Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Optimierte Einzelzelle TCR Isolation und Generierung von retroviralen Vektoren für In-Vitro und In Vivo Ausdruck menschlichen TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

Das aktuelle Protokoll kombiniert, die einzelne Zelle menschlichen TCR Alpha- und Beta-Kette Sequenzierung mit gepaart gestrafft Generation kompatibel mit in Vitro und in Vivo TCR Ausdruck retroviralen Vektoren.

Abstract

Obwohl mehrere Methoden für die Sequenzierung von gepaarten T-Zell-Rezeptor (TCR) Alpha- und Beta-Ketten aus einzelnen T-Zellen entwickelt wurden, wurden keine bisher förderlich für nachgeschaltete in Vivo Funktionsanalyse des TCR Heterodimere. Wir haben eine verbesserte Protokoll basiert auf einem zweistufigen Multiplex nested PCR, resultiert in einer PCR-Produkt, das gesamte Variable Regionen eine menschliche TCR-Alpha und Beta-Ketten umfasst entwickelt. Durch die einzigartige Restriktionsschnittstellen Identifizierung und Einbindung in die PCR-Primer, haben wir das PCR-Produkt mit direkten vor-Klonen in der Vorlage retroviral Vektor kompatibel gemacht. Das daraus resultierende retrovirale Konstrukt kodiert eine Chimäre Mensch/Maus TCR mit einer Maus intrazelluläre Domäne in Mauszellen oder in Vivo Maus-Modellen funktioniert. Insgesamt verbindet das Protokoll hier beschriebenen menschlichen Einzelzelle gepaart TCR Alpha- und Beta-Kette Identifikation mit optimierten Generation von retroviralen Vektoren leicht anpassbar für in Vitro und in Vivo TCR Ausdruck. Das Video und das Begleitmaterial sollen eine sehr detaillierte Beschreibung der einzelnen Zelle PCR, vermitteln, dass die entscheidenden Schritte gefolgt und mögliche Fallstricke vermieden werden können. Darüber hinaus bieten wir eine ausführliche Beschreibung der Klonen Schritte notwendig, um dem Expressionsvektor erzeugen. Sobald Sie beherrscht, konnte die ganze Prozedur von Einzelzelle Sortierung TCR Ausdruck in einem kurzen Zeitraum von zwei Wochen durchgeführt werden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Der T-Zell-Rezeptor (TCR) schreibt T-Zell-Schicksal-Entscheidung während der Entwicklung, Steady-State/Homöostase und Antigenen Stimulation in der Peripherie1,2,3. Jüngste Erweiterung der Deep sequencing Technologien hat eine bisher unterschätzte TCR Vielfalt in Antigen-spezifischen T-Zell-Antworten aufgedeckt. TCR Vielfalt schlägt ein Potenzial für funktional Breite T-Zell-Reaktionen. Um die Sequenzanalyse Repertoire TCR TCR funktionale Tests zu integrieren, sollten die Sequenzierung Ansätze entworfen werden, kompatibel mit experimentellen Systemen und in Vivo Modelle für nachfolgende Funktionsanalyse der SELECT-Anweisung verwendet werden TCR. Wir haben einen effizienten Ansatz für menschliche TCR Sequenz Isolation entwickelt und gestrafft, vor-Klonen in einen Chimären Mensch/Maus TCR Vorlage Vektor mit TCR Ausdruck in HLA-humanisierten Mäuse4kompatibel. Isolation der entsprechenden Alpha- und Beta-Ketten des heterodimerisierenden TCR verlangt PCR Verstärkung der beiden Ketten aus einer einzigen Zelle. Obwohl einige einzellige TCR Klonen Protokolle entwickelt und genutzt haben, wurden keiner bisher problemlos kompatibel mit Hochdurchsatz-optimierte direkte Klonen unbekannter Vα/Vβ TCRs in retrovirale Vektoren für erneuten Ausdruck in-vivo notwendig 4,5,6,7. Frühere Studien haben zwei Hauptansätze, entweder um einen begrenzten Teil des TCR ausreichend, um die Sequenz zu extrapolieren oder verstärken die gesamte TCR Sequenz4,5,6 selektiv zu verstärken genutzt. , 7. Downstream Funktionsanalyse des TCR Sequenzen erhalten über den ersten Ansatz erfordert kostspielige in Silico Montage und de Novo Bau TCR. Während der zweite Ansatz die komplette TCR-Sequenz bietet, ist die menschliche konstante Region nicht in Vivo Ausdruck der geklonten TCRs in Mausmodellen vereinbar. Unser Ansatz ist speziell mit in Vivo Funktionsanalyse des TCR in Maus-Modellen kompatibel. Wir entwickelten eine effiziente und schlanke einzelligen PCR-Protokoll, das für direkte vor-Klonen der PCR-Fragmente in der Vorlage Expressionsvektor ermöglicht.

Unser Ansatz nutzt eine hochsensible Multiplex verschachtelten PCR-Reaktion, die in zwei Schritten durchgeführt wird. In der ersten Multiplex-Reaktion Schritt einen Pool von 40 Primer speziell für die V-Beta-Ketten und einen Pool von 44 Primer speziell für alles, was die V-Alpha-Ketten verwendet werden, um die TCR-Alpha oder TCR-Beta ohne Vorkenntnisse der Sequenz (Tabelle 1) zu verstärken. Der forward Primer hat eine Adapter-Sequenz, die in der 5' des PCR Produktes aufgenommen wird. Die rückwärts-Primer basiert auf die konstante Region der TCR. Wir haben ermittelt, einzigartige Restriktionsschnittstellen, die aus menschlichen Variable oder Kreuzung TCR Regionen fehlen, und integriert diese in neu gestalteten TCRα und TCRβ Primern (Abbildung 1). In der zweiten verschachtelte Reaktion eine Grundierung, die spezifisch für die Adapter-Sequenz und einer verschachtelten rückwärts-Primer in der konstanten Region dienen weiter verstärken die TCR-Ketten mit erhöhte Spezifität (Tabelle 1, Abb. 1). Nach einzelnen Zelle isoliert, zwei Runden der PCR (erste Reaktion mit einem Pool von Vα und Vβ Primern, und zweitens mit Adapter Primern) führen ein PCR-Produkt, das direkt in die Vorlage retroviral Vektor Sub geklont werden kann. Das endgültige TCR-Konstrukt wird in eine einzelne offene Leserahmen (ORF), menschlichen Variablen Regionen kombiniert mit Maus konstante Regionen durch die "Self anhaftenden" Proteinsequenz verbunden kodieren P2A (hVα-mCα-P2A-hVβ-mCβ)8. Der P2A-Sequenz wurde in mehreren Systemen eingesetzt und wurde speziell für den Ausdruck von TCR8,9,10,11ausgiebig getestet. Obwohl, nach Übersetzung P2A Sequenz bleibt der Großteil an dem C-Terminus der alpha-Kette durch eine flexible Linker verbunden, während der Beta-Kette Signalsequenz eine zusätzliche Prolin, diese Änderung hat hat keine nachteiligen Auswirkungen auf die TCR-Funktion. Die konstante Region der Maus wird in das Konstrukt statt Menschen verwendet, um mögliche veränderte Interaktionen mit nachgeschalteten Signalisierung Komponenten zu vermeiden wenn wieder in Mauszellen exprimiert. Die einzige ORF führen stöchiometrische separater Ausdruck von Alpha- und Beta-Ketten9,11. Das aktuelle Protokoll basiert auf Reagenzien und Ansätze, die überall erhältlich sind, und soll in einer schlanken und effizienten Art und Weise durchgeführt werden. Obwohl wir diese Technik speziell zur TCR von selbstzersetzliche T-Zellen in autoimmune Diabetes verwickelt assay verwendet haben, erwarten wir, dass dieses Protokoll allgemein anwendbar zur Identifizierung und funktionelle Beurteilung menschlichen TCRs spezifisch für sind autoimmune Epitope, Krebs Epitope oder Reaktionen auf Krankheitserreger und Impfstoffe.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Identifizierung der T-Zell-Population von Interesse.

Hinweis: Antigen spezifischen Verbreitung in Kombination mit Zellteilung Farbstoff (z. B. Carboxyfluorescein Succinimidyl Ester, CFSE-) verwendet werden, kann um T-Zellen zu isolieren basierend auf ihre Verbreitung in Reaktion auf Antigene Stimulation. Wenn von PBMCs beginnen, eine 7-Tage in Vitro Expansion sollte ausreichen, um ein Antigen spezifische CFSE-geringe Bevölkerungsdichte 12 identifizieren.

  1. Mix PBMCs 1:1 mit MHC abgestimmt Feeder-Zellen und Aufkleber mit 5 µM CFSE-Zellteilung Farbstoff.
  2. Platte 2-2,5 x 10 5 Zellen pro Bohrloch in einer 96-Well Rundboden Kultur Platte in 200 µL 10 % FCS komplette RPMI Medien.
    Hinweis: Enthält komplette RPMI, 2 mM l-Glutamin, 1 mM Natrium Pyruvat, 100 µM MEM nichtessentiellen Aminosäuren, 5 mM HEPES, 5,5 × 10 − 5 Einheiten von 2-Mercaptoethanol, 100 mL U − 1 Penicillin und 100 µg mL − 1 Streptomycin.
  3. Stimulieren Zellen mit 25 µM-Peptid-Antigen.
  4. Am vierten Tag der Kultur sorgfältig entfernen und ersetzen Sie 100 µL Medien.
    Hinweis: Ein optimaler Ansatz für Antigen-spezifische T-Zell-Erkennung ist die Verwendung von Peptid-HLA Tetramers 13. Tetramer Färbung ermöglicht eine gleichzeitige Beurteilung der Antigen-Spezifität sowie HLA-Beschränkung.

2. Richten Sie die einzelne Zelle Art.

  1. Perform kostenlos alle Verfahren in eine Kapuze oder einen bestimmten Bereich verstärkte Vorlage. Aliquoten Reagenzien zur Vermeidung von Kontaminationen, reinigen alle Arbeitsflächen und wenn möglich, Geräte mit 10 % Bleichmittel vor PCR Setup. Verwenden Sie Filter-Tips, RNAse und DNAse frei Reagenzien und Kunststoffe in der PCR und Vektor klonen Schritte. Wichtige Reagenzien finden Sie in der Tabelle der Materialien.
    Hinweis: Die Multiplex-PCR-Reaktion ist sehr empfindlich, und geringe Mengen an Verunreinigungen verstärkten Produkt führen können.
  2. Generieren der reversen Transkription-master-Mix durch die Kombination 10 x Funktelegrafie-Reaktion-Puffer, 25 X DNTPs, 9 U RT Enzym, 0,01 % Triton-X, 0,7 U RNAse-Inhibitor und 383 nM jeden RT TCR Grundierung (siehe Tabelle 1) in einem sterilen Pipettieren Reservoir. Machen Sie für jede 96-Well-Platte genügend master-Mix für 10 zusätzliche Reaktionen (insgesamt 106), zum Ausgleich von Flüssigkeitsverlust beim Pipettieren. Siehe Tabelle 2 für Reaktionskomponenten und Mengen pro Bohrloch.
  3. Vorbereitung einer 96-Well-PCR-Sammlung Platte für Zelle Sortierung nach 6 µL der reversen Transkription-master-Mix pro Bohrloch mit einer Mehrkanal-Pipette pipettieren. Halten Sie die Platte auf Eis oder in einem kalten Block.
  4. Zellen mit Antikörpern gegen Oberflächenmarker (wie CD3, und CD4 oder CD8 und CD3, jeweils 2 µg/mL, in Kombination mit Zellteilung Farbstoff oder Tetramer Färbung) Zelle beschriften.
  5. Art T-Zellen in einer Zelle pro Bohrloch, überspringen der zwölften Reihe, die als Negativkontrolle dienen wird.
    Hinweis: Die Effizienz der Art präzise Erfassung Platte Ausrichtung innerhalb der Kennzeichenhalter, sowie die Aufrechterhaltung der Zellen und die Platten bei niedriger Temperatur vor der cDNA Reaktion abhängig. Sammlung Platten sollte auf dem Eis zu allen Zeiten, außer gehalten werden beim Sortieren, wenn sie innerhalb der Kühlplatte behoben werden. Nicht alle Sortiermaschinen verfügen über eine Temperatur geregelte Kennzeichenhalter; Allerdings ist die Verwendung eines dringend empfohlen. Da die Art in der Regel ca. 10-15 min pro Platte dauert, gibt es ein erhöhtes Potenzial für RNA-Abbau, wenn die Platte nicht bei einer niedrigen Temperatur beibehalten wird.
  6. Als Positivkontrolle, eine größere Anzahl von Zellen (100) manuell hinzufügen mit einer Pipette zu einem der Brunnen in diesem Stadium. Alternativ zuvor isolierten RNA aus gepoolten Zellen kann verwendet werden als Positivkontrolle bei 10 ng pro Bohrloch.
    Hinweis: Pipette gereinigten Kontrolle RNA mit Präzision und Pflege zur Vermeidung von Kreuzkontamination anderer Brunnen und falsch-positive Ergebnisse.
  7. Dichtplatte mit Klebefolie und spin-down bei 1000 X g für 5 min bei 4 ° c
  8. Sofort zu transkribieren RNA in cDNA durch Inkubation der Platte bei 25 ° C für 10 min, 37 ° C für 45 min und 85 ° C für 10 min.
    Hinweis: Um effiziente PCR-Reaktion zu gewährleisten, wird empfohlen, dass die erste PCR-Reaktion am selben Tag durchgeführt werden. Alternativ können die transkribierten Platten im-80 ° C bis zu 2 Monate gehalten werden.

3. Multiplex-nested PCR durchführen

Hinweis: bereiten Sie alle Meister Mixe in eine saubere Vorlage-freien Zone zur Vermeidung von Kontaminationen.

  1. Stellen jede Variable Region Grundierung bis 100 µM mit DNAse und RNAse frei H 2 O. Als nächstes kombinieren Sie 20 µL jedes der 44 Primer, den V-Alpha-Grundierung-Pool zu generieren. Um die V-Beta zu generieren Grundierung Pool kombinieren 20 µL jeder der 40 V-Beta-Primer plus 80 µL DNAse und RNAse frei H 2 O. Primer Sequenzen in Tabelle 1 aufgeführt sind. Sobald gebündelt, die Konzentration des jedes Primers in der Mischung ist 2,3 µM.
  2. Rekonstruieren die konstante Region Primer zu 100 µM-Stammlösung mit DNAse und RNAse frei H 2 O. verdünnt die konstante Region Primer 10 µM Arbeitslösung und aliquoten einsetzbar.
  3. Zwei separate master Mischungen vorbereiten TCR-Alpha und TCR-Beta-Verstärkung. Die master-Mixes zu erzeugen, durch die Kombination von 5 X buffer, 80 µM dNTPs, 3 % DMSO, 2 µM Grundierung Pool (Endkonzentration von 46 nM für jede Grundierung), 200 nM TCR-konstante Region rückwärts-Primer, 1 U DNA-Polymerase und DNAse und RNAse frei H 2 O (Tabelle 2 < / starke >). Für jede 96-Well-Platte machen genügend master-Mix für 10 zusätzliche Reaktionen (insgesamt 106), Ausgleich für den Verlust von Flüssigkeit beim Pipettieren.
    Hinweis: Die Berechnungen basieren auf der PCR Endvolumen von 25 µL pro Bohrloch, wo 22,5 µL master PCR-Mix mit 2,5 µL cDNA-Vorlage kombiniert wird.
  4. Halten die Platte mit cDNA auf Eis oder in einem kalten Block. Mithilfe einer Mehrkanal TCR-Beta-Reaktion in eine neue 96-Well-PCR-Platte 22,5 µL pipette. Verwenden Sie dann ein Multichannel 2,5 µL cDNA in die PCR-Platte übertragen.
  5. Verwenden, eine Mehrkanal um 22,5 µL der TCR-Alpha Reaktion direkt in die Platte mit dem Rest der cDNA pipette.
  6. Dichtung die Platten mit Klebstoff, sanft Wirbel und Spin nach unten bei 1000 X g für 5 min bei 4 ° c
  7. Die Multiplex-PCR-Reaktion mit den folgenden Zyklen laufen: 5 min bei 95 ° C gefolgt von 34 Zyklen von 20 s bei 95 ° C, 30 s bei 54 ° C und 1 min bei 72 ° C, gefolgt von 7 min bei 72 ° c
  8. Tragen, die verschachtelten PCR-Reaktion in einem Endvolumen von 25 µL, 2,5 µL der Multiplex-PCR Mischung als Vorlage verwenden.
    1. Rekonstruieren die internen und Adapter Primer bis 100 µM mit DNAse und RNAse frei H 2 O. machen 10 µM Aliquote für den arbeitenden bestand.
    2. Zwei separate master Mischungen vorbereiten TCR-Alpha und TCR-Beta amplifizierung. Mix 5 X Puffer, 25 X DNTP, 3 % DMSO, 200 nM vorwärts Adapter Grundierung, 200 nM rückwärts verschachtelte-Primer, 1 U DNA-Polymerase und DNA-Polymerase und Nuklease-freie H 2 O für ein Endvolumen von 22,5 µL (Tabelle 2). Für jede 96-Well-Platte machen genügend master-Mix für 10 zusätzliche Reaktionen (insgesamt 106), zum Ausgleich von Flüssigkeitsverlust beim Pipettieren.
      Hinweis: Bei der zweiten PCR Reaktion Verwendung der 5 X PCR Puffer mit Beladung Farbstoff Agarosegel beladen zu erleichtern.
    3. Mit einer Mehrkanal pipette die master Mischungen für die TCR-Alpha und TCR-Beta-Reaktionen auf 22,5 µL pro Bohrloch in zwei neue 96-Well-PCR-Platten.
    4. Fügen Sie die Multiplex-PCR-Reaktion-Vorlage am 2,5 µL pro Bohrloch.
      Hinweis: Die verbleibenden erste PCR Reaktion sollten versiegelt und bei-20 ° C dienen als Quelle für zusätzliche Vorlage gespeichert, falls es nötig (siehe Schritt 4.3 Hinweis).
    5. Dichtung der Platten, sanft Wirbel und Spin down 1000 X g für 5 min bei 4 ° c
    6. Die verschachtelte PCR-Reaktion mit den folgenden Zyklen laufen: 5 min bei 95 ° C gefolgt von 34 Zyklen von 20 s bei 95 ° C, 30 s bei 56 ° C und 1 min bei 72 ° C, gefolgt von 7 min bei 72 ° c
    7. Laufen 5 µL der letzten Reaktion, auf eine 1 % Agarose-gel mit Interkalation Bromid (einschließlich der negativen und positiven Kontroll-Vertiefungen).
      Hinweis: Die erwartete Band sollte bei rund 500 bp Größe ausgeführt. Eine Beispiel-Reaktion ist in Abbildung 2 gezeigt.
    8. Reinigen den Rest der zweiten Reaktion (20 µL) mit einem 96-Well-Format PCR Reinigung Kit, Eluieren mit 15 µL von 70 ° C H 2 O pro Bohrloch, und führen Sie Sanger Sequenzierung. Verwenden Sie die entsprechende TCR-Alpha oder TCR-Beta-Adapter vorwärts Primer für die Sequenzierung (Tabelle 1).
      Hinweis: Sequenzen mit online verfügbaren Immungenetik Software analysiert werden können.

4. Alpha- und Beta-PCR-Ketten vor-Klonen.

Hinweis: der Pool die forward Primer verwendet in der ersten Reaktion und die reverse Primer in der zweiten PCR-Reaktion werden verwendet, um Restriktionsschnittstellen zu integrieren. Daher die erhaltenen Alpha- und Beta-Kette PCR-Produkte sind bereit, sequenziell Sub geklonten in der Vorlage retroviral Vektor ( Abbildung 1).

  1. Digest der gereinigten PCR-Produkte aus der Beta verschachtelt Reaktion mit BstbI und MfeI (Tabelle 3).
    Hinweis: Nicht mehr als 5 µg einfügen.
  2. Parallel zu verdauen die Vorlage Vektor mit BstbI und MfeI (Tabelle 3). Verwenden Sie 1-2 µg des Vektors Vorlage pro TCR. Führen des verdauten Vektors auf einem Agarosegel, und die größeren Band (~ 7500 bp) zu isolieren. Reinigen den Vektor mit einem DNA-Reinigung-Kit-Gel.
    Hinweis: Während das Restriktionsenzym verdauen, die Vorlage murine TCR-Beta-Variable Region entfernt, ermöglicht die Zugabe der menschlichen TCR-Beta-Variable Region.
  3. Reinigen die verdaute PCR-Produkte mit einem PCR Reinigung Kit.
    Hinweis: Vergewissern Sie sich die DNA Reinigungskapazität der im Kit enthaltenen Spalten; Verwenden Sie mehrere Spalten, wenn nötig. Der Mindestbetrag für einen gereinigten Einsatz notwendig für eine erfolgreiche Unterbindung Reaktion ist 50 ng auf eine minimale Konzentration von 10 ng/µL. Wenn die gereinigte Insert-Menge für eine erfolgreiche Verbindung nicht ausreicht, kann die zweite PCR Reaktion wiederholt werden.
  4. Behandlung den Vorlage Vektor mit 10 U CIP-Enzym für 1 h bei 37 ° C zu verhindern selbst Ligation, gefolgt von Hitzeinaktivierung für 10 min bei 75 ° c zu reinigen die DNA mit einem PCR-Reinigung-Kit (Tabelle 3).
  5. Ligate TCR-Beta einfügen und Vektor-DNA-Ligase in einem Gesamtvolumen von 20 µL bei 6 Molaren Überschuss des Einsatzes für 30 min bei Raumtemperatur mit.
    Hinweis: Insgesamt die Ligatur Reaktion sollte enthalten ca. 150 ng DNA (Tabelle 3).
  6. Für Transformationen, mix 8 µL der Ligatur Reaktion mit 80 µL chemisch kompetenten e. coli DH5α Zellen (Table of Materials) und inkubieren Sie für 30 min. Hitzeschock bei 42 ° C für 45 S. hinzufügen 500 µL auf Eis Super Optimale Brühe mit Catabolite Unterdrückung (S.O.C.) Medium und schütteln für 1,5 h bei 37 ° c
  7. Platte, 250 µL Bakterienkultur auf einem Ampicillin, Lysogeny Brühe (LB) Nährbodenplatte enthält. Inkubieren Sie die Platte über Nacht (~ 16 h) bei 37 ° c
  8. Am nächsten Tag abholen Bakterienkolonien und wachsen sie in 3 mL LB-Medium mit Ampicillin über Nacht. Isolieren die Plasmid-DNA mit DNA Plasmid Reinigung Kit.
  9. Bestätigen die erfolgreiche Aufnahme der Beta-Kette durch einen kleinen Test-Digest mit Restriktionsenzymen BstbI und MfeI. Kombinieren Sie in einem 12 µL Gesamt Reaktionsvolumen 200-500 µg Plasmid DNA, 0,25 µL jedes Enzym und 10 X Enzym Puffer (Tabelle 3). Führen Sie die Reaktion heraus auf einem 1 % Agarosegel mit Interkalation Bromid um die Größe der Band einfügen zu bestätigen (~ 500 bp).
  10. Nach der Bestätigung der Anwesenheit des Einsatzes, Reihenfolge den TCR-Beta-Abschnitt des Vektors mit dem IRES-rückwärts-Primer (Tabelle 1).
  11. Nach Reihenfolge Bestätigung des TCR-Beta-Einsatzes, ein ähnliches Verfahren zum Einfügen der alpha Variable Region durchführen. Die gereinigten PCR-Produkte von alpha verschachtelte Reaktion und die neu erzeugten TCR-Beta-Einlage mit Vektor, mit SnaBI und SacII verdauen.
    Hinweis: Während das Restriktionsenzym verdauen, die Vorlage murine TCR-Alpha Variable Region entfernt, ermöglicht die Zugabe der menschlichen TCR-Alpha Variable Region.
  12. Ligate Alpha fügt in TCR Vektoren Codierung der entsprechenden Beta-Variable Region mit DNA-Ligase in einem Gesamtvolumen von 20 µL bei 6 Molaren Überschuss des Einsatzes für 30 min bei Raumtemperatur.
    Hinweis: Insgesamt die Ligatur Reaktion sollte enthalten ca. 150 ng DNA (Tabelle 3).
  13. Für Transformationen, mix 8 µL der Ligatur Reaktion mit 80 µL chemisch kompetenten e. coli DH5α Zellen (Table of Materials) und inkubieren Sie für 30 min. Hitzeschock bei 42 ° C für 45 S. hinzufügen 500 µL S.O.C. auf Eis Medium und schütteln für 1,5 h bei 37 ° c
  14. Platte, 250 µL Bakterienkultur auf einem Ampicillin, Lysogeny Brühe (LB) Nährbodenplatte enthält. Inkubieren Sie die Platte über Nacht (~ 16 h) bei 37 ° c
  15. Am nächsten Tag abholen Bakterienkolonien und wachsen sie in 3 mL LB-Medium mit Ampicillin über Nacht. Isolieren die Plasmid-DNA mit DNA Plasmid Reinigung Kit.
  16. Bestätigen die erfolgreiche Aufnahme der alpha-Kette von einem kleinen Test-Digest mit Restriktionsenzymen SnaBI und SacII. Kombinieren Sie in einem 12 µL Gesamt Reaktionsvolumen 200-500 µg Plasmid DNA, 0,25 µL jedes Enzym und 10 X Enzym Puffer (Tabelle 3). Führen Sie die Reaktion heraus auf einem 1 % Agarosegel mit Interkalation Bromid um die Größe der Band einfügen zu bestätigen (~ 500 bp).
  17. Nach der Bestätigung der Anwesenheit des Einsatzes, Reihenfolge den TCR-Alpha-Abschnitt des Vektors mit der MSCV2-Forward Primer (Tabelle 1).
  18. Nach der Überprüfung der alpha-Kette Reihenfolge überprüfen die komplette TCR einfügen durch Sequenzierung mit TCR-Beta-Reverse und IRES-Reverse Primer (Tabelle 1).

5. TCR Zelle Oberflächenexpression und Spezifität zu überprüfen.

Hinweis: HEK293T Zellen werden verwendet, um erfolgreiche TCR Kette Pari testenNG und Zelle Oberfläche Ausdruck ( Abbildung 3A) 8. Peptid-MHC Tetramer Färbung auf den transfizierten HEK293T Zellen zu testen, für die Aufbewahrung von Antigenen Spezifität Post TCR Genisolierung ( Abb. 3 b) durchgeführt werden.

  1. Platte aus HEK293T Zellen in 12-Well-Zellkultur-Platten auf 1 x 10 5 Zellen pro Bohrloch in 1 mL komplette DMEM Medien enthält 5 % FCS und Kultur über Nacht bei 37 ° c Platte genügend Zellen zu separate Brunnen für jeden neuen TCR benannt haben , Kontrolle Vorlage TCR Vektor, Vektor, CD3 Kontrolle TCR Vektor nur, und ein nicht-transfizierten gut.
    Hinweis: Transfektion mit einer voll Maus Vorlage TCR Vektor (mTCR-pMIA) in Kombination mit mCD3εγδζ-pMIG Vektor, mTCR-pMIA Vektor allein, und mCD3εγδζ-pMIG Vektor allein dienen als positive und negative Kontrollen.
    Hinweis: Vollständige DMEM enthält 2 mM L-Glutamin, 1 mM Natrium Pyruvat, 100 µM nicht-essentiellen Aminosäuren, 5 mM HEPES-Puffer, 5.5 x 10 -5 Einheiten von 2-Mercaptoethanol, 100 U/ml Penicillin/Streptomycin.
  2. Am Folgetag transfizieren Zellen mit 1 µg Chimären h/mTCR-pMIA-Vektor, 1 µg Maus CD3εγδζ-pMSCVII-GLP (pMIG) Vektor und Liposomen-basiertes Transfection Reagens nach Herstellervorschriften.
  3. Für jeden TCR 6 µL Transfection Reagens zu 100 µL Raumtemperatur serumfreien DMEM hinzufügen. Kurz Wirbel und Inkubation bei Raumtemperatur für 15 min.
  4. In separate 1,5 mL verbinden Rohre 1 µg der TCR-pMIA-Vektor mit 1 µg Maus CD3εγδζ-pMSCVII-GLP (pMIG) Vektor oder 1 µg jeden Vektor für Steuerelemente getrennt.
  5. Dropwise, die Transfection Reagens/DMEM Lösung hinzufügen das Röhrchen mit der Vektor-DNA. Inkubation bei Raumtemperatur für 15 min.
  6. Dropwise, fügen Sie die Transfection Reagens/DMEM/DNA-Lösung zu den HEK293T Zellen. Klopfen Sie leicht die Platte zu mischen. Inkubation bei 37 ° C für 24 h
  7. Nach 24 h ersetzen Sie die Medien, und halten Sie Zellen in Kultur für weitere 24 h.
  8. Zellen durch kräftig Pipettieren von der Platte zu entfernen, und färben Sie die Zellen mit Anti-Maus-CD3-Antikörper (2,5 µg/mL), Oberflächenexpression von Chimären-TCR durch Durchflusszytometrie zu überzeugen.
  9. Um CD3 Ausdruck zwischen Zellen vergleichen, die auf einem ähnlichen Niveau transfiziert wurden Tor die Analyse auf Zellen, die ein ähnliches hohes Maß an fluoreszierenden Reporter Moleküle (GFP für CD3 komplex und Ametrin für TCR Expressionsvektor) zum Ausdruck zu bringen. Optimalerweise sollte die Analyse auf GFP + Ametrin + Zellen innerhalb von 10 gated werden 4 bis 10 5 Fluoreszenz Intensität ( Abb. 3A).
    Hinweis: Die Höhe der CD3 Expression in Zellen mit Chimären Konstrukt transfiziert sollte die Kontrolle Maus (Originalvorlage) Vektor ( Abbildung 3A) vergleichbar sein. Die generierten TCR retroviralen Vektoren sind kompatibel mit in Vivo Expressionssysteme wie zuvor beschrieben 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die Effizienz der Multiplex-nested PCR Reaktion in Schritt 3.2.7 (Abbildung 2) Prüfung: 5µL die zweite Reaktion auf einem Agarosegel zur Neige. Im Durchschnitt ist die Effizienz der TCR-Beta-Verstärkung bei etwa 80 %, während die Effizienz der TCR-Alpha Reaktion in der Regel niedriger, bei etwa 50 ist % rechnen4. Nur paarweise TCR-Alpha und TCR-Beta-Ketten können für TCR Ausdruck verwendet werden; jedoch konnten alle PCR Produkte sequenziert werden, um TCR Sequenz und Repertoire-Informationen zu erhalten.

Gen-silencing erlauben nur eine einzelne TCR-Beta-Kette in einer bestimmten T-Zelle ausgedrückt werden. Jedoch eine T-Zelle ist in der Lage des Neuordnens einer zweiten TCR-Alpha-Kette, und etwa 25 % der T-Zellen wird mit dem Ausdruck einer zweiten im Rahmen TCR-Alpha Kette 14. Es wird erwartet, dass einige Anteil der isolierten TCR-Alpha-Ketten die sekundären Alpha statt der "richtigen" alpha-Kette werden. Die alpha Sekundärkette ist oft keine optimale Bindungspartner mit der TCR-Beta-Kette; Infolgedessen wird erwartet, dass nicht alle geklonten TCR eine stabile komplexe und express auf Zelloberfläche bilden werden. Daher hat die richtige TCR Kette koppeln und Zelle Oberflächenexpression von transfecting HEK293T Zellen (Abbildung 3A) bestätigt werden.

Figure 1
Abbildung 1 . Optimierte Multiplex-nested PCR und retroviralen Konstrukt Entwicklung von einzelnen T-Zellen. Zwei Runden von PCR Verstärkung der entsprechenden TCR-Alpha und Beta-Ketten führen. Eingebettet in die Primer Restriktionsschnittstellen ermöglichen optimierte vor-Klonen und Generierung von Chimären Mensch/Maus Vektor für die Expression in Mauszellen. Die Vorlage Maus Vektor lässt sich leicht Variable Maus Regionen für den menschlichen, erzeugen einen Chimären Mensch/Maus TCR retroviralen Vektor kompatibel mit Ausdruck in Mauszellen wechseln. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 . Beispiel für einzelne Zelle PCR. Multiplex-verschachtelten PCR Verstärkung der T-Zell-Rezeptor Beta- und Alpha-Ketten aus einzelnen menschlichen T-Zellen in einer 96-Well-Platte sortiert. Gezeigt werden entsprechende (oben und unten) PCR-Produkte von einzelnen Zelle verstärkt TCR-Beta und TCR-alpha-Ketten aus menschlichen PBMCs. NC - keine Vorlage Steuerung, PC - positiv-Kontrolle. Durch einen kleinen Teil der Reaktion auf einem Agarosegel (5 µL) ausgeführt, wird die Effizienz der einzelnen Zelle Alpha- und Beta-Kette PCR Reaktionen vor PCR-Produkt. -Sequenzierung bestätigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 . Überprüfung der Zelle Oberfläche Chimären TCR Ausdruck und Spezifität. (A) HEK293T Zelle wurden mit transfiziert Maus TCR oder ein Mensch/Maus Chimären TCR in Kombination mit der Maus CD3εγδζ. TCR Oberflächenexpression von Zellen wurde mit Anti-mCD3ε Antikörper gemessen. Anspritzung Strategie: Erstens ist die Analyse auf Ametrin und GFP doppelt positive Zellen (G2) eingezäunt. Im Falle der einzigen Vektor Kontrollen hat die Anspritzung auf die einzelnen Fluoreszenz (G1) beruhen. Zweitens werden die Zellen von der G1 und G2 auf der Ebene von CD3ε Ausdruck analysiert. (B) TCR Spezifität bestätigt Tetramer Färbung von 293T Zellen mit DRB1 * 0401:GAD115-127 Tetramer. Analyse ist wie in (A) dargestellt auf GFP + Ametrin + CD3ε + Zellen, eingezäunt. Bitte klicken Sie hier für eine größere Version dieser Figur.

ZIELGEN PRIMER-ORIENTIERUNG SEQUENZ
Reverse Transkription
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR-alpha-PCR-Reaktion 1
TRAV1-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Nach vorne CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC-extern Rückgängig zu machen CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR-Reaktion 1 TRBV2 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Nach vorne CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Nach vorne CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Nach vorne CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Nach vorne CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Nach vorne CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Nach vorne CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Nach vorne CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC extern Rückgängig zu machen GTGGCCAGGCACACCAGTGTG TCR-alpha-PCR-Reaktion 2 TRAC interne Rückgängig zu machen CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV-Adapter Nach vorne CGGTTCAGCAGGAATGCCtacgtaATG TCR-Beta PCR Reaktion 2 TRBC interne Rückgängig zu machen CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV Adapter Nach vorne CAGAAGACGGCATACGAGATcaattgATG Sequenzierung Primer pMSCV-II Nach vorne CCTCCTCTTCCTCCATCCGCC TCRbeta Rückgängig zu machen GCCAAGCACACGAGGGTAGCC IRES Rückgängig zu machen AACGCACACCGGCCTTATTCC * Kleinbuchstaben innerhalb der Primer-Sequenzen anzugeben, dass die eingebaute Restriktionsenzym Seiten schneiden

Tabelle 1: Reverse Transkription, PCR und Sequenzierung Zündkapseln.

Schritt 2.2 Mengen pro Bohrloch
RT-PCR-Reaktion (6μL) (ΜL)
10 X Puffer 0,6
2 X dNTP 0,24
10 % Triton X 0,06
3 TCR-spezifische Primer (10mM Ea.) 0,23 Stk. (x 3 = 0,69)
Enzym 0.18
RNase-inhibitor 0,28
NF(Nuclease-Free)-H2O 3.95
Schritt 3.1
ein PCR-Reaktion 1 (25μL) (ΜL) b PCR-Reaktion 1 (25μL) (ΜL)
5 X Puffer 5 5 X Puffer 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3 %) 0,75
ein Pool (F Primer) (2.3μM) 0,3 b-Pool (F Primer) (2.3μM) 0,5
eine externe R-Grundierung (10uM) 0,6 b externe R Grundierung (10μM) 1
DNA-polymerase 0,2 Taq Polymerase gehen 0,2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14,65 NF-H2O 14.05.
Schritt 3,8
PCR-Reaktion 2 - für gleich ein und b (25μL) (ΜL)
5 X Puffer 5
dNTP (10mM) 1
DMSO 0,75
Adapter F-Grundierung (10μM) 1
Interne R Grundierung (10μM) 1
DNA-polymerase 0,2
PCR-Rxn 1 Produkt 2.5
NF-H2O 13.55

Tabelle 2. Reversen Transkription und PCR-Reaktionen.

Schritt 4.2 und 4.3
TRBV Digest Reaktion (50μL) (ΜL) mTCR-pMIA-Vektor-Digest (500μL) (ΜL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Puffer 5 10 x Puffer 50
H2O H2O
4.4 Schritt
CIP-Reaktion (100μL) (ΜL) DNA(~1.5mg)
> Verdaut & gereinigt Vektor-DNA 84 10 x Puffer 10 CIP-Enzym 6 Schritt 4.5 Ligatur-Reaktion (20μL) (ΜL) Verdaut/CIPed Vektor-DNA (Gesamtbetrag einfügen und Vektor ist ~ 150ng) Einfügen von DNA (6 molare Zugang zum Vektor) 2 x Ligase Puffer 10 Ligase-Enzym 1 H2O Schritt 4,9 Digest Testreaktion (12μL) (ΜL) DNA (100-300ng) 1 MfeI 0,25 BstbI 0,25 10 x Puffer 1.2 H2O 9.3 Schritt 4.11 TRAV Digest Reaktion (60μL) (ΜL) Mit Beta - mTCR-pMIA-Vektor-Digest (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x Puffer 6 10 x Puffer 10 H2O H2O

Tabelle 3. Vektor klonen Reaktionen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das aktuelle Protokoll beschreibt eine effiziente Methode für einzelne Zelle TCR Verstärkung und nachfolgende vor-Klonen von gekoppelten TCR-Alpha und Beta-Ketten in eine Vorlage retrovirale Expressionsvektor. Obwohl mehrere einzelne Zelle PCR Protokolle entwickelt wurden, haben keine kompatibel mit sofortiger vor-Klonen in einem Ausdruck Vektor bisher. In den meisten Fällen wird eine Teilsequenz der hochvariablen CDR3 Regionen verstärkt, mit genügend Sequenz, die Variable Region zu extrapolieren. Dieser kleiner PCR-Produkt unterstützt höheren PCR-Effizienz, sondern erfordert de Novo TCR Gensynthese für funktionelle Studien. Das aktuelle Protokoll hält die Effizienz der bereits veröffentlichten CDR3 ausgerichtete Einzelzelle TCR Sequenzierung Protokolle, und gleichzeitig eine längere Amplifikate, enthält die gesamte Variable Region geeignet für das Klonen nachgeben. Das beschriebene System hat daher eine erhöhte Flexibilität geben eine quantitative Sequenz sowie funktionale Ausgabe.

Je nach Fragestellung behandelt variiert die Quelle und die Spezifität der T-Zellen analysiert. Allerdings, wenn das Ziel des Projekts die Analyse der in Vivo TCR Funktion ist, ist es notwendig zu wissen, die HLA-Einschränkung der isolierte T-Zellen. Das aktuelle Protokoll wurde speziell mit in Vivo TCR Ausdruck bei HLA-humanisierten Mäusen kompatibel sein. Viele dieser Mäuse generiert worden und sind jetzt im Handel erhältlich, einschließlich HLA-A2. 1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 und HLA - B * 0702 transgene Linien. Dieses Protokoll kann erfolgreich mit den zuvor veröffentlichten Protokoll für retrovirale vermittelten Knochenmark Stammzellen Ausdruck der menschlichen TCRs4,15,16kombiniert werden. Wir erwarten, dass humanisierte TCR Retrogenic System anwendbar und sehr nützlich für die Funktionsanalyse des menschlichen TCRs in verschiedenen Autoimmunerkrankungen, Krebs und Infektionskrankheiten Modelle.

Die aktuellen Einzelzelle PCR-Protokoll beschreibt die entscheidenden Schritte und gibt Anregungen für erfolgreiche Verstärkung von gekoppelten TCR-Alpha und TCR-Beta-Sequenzen. Der erste wichtige Schritt ist eine fristgerechte Erfüllung der cDNA Transkription und spätere erste Runde der Multiplex-PCR. Alle Schritte sollten in einer fristgerechten Weise durchgeführt werden, und alle Reagenzien und Zellen gehalten auf Eis, RNA und DNA-Abbau zu verhindern. Zweitens, weil das Protokoll sehr empfindlich auf ein niedriges Niveau der Vorlage werden soll, ist es sehr anfällig für Verschmutzung. Daher ist es zwingend notwendig, um in einer Vorlage-freie Gegend, abseits amplifizierten PCR-Produkte oder TCR Vektor klonen zu arbeiten. Einen separaten Raum oder Haube sollte verwendet werden, einrichten cDNA und PCR-Reaktionen. Vorlage aus der ersten PCR-Reaktion sollte hinzugefügt werden, in einem anderen Bereich aus dem die PCR eingerichtet ist. Es ist ratsam, ein separater Satz von regelmÄÑig Reagenzien für die einzelne Zelle PCR Experimente verwendet werden.

Dieses Protokoll wurde speziell optimiert mit Hilfe der Reagenzien in Tabelle Materialienaufgeführt, und Ersetzungen in Reagenzien erfordern zusätzliche Optimierung. Die ersten Ermittlung des Antigen-spezifische Zellen kann geändert werden, um Peptid-MHC-Tetramers verwenden. Tetramer Färbung ermöglicht eine gleichzeitige Beurteilung der Antigen-Spezifität sowie HLA-Beschränkung. Alternative Methoden zum Nachweis von Antigen Reaktivität, z. B. Hochregulation des frühen Aktivierungsmarker oder Sekretion von inflammatorischen Zytokinen können bei fehlender Tetramer Reagenzien betrachtet werden. Beispielsweise können duale Spezifität Fusion Antikörper spezifisch für eine T-Zell-Antigen und IFNγ mit magnetischer Wulst Isolation zu bereichern für Antigen reaktive IFNγ produzierenden Zellen kombiniert werden.

Während der Chimären Mensch/Maus-Konstrukt beschrieben in unserem Protokoll sorgt für Kompatibilität mit Mauszellen, ist das Niveau seiner Vereinbarkeit mit komplexen menschlichen CD3 unbekannte. Obwohl formal nicht von uns getestet, haben andere gezeigt, dass Chimären TCR-Konstrukte mit murinen konstante Regionen auf der Oberfläche des menschlichen Lymphozyten17ausgedrückt werden können. Dies bedeutet, dass murine TCR konstante Regionen Interaktion mit dem menschlichen CD3 Signalisierung komplexe unterstützen können. Wenn das Ziel der identifizierten TCR in menschlichen Primärzellen oder humanen Zelllinien, wie z.B. Jurkat-Zellen, zum Ausdruck bringen kann ein optimaler Ansatz jedoch, ein vollständig humaner Konstrukt zu verwenden. Dies kann durch Austauschen der murinen konstanten Regionen innerhalb des Vektors mit menschlichen konstanten Regionen erreicht werden.

Enthält eine identifizierte TCR Variable Region eines der Restriktionsschnittstellen verwendet für das Klonen, TCR in einen Shuttle-Vektor eingefügt werden soll und danach mutiert mit einer Website gerichtet Mutagenese Kit induzieren eine Stille Nukleotid-Änderung innerhalb der Einschränkung Schneiden Sie die Website. Ein alternativer Ansatz ist de-Novo -Synthese der TCR Variable Region des Interesses geändert, um die unerwünschte Einschränkung Website ausschließen.

Die wichtigste Einschränkung dieser Technik ist die Unfähigkeit, Verstärkung der sekundären "cytoplasmatische" alpha-Ketten zu beseitigen. TCR-Alpha Gene gehen durch allelic Ausschluß wie TCR-Beta-Gene, so Sie kein erheblicher Anteil der T-Zellen eine sekundäre "cytoplasmatische" alpha-Kette14zum Ausdruck bringen wird. Die beschriebenen PCR-Protokoll führt nur zu Verstärkung von einem TCR alpha-Kette, aber wenn die verstärkte alpha-Kette "cytoplasmatische" alpha Kette, die es nicht mit der verstärkten Beta-Kette koppeln kann. Daher ist es unerlässlich, TCR Zelle Oberflächenexpression in HEK293T Zellen darauf erfolgreiche Paarung zu testen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Studie wurde von JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30-DK079638-05-PILOT PJ, and The Robert und Janice McNair Foundation finanziert.

Wir danken Sandra Pena und Andrene McDonald für Rekrutierung von Patienten, Samuel Blum für technische Hilfe, Dr. George Makedonas für die Gabe von Antikörpern und Kontrolle DNA für die PCR Optimierung verwendet.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Optimierte Einzelzelle TCR Isolation und Generierung von retroviralen Vektoren für <em>In-Vitro </em>und <em>In Vivo</em> Ausdruck menschlichen TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter