKrævelse af sinfældet resistens i transficerede parasitter.
        1. For de transficerede parasitter dyrket i T25 kolber, dyrk dem i 2-3 d til naturlig udgang. Derefter indsamles parasitterne, blunt nål lyscelleceller for at frigive intracellulære parasitter og rense dem ved filtrering gennem membraner med porestørrelse på 3 μm. Tæl parasitterne med et hæmocytometer for at estimere densiteten.
        2. Tilsæt rensede parasitter i 6-brøndsplader podet med sammenflydende HFF-celler: Til den første række (3 brønde) tilsættes 200 parasitter / brønd og dyrker dem i almindeligt D10-medium (2 ml / brønd); Til den anden række tilføjes 5000 parasitter / brønd og dyrker dem i D10 medium indeholdende 0,3 μM sinefungin.
        3. Sæt pladerne i en 5% CO2-inkubator og dyrk parasitterne ved 37 ° C 8-10 d uden forstyrrelse for at tillade plaques at danne. Fiks prøverne med 70% ethanol (2 ml / brønd) og pletter monolaget med 0,1% krystalviolet (2 ml / brønd). Vask brøndene med vand for at visualiserePlaquesne (klare zoner) dannet af parasitvækst.
          BEMÆRK: Den negative kontrol skal behandles på samme måde side om side.
      4. Beregn hastigheden af ​​CRISPR-induceret sinfunginresistens.
        1. Hent det gennemsnitlige antal (X) af plaques fra brønde uden lægemiddel og beregne parasitets levedygtighed som X / 200. Hent det gennemsnitlige antal (Y) af plaques fra brønde indeholdende sinfungin for at beregne hastigheden af ​​CRISPR-induceret sinfungemodstand som følger:
          Sats for CRISPR induceret modstand = 200 × Y / (5000 × X × transfektionseffektivitet)
          BEMÆRK: Transfektionseffektivitet er opnået fra 4.3.2.
    4. Undersøg indelmutationer induceret af CRISPR / Cas9
      1. Væk de elektroporerede parasitter fra afsnit 4.2.9 i en T25-kolbe podet med HFF-celler i 2 d ved 37 ° C. Derefter erstattes mediet med 5 ml D10 medium indeholdende 0,3 μM sinfungin (selektionsmedium).
        1. Opbevar parasitterne i udvælgelsesmedium i mindst 3 passager, indtil den resistente pool bliver stabil (indikeret ved fravær af parasitvækst i den negative kontrolgruppe, men robust parasitvækst i forsøgsgruppen).
      2. Subklon den senfunginresistente pool for at opnå klonestammer.
        1. Indsamle friskudstrålede parasitter, rense ved 3 μm membranfiltrering og subklon i 96-brøndsplader podet med sammenflydende HFF-celler i 150 μl D10-medium. Dyrk subkloningskulturerne i en CO 2- inkubator ved 37 ° C i 7 - 10 d uden at forstyrre pladerne.
          BEMÆRK: Se protokol 4.4.2.1 Bemærk i S supplerende fil 1 .
      3. Kontroller 96-brøndspladerne under et inverteret fasekontrastmikroskop for at kigge efter brønde, der kun indeholder en plaque. Markér sådanne brønde og overfør derefter cellerne fra hver brønd til 24 brøndsplader podet med HFF-celler ved anvendelse af en pipette.
      4. <Li> Når 80-90% af HFF-cellerne i en brønd lyseres, høstes parasitterne (ca. 500 μl) og passerer 50 μL parasitopløsning til en ny brønd for at opretholde stammen. Brug resten (≈ 450 μL) til at ekstrahere genomisk DNA til PCR amplifikation.
        1. For genomisk DNA-isolering fra SNF r- klonen er parasitterne (små mængder HFF-cellecontaminering tolerabel) ved 1000 xg i 10 minutter. Vask de pelleterede parasitter en gang med fosfatbufret saltvand (PBS) og pellet dem igen. Isolér genomisk DNA fra pelleterede celler ved brug af et kommercielt kit eller ved kogning. Resuspender parasitter i 50-100 μl PBS.
          BEMÆRK: Udfør PCR for at opnå et fragment af SNR1- genet til sekventering. Brug følgende primere til at amplificere SNR1-locus 2 : SNR1-Amp-Fw: 5 'CCGACCACAA CAATTTTC og SNR1-Amp-Rv: 5'GACGTGATTCACTTTTTTACAGACAGAC. Brug højfidelitets DNA-polymeraser. Forstærk WT-locus til kontrolformål.
      5. Udfør tHan PCR med 20 μl reaktionsvolumen og køre det med det følgende program: 98 ° C i 1 min efterfulgt af 30 cykler på 98 ° C i 10 s, 55 ° C i 30 s og 72 ° C i 2,5 min efterfulgt af Sidste forlængelse i 2 minutter ved 72 ° C.
        BEMÆRK: Sequence PCR-produkterne ved hjælp af følgende primere: SNR1-Seq1: 5 'GCC ACA TGC TTT AGC GTG, SNR1-Seq2: 5' TCC TCT CCA TCA CGG GTT GG, SNR1-Seq3: 5'GCA AGA GCC GCG TGA CG , SNR1-Seq4: 5 'CTC TCC CGC GGT CGA G, SNR1-Seq5: 5'GCA CCG TCC GCA AGC og SNR1-Seq6: 5' CCG GAA GGT GAA TCG TTC TTC.
      6. Sammenlign sekvenserne af SNR1- gen fra sinfunginresistente mutanter til den for WT-stammen ved hjælp af et sekvensjusteringsværktøj.
        BEMÆRK: Se Supplerende fil 2- protokol 5 for detaljer om anvendelse af negativt valg på SNR1- locus for genetisk komplementering eller transgen belastning.

Representative Results

Denne artikel beskriver detaljeret flere metoder, der kan anvendes i succession for at identificere et gen, der er ansvarlig for lægemiddelresistens ( figur 1 ). De 24 afkom af ME49-FUDR r X VAND-SNF r- krydset blev vurderet for resistens over for lægemiddelsusfungin som beskrevet i protokol 1. Ved anvendelse af det genetiske kort og SNF r- fænotypen af ​​afkom blev en QTL-scan kørt i R / Qtl - protokol 2 ( figur 2 ). Dette resulterede i en signifikant top på kromosom IX, der spænder ca. 1 Mbp. Det er i denne region, at kausal mutationen er placeret.

For at identificere den kausal mutation, som WGS læser fra afkom, blev de justeret til VAND-SNFs referencegenomet ved anvendelse af Bowtie2 - Protocol 3.1, blev SNP'er kaldet ved anvendelse af VarScan mpileup2snp - Protocol 3.2, og QTL-locuset i VAND-genomet blev identificeret ved anvendelse af MUMmer - ProtocOl 3.3. Fædre SNP'er inden for QTL-locuset blev ekstraheret og scannet for et mønster, hvor SNF r- afkom har en SNP, og SNF'erne gør ikke det, hvilket er muligt, fordi afkom SNP'er blev opnået ved sammenligning med VAND-SNFs referencegenomet ( Figur 3 ) . Kun en SNP matchede dette mønster, hvilket resulterer i et tidligt stopkodon i et formodet aminosyre-transportgener ved navn SNR1 .

Bekræftelse af, at SNR1 er SNF r- resistensgenet blev udført ved anvendelse af CRISPR / Cas9-systemet. Et nyt CRISPR / Cas9 plasmid konstrueret til T. gondii gen redigering blev fremstillet indeholdende et gRNA målrettet mod SNR1 genet nær SNF r mutationen identificeret i afkom - protokol 4 ( figur 4A ). Det SNR1 målrettede CRISPR / Cas9 plasmid blev elektroporeret ind i en SNF s WT parasitstamme, og resistente mutanter blev opnået når kultHærdet i 0,3 μM sinefungin. Der blev ikke opnået nogen SNF r parasitter, når de elektroporeredes med UPRT målrettet CRISPR / Cas9 plasmid. Flere SNF r CRISPR-mutanter blev klonet, og regionen omkring SNR1- gRNA-målet blev sekventeret. Hver mutant havde en indel, som forstyrrede den kodende sekvens af SNR1 genet ( figur 4B ). Denne metode kan også bruges til at indsætte en målretningskonstruktion i SNR1- locuset via NHEJ ( Figur 5) eller ved HR ( Figur 6 ) - Supplerende fil 2 .

figur 1
Figur 1: Skematisk Workflow for eksperimenter skitseret i protokollerne. De vigtigste trin i at identificere og bekræfte SNF r genet ved hjælp af ME49-FUDR r X VAND-SNF r kryds er vist med henvisning til de relevante protokoller skitseret i tHans artikel. Klik her for at se en større version af denne figur.

Figur 2
Figur 2: R / qtl Kommandoer til at køre QTL Scan på SNF r Phenotype. Kommandoerne som beskrevet i protokol 2 blev kørt i R ved hjælp af qtl-pakken. Repræsentative kommandoer og plot vises. Klik her for at se en større version af denne figur.

Figur 3
Figur 3: Placering af kausal SNP. Efterkommere WGS læser blev justeret til VAND-SNF s referencegenomet med Bowtie 2, SNP'er blev kaldt med VarScan, og de korresponderende Ing VAND QTL locus identificeret med MUMmer. SNP'er placeret i QTL-locuset blev importeret til et regneark, og den kausal SNP blev identificeret. SNF r afkom (gul), SNF s afkom (grøn), SNF r SNP (rød) (se datafil 3 ). Klik her for at se en større version af denne figur.

Figur 4
Figur 4: Bekræfter SNR1 som SNF r- gen ved hjælp af CRISPR / Cas9. ( A ) CRISPR / Cas9 inducerede indelmutationer (grøn) i SNR1- locus. ( B ) Repræsentative indeler i SNR1 forårsaget af to forskellige SNR1- specifikke CRISPR-plasmider (henholdsvis C5 og C6). RH er WT-stammen, og C5 og C6 er SNFr-mutanter. (B er taget fra referenceS = "xref"> 2). Klik her for at se en større version af denne figur.

Figur 5
Figur 5. Indsatsmutagenese ved anvendelse af CRISPR / Cas9. ( A ) Indsættelse af komplementerende eller transgene gener i SNR1- locuset ved CRISPR / Cas9-medieret site-specifik integration. To mulige orienteringer af det indsatte DHFR * mini-gen og de primere, der anvendes til identifikation, F1 / 2 og R1 / 2 repræsenterer primerstederne for oligos anvendt i diagnostiske PCR'er. ( B ) Diagnostiske PCR'er af en snr1 :: DHFR * klon, RH anvendes som en WT-kontrol. PCR af GRA1p er inkluderet som en kontrol, der kontrollerer kvaliteten af ​​genomisk DNA som skabeloner. Stjerner indikerer baner med uspecifikke bånd (figur 5B er taget fra referencenCe 2 ). Klik her for at se en større version af denne figur.

Figur 6
Figur 6: Gene Knockout ved hjælp af CRISPR / Cas9. Et klassisk design til CRISPR / Cas9 medieret homologt gen erstatning i T. gondii . Orienteringen af ​​indsat transgen er fastgjort i dette tilfælde. F1 / R1, F2 / R2 og F3 / R3 repræsenterer primerstederne for oligos anvendt i diagnostiske PCR'er. Klik her for at se en større version af denne figur.

Datafil 1: ME49-FUDR r X VAND-SNF r Korsfil fEller brug i R / qtl, "csv" Format. En .csv-fil, der kan indlæses i R / qtl med formatet = "csv". Klik her for at downloade denne fil.

Datafil 2: (krid txt, genotype txt, markørpos.txt, mname.txt, phenonames.txt og phenos.txt). ME49-FUDR r X VAND-SNF r Krydsfiler til brug i R / qtl, "gary" Format. Seks .txt-filer, der kan indlæses i R / qtl med formatet = "gary". Klik her for at downloade denne fil.

Datafil 3. Regneark med afkom SNP'er på tværs af SNF r Klik her for at downloade denne fil.

Supplerende fil 1: Yderligere protokoldetaljer. Klik her for at downloade denne fil.

Supplerende fil 2: Protokol 5 - Anvendelse af negativt valg på SNR1 Locus til genetisk komplementering eller transgenisk stammekonstruktion . Klik her for at downloade denne fil.

Discussion

Disse protokoller frembyder adskillige metoder, der, når de kombineres, tillader identifikation af et lægemiddelresistensgen i T. gondii . To især var integreret i projektet, den forholdsvis erfarne metode til QTL-kortlægning og den nyligt udviklede metode til CRISPR / Cas9-genredigering. Lander og Botstein udgav deres indflydelsesrige papir i 1989 og demonstrerede QTL-kortlægning, der korrelerer genetiske loci med fænotyper 36 . Senere i 2012 beskrev Dounda og Charpentier CRISPR / Cas9-editeringssystemet i Streptococcus pyogenes 22, der hurtigt blev tilpasset som et genetisk værktøj i mange forskellige modeller, herunder T. gondii 13 , 17 . Begge metoder var nyttige her, hvor QTL-kortlægning definerede locus indeholdende lægemiddelresistensmutationen, der i sidste ende blev identificeret ved anvendelse af WGS-baseret SNP-detektion, og CRISPR / Cas9-redigering gav mig Ans for at bekræfte SNR1 er det genfindte lægemiddelresistensgen.

ME49-FUDR r X VAND-SNF r- kryds 8 blev oprindeligt udviklet til at forhøre en virulensfænotype 19 , men forældrenes stammer forekom også at have en yderligere fænotypisk forskel, for hvilken kausal genet ikke var kendt, sinusfældet resistens i VAND-forældre. Dette fremhæver en fordel ved krydser, idet de kan genindføres, når der ses yderligere fænotypiske forskelle i forældrene. Dette var tilfældet for et andet Toxoplasma- kryds, type 2 x type 3, hvor flere gener involveret i virulens blev fundet ved at kortlægge flere fænotyper 37 , 38 , 39 , 40 . Til dato er fire forskellige T. gondii- kryds blevet beskrevet og brugt til at kortlægge gener, som er ansvarlige for fænotyperSs = "xref"> 8 , 37 , 41 , 42 , som alle har potentialet til at blive genbrugt til at kortlægge nye fænotyper, for hvilke det genetiske grundlag ikke er kendt. Langs disse linjer er genomerne for 62 T. gondii- stammer, der repræsenterer den kendte globale genetiske mangfoldighed, sekventeret 43 . Nye kryds kan laves fra denne pool for stammer, der adskiller sig fra interessante fænotyper. Efter at have udtalt fordelene ved QTL-kortlægning, må det siges, at generering af et kryds er ikke en mindre virksomhed. Der er andre metoder, der kan bruges til at identificere årsagsgener. En kraftig teknik bruger kemisk mutagenese til at skabe mutanter, der kan screenes for fænotyper. For at finde årsagsgenet kan mutanter enten komplementeres med kosmidbiblioteker 44 eller genomsekventeringsmetoder kan anvendes til at finde årsagsmutationen 45 . For moSe her om to, se JoVE artikler fra Coleman et al. Og Walwyn et al. Der beskriver disse tilgange 46 , 47 .

Mange af de trin, der fører til identifikationen af ​​den kausal SNF r- mutation (protokol 2 og 3) er baseret på beregningsmetoder udført med software, som er frit tilgængelig til akademisk brug. Detaljerede kommandoer for hvert trin er tilvejebragt, og når kørslen med de rigtige filer vil tillade brugeren at genskabe de datasæt, der er nødvendige for at finde årsags SNF r SNP. Husk at nogle af syntaksen i kommandoerne henviser til filnavne eller mappestruktur ($ PATH), der kan ændres til brugerens præference. Selvom de kommandoer, der gives her, helt sikkert ikke udtømmer måder man kan analysere et kryds med QTL analyse og WGS-baseret SNP-identifikation, er de tilstrækkelige til at gentage eksperimentet beskrevet i denne artikel og bør give brugeren mulighed for at blive m Malm er bekendt med, hvordan disse fremgangsmåder udnyttes trinvist.

Skønt QTL-kortlægning og WGS-sekvensbaseret SNP-detektion var tilstrækkelige til at identificere et kandidat SNF r- gen, er der behov for yderligere eksperimenter for at bekræfte dets rolle i lægemiddelresistens. Dette kan overbevisende ses ved genforstyrrelser eller knockout-teknikker, der begge kan opnås ved hjælp af CRISPR / Cas9 genredigering. Detaljerede metoder til anvendelse af CRISPR / Cas9 til enten at generere indelmutationer eller indsætte transgene konstruktioner i et målgen i T. gondii er givet. Målretningsspecifikiteten, som CRISPR / Cas9 giver, øger effektiviteten af ​​genredigering over traditionelle metoder. Denne øgede effekt har også gjort det muligt at anvende ikke-laboratorie-tilpassede stammer til genetiske undersøgelser, som tidligere var vanskelige at modificere 13 . Selvom CRISPR / Cas9 i sin barndom allerede er blevet brugt til at forårsage genforstyrrelserLass = "xref"> 2 , 13 , 17 , 18 , 48 , 49 , tag gener 17 , og lav genknockouts 16 , 19 , 50 , 51 , 52 , 53 , 54 i T. gondii , lovende at være et nyttigt værktøj For mange andre undersøgelser i fremtiden.

Opdagelsen af, at SNR1- inaktivering fører til sinfældet resistens gør SNR1- locus til et lovende sted for transgen insertion eller genetisk komplementering. For at maksimere succesen med at anvende CRISPR / Cas9-medieret genmålretning til at lede integrationen af ​​transgen til SNR1- locuset, bør følgende aspekter overvejesRødt under det eksperimentelle design. For det første anbefales en markeringsmarkør til at blive inkluderet i den transgene konstruktion for at øge effektiviteten af ​​belastningskonstruktionen. Hvis der er inkluderet en markeringsmarkør, kan både positivt og negativt valg anvendes, hvilket resulterer i, at næsten 100% af de dobbelt valgte parasitter er transgene med GOI integreret på SNR1- locus. I modsætning hertil afhænger effektiviteten af ​​succesfuld transgenese i høj grad af effektiviteten af ​​cotransfektion af CRISPR-plasmidet og den transgene konstruktion, hvis den transgene konstruktion ikke indeholder yderligere selekterbare træk og afhænger af negativt selektion på SNR1- locuset.

For det andet, selv om CRISPR / Cas9-medieret stedsspecifik integration af et ikke-homologt DNA-fragment hyppigt anvendes til komplementering og transgenese, skal det bemærkes, at orienteringen af ​​indsættelse ikke kan garanteres i sådanne tilfælde, hvor begge retninger er mulige. Dette kan udgøre problemerMs til nogle applikationer. For at komplementere en mutant med forskellige gen alleler er det for eksempel vanskeligt at sikre, at alle alleler indsættes i samme orientering, og uoverensstemmelser i orientering kan forårsage ekspressionsforskelle. Til denne type ansøgning anbefales DNA-konstruktioner med sekvenser homologe til SNR1- locuset, hvilket vil drive den korrekte integrationsorientering ( figur 6 ).

For det tredje er forholdet mellem CRISPR-plasmidet og det transgene DNA-molekyle under transfektion kritisk for succesfuld transgenisk belastningskonstruktion. Dette forhold skal justeres i henhold til udvælgelsesstrategierne. Følgende retningslinjer anbefales: 1) Hvis den transgene konstruktion indeholder en lægemiddelresistent markør og det tilsvarende lægemiddel, er det eneste valg, der anvendes til at generere transgene parasitter, dvs. det er ikke brugt sinfungin, det foreslåede molforhold mellem den transgene konstruktion og CRISPR-plasmaetId er 1: 5. Ved at anvende mere CRISPR-plasmid i dette tilfælde øges sandsynligheden for, at parasitter, der modtager den transgene konstruktion, også modtager CRISPR-plasmidet, derfor er de lægemiddelresistente parasitter mere tilbøjelige til at have markøren indsat på CRISPR-målingsstedet. Hvis forholdet er omvendt, vil de fleste parasitter, der modtager den transgene konstruktion, ikke få CRISPR-plasmidet. Som følge heraf opnår langt størstedelen af ​​lægemiddelresistente parasitter den transgene konstruktion gennem tilfældig integration, der ikke er forbundet med CRISPR / CAS9-medieret stedspecifik insertion. 2) Hvis den transgene konstruktion indeholder en lægemiddelresistent markør, og det tilsvarende lægemiddel anvendes sammen med sinfungin for at vælge transgene parasitter, er det foreslåede molforhold mellem den transgene konstruktion og CRISPR-plasmidet 1: 1. Denne strategi giver den højeste effektivitet ved transgen belastning konstruktion. 3) Hvis den transgene konstruktion ikke indeholder en valgbar producent, afhænger af negativt valgVed sinfungin alene for at opnå transgene parasitter er det foreslåede molforhold mellem den transgene konstruktion og CRISPR-plasmidet 5: 1. Begrundelsen for dette design er det samme som i den første retningslinje ovenfor. Da både pyrimethamin og sinfungin blev anvendt til udvælgelse i protokol 5, blev forholdet mellem DHFR * mini-gen og det SNR1- målrettede CRISPR-plasmid sat som 1: 1.

Tværtimod har metoderne beskrevet her et detaljeringsniveau, som ikke var muligt at formidle i den oprindelige publikation, der identificerede SNR1 2 . Disse protokoller; Specielt bør kommandolinjens syntaks, sekventiel layout af de anvendte programmer og brugen af ​​CRISPR / Cas9 hjælpe fremtidige bestræbelser for at identificere nye gener, som er ansvarlige for fænotyper.

Acknowledgments

Vi vil gerne takke L. David Sibley og Asis Khan for deres bidrag til den oprindelige publikation, som disse protokoller bygger på. Dette arbejde blev finansieret af National Institutes of Health grant AI108721.

Materials

Name Company Catalog Number Comments
T25 flasks Corning 430639
Human Foreskin Fibroblasts (HFF) ATCC SCRC-1041
T. gondii ME49 strain ATCC 50840
T. gondiiVAND strain ATCC PRA-344
DMEM (No Sodium Bicarbonate) Life Sciences 12800017
Sodium Bicarbonate Sigma Aldrich S5761
HEPES Sigma Aldrich H3375
Fetal Bovine Serum (FBS) Premium Grade VWR International 97068-085
L-Glutamine  200 mM Sigma Aldrich G7513
Gentamicin (10 mg/mL) Life Technologies  15710064
Cell Scraper for Flasks VWR International 10062-904
Syringe 10 mL BD 309604
Blunt needles 22 G x 1" BRICO Products BN2210
Nuclepore Filter 3.0 µm, 25 mm GE Healthcare 110612
Swin-Lok Filter Holder 25 mm GE Healthcare 420200
Hemacytometer Propper MFG 90001
Sinefungin Enzo Life Sciences 380-070-M001
The R Foundation https://www.r-project.org/
J/qtl The Churchill Group http://churchill.jax.org/software/jqtl.shtml
Bowtie2 John Hopkins University http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
NCBI SRA Toolkit NCBI http://www.ncbi.nlm.nih.gov/Traces/sra/?view=toolkit_doc
SAMtools Wellcome Trust Sanger Institute http://www.htslib.org/
VarScan Washington University, St Louis http://varscan.sourceforge.net/
MUMmer JCVI & Univ Hamburg http://mummer.sourceforge.net/
pSAG1::CAS9-U6::sgUPRT Addgene Plasmid #54467 T. gondii CRISPR plasmid to cut the UPRT gene
pSAG1::CAS9-U6::sg290860-6 Addgene Plasmid #59855 T. gondii CRISPR plasmid to cut the TG*_290860 SNR1 gene
pUPRT::DHFR-D Addgene Plasmid #58528 Template for DHFR* mini gene
Q5 Site-Directed Mutagenesis Kit  New England Biolabs E0552S
QIAprep Spin Miniprep Kit QIAGEN 27106
NanoDrop 2000 Thermo Scientific ND-2000
LB Broth Fisher Scientific DF0446-07-5
Potassium chloride Sigma Aldrich P9541
Calcium chloride Sigma Aldrich 746495
Potassium phosphate monobasic Sigma Aldrich P9791
Potassium phosphate dibasic Sigma Aldrich P5504
EDTA Sigma Aldrich E5134
Magnesium chloride Sigma Aldrich M1028
Adenosine triposhpate (ATP) Sigma Aldrich A6419
L-glutathione (GSH) Sigma Aldrich G4251
ECM 830 Electroporation System BTX 45-0002
Electroporation Cuvette  4 mm Harvard Apparatus 45-0126
Crytal Violet Alfa Aesar B21932-14
6-well TC plate Corning 353046
24-well TC plate Corning 353935
Cover glass 12 mm round VWR International 89015-724
96-well TC plate Corning 353075
Gibson Assembly Cloning Kit (Multi-fragment) New England Biolabs E5510S
Q5 High-Fidelity Polymerase  New England Biolabs M0491S
Pyrimethamine TCI AMERICA P2037-1G Use cuation when using pyrimethamine resistant parasites - see Protocol

DOWNLOAD MATERIALS LIST

References

  1. Dubey, J. P. The history of Toxoplasma gondii--the first 100 years. J Eukaryot Microbiol. 55, (6), 467-475 (2008).
  2. Behnke, M. S., Khan, A., Sibley, L. D. Genetic Mapping Reveals that Sinefungin Resistance in Toxoplasma gondii Is Controlled by a Putative Amino Acid Transporter Locus That Can Be Used as a Negative Selectable Marker. Eukaryot Cell. 14, (2), 140-148 (2015).
  3. Dubey, J. P. History of the discovery of the life cycle of Toxoplasma gondii. Int J Parasitol. 39, (8), 877-882 (2009).
  4. Pfefferkorn, L. C., Pfefferkorn, E. R. Toxoplasma gondii: genetic recombination between drug resistant mutants. Exp Parasitol. 50, (3), 305-316 (1980).
  5. Donald, R. G., Roos, D. S. Insertional mutagenesis and marker rescue in a protozoan parasite: cloning of the uracil phosphoribosyltransferase locus from Toxoplasma gondii. Proc Natl Acad Sci U S A. 92, (12), 5749-5753 (1995).
  6. Sullivan, W. J. Jr Insertional tagging of at least two loci associated with resistance to adenine arabinoside in Toxoplasma gondii, and cloning of the adenosine kinase locus. Mol Biochem Parasitol. 103, (1), 1-14 (1999).
  7. Khan, A. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acids Res. 33, (9), 2980-2992 (2005).
  8. Khan, A. NextGen sequencing reveals short double crossovers contribute disproportionately to genetic diversity in Toxoplasma gondii. BMC Genomics. 15, (1), 1168 (2014).
  9. Shaik, J. S., Khan, A., Beverley, S. M., Sibley, L. REDHORSE-REcombination and Double crossover detection in Haploid Organisms using next-geneRation SEquencing data. BMC Genomics. 16, (1), 133 (2015).
  10. Arends, D., Prins, P., Jansen, R. C., Broman, K. W. R/qtl: high-throughput multiple QTL mapping. Bioinformatics. 26, (23), 2990-2992 (2010).
  11. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9, (4), 357-359 (2012).
  12. Koboldt, D. C. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Res. 22, (3), 568-576 (2012).
  13. Shen, B., Brown, K. M., Lee, T. D., Sibley, L. D. Efficient gene disruption in diverse strains of Toxoplasma gondii using CRISPR/CAS9. MBio. 5, (3), e01114 (2014).
  14. Fox, B. A., Ristuccia, J. G., Gigley, J. P., Bzik, D. J. Efficient gene replacements in Toxoplasma gondii strains deficient for nonhomologous end joining. Eukaryot Cell. 8, (4), 520-529 (2009).
  15. Huynh, M. H., Carruthers, V. B. Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryot Cell. 8, (4), 530-539 (2009).
  16. Wang, J. L. The Past, Present, and Future of Genetic Manipulation in Toxoplasma gondii. Trends Parasitol. (2016).
  17. Sidik, S. M., Hackett, C. G., Tran, F., Westwood, N. J., Lourido, S. Efficient genome engineering of Toxoplasma gondii using CRISPR/Cas9. PLoS One. 9, (6), e100450 (2014).
  18. Sugi, T., Kato, K., Weiss, L. M. An improved method for introducing site-directed point mutation into the Toxoplasma gondii genome using CRISPR/Cas9. Parasitol Int. (2016).
  19. Behnke, M. S. Rhoptry Proteins ROP5 and ROP18 Are Major Murine Virulence Factors in Genetically Divergent South American Strains of Toxoplasma gondii. PLoS Genet. 11, (8), e1005434 (2015).
  20. Barrangou, R. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 315, (5819), 1709-1712 (2007).
  21. Garneau, J. E. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature. 468, 67-71 (2010).
  22. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  23. Cong, L. Multiplex genome engineering using CRISPR/Cas systems. Science. 339, (6121), 819-823 (2013).
  24. Mali, P. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  25. Jiang, F., Zhou, K., Ma, L., Gressel, S., Doudna, J. A. STRUCTURAL BIOLOGY. A Cas9-guide RNA complex preorganized for target DNA recognition. Science. 348, (6242), 1477-1481 (2015).
  26. Nishimasu, H. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  27. The R Project for Statistical Computing. Available from: https://www.r-project.org (2016).
  28. Smith, R., Sheppard, K., DiPetrillo, K., Churchill, G. Quantitative trait locus analysis using J/qtl. Methods Mol Biol. 573, 175-188 (2009).
  29. The Churchill Group. J/qtl. http://churchill.jax.org/software/jqtl.shtml (2013).
  30. Li, H. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  31. Kurtz, S. Versatile and open software for comparing large genomes. Genome Biol. 5, (2), (2004).
  32. Gajria, B. ToxoDB: an integrated Toxoplasma gondii database resource. Nucleic Acids Res. 36, (Database issue), D553-D556 (2008).
  33. Heigwer, F., Kerr, G., Boutros, M. E-CRISP: fast CRISPR target site identification. Nat Methods. 11, (2), 122-123 (2014).
  34. Roos, D. S. Molecular genetic tools for the identification and analysis of drug targets in Toxoplasma gondii. Curr Top Microbiol Immunol. 219, 247-259 (1996).
  35. Soldati, D., Boothroyd, J. C. Transient transfection and expression in the obligate intracellular parasite Toxoplasma gondii. Science. 260, (5106), 349-352 (1993).
  36. Lander, E. S., Botstein, D. Mapping mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics. 121, (1), 185-199 (1989).
  37. Saeij, J. P. Polymorphic secreted kinases are key virulence factors in toxoplasmosis. Science. 314, (5806), 1780-1783 (2006).
  38. Saeij, J. P. Toxoplasma co-opts host gene expression by injection of a polymorphic kinase homologue. Nature. 445, (7125), 324-327 (2007).
  39. Rosowski, E. E. Strain-specific activation of the NF-kappaB pathway by GRA15, a novel Toxoplasma gondii dense granule protein. J Exp Med. 208, (1), 195-212 (2011).
  40. Reese, M. L., Zeiner, G. M., Saeij, J. P., Boothroyd, J. C., Boyle, J. P. Polymorphic family of injected pseudokinases is paramount in Toxoplasma virulence. Proc Natl Acad Sci U S A. 108, (23), 9625-9630 (2011).
  41. Taylor, S. A secreted serine-threonine kinase determines virulence in the eukaryotic pathogen Toxoplasma gondii. Science. 314, (5806), 1776-1780 (2006).
  42. Behnke, M. S. Virulence differences in Toxoplasma mediated by amplification of a family of polymorphic pseudokinases. Proc Natl Acad Sci U S A. 108, (23), 9631-9636 (2011).
  43. Lorenzi, H. Local admixture of amplified and diversified secreted pathogenesis determinants shapes mosaic Toxoplasma gondii genomes. Nat Commun. 7, 10147 (2016).
  44. Gubbels, M. J. Forward genetic analysis of the apicomplexan cell division cycle in Toxoplasma gondii. PLoS Pathog. 4, (2), e36 (2008).
  45. Farrell, A. A DOC2 protein identified by mutational profiling is essential for apicomplexan parasite exocytosis. Science. 335, (6065), 218-221 (2012).
  46. Coleman, B. I., Gubbels, M. J. A genetic screen to isolate Toxoplasma gondii host-cell egress mutants. J Vis Exp. (60), (2012).
  47. Walwyn, O. Forward genetics screens using macrophages to identify Toxoplasma gondii genes important for resistance to IFN-gamma-dependent cell autonomous immunity. J Vis Exp. (97), (2015).
  48. Rugarabamu, G., Marq, J. B., Guerin, A., Lebrun, M., Soldati-Favre, D. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion. Mol Microbiol. 97, (2), 244-262 (2015).
  49. Varberg, J. M., Padgett, L. R., Arrizabalaga, G., Sullivan, W. J. Jr TgATAT-Mediated alpha-Tubulin Acetylation Is Required for Division of the Protozoan Parasite Toxoplasma gondii. mSphere. 1, (1), (2016).
  50. Zheng, J., Jia, H., Zheng, Y. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int J Parasitol. 45, (2-3), 141-148 (2015).
  51. Long, S., Wang, Q., Sibley, L. D. Analysis of Noncanonical Calcium-Dependent Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using CRISPR/Cas9. Infect Immun. 84, (5), 1262-1273 (2016).
  52. Wang, K. Identification of Novel O-Linked Glycosylated Toxoplasma Proteins by Vicia villosa Lectin Chromatography. PLoS One. 11, (3), e0150561 (2016).
  53. Yang, M., Zheng, J., Jia, H., Song, M. Functional characterization of X-prolyl aminopeptidase from Toxoplasma gondii. Parasitology. 1-7 (2016).
  54. Zhang, W. Analysis of the virulence determination mechanisms in a local Toxoplasma strain (T.gHB1) isolated from central China. Parasitol Res. (2016).
QTL Mapping og CRISPR / Cas9 redigering for at identificere et lægemiddelresistensgen i<em&gt; Toxoplasma gondii</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Shen, B., Powell, R. H., Behnke, M. S. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii. J. Vis. Exp. (124), e55185, doi:10.3791/55185 (2017).More

Shen, B., Powell, R. H., Behnke, M. S. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii. J. Vis. Exp. (124), e55185, doi:10.3791/55185 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter