Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

לימוד מחזור גנים ביטוי מוסדר על ידי שני פרוטוקולי סינכרון התא

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

אנו מדווחים על שני פרוטוקולים של סינכרון תאים המספקים הקשר ללימוד אירועים הקשורים לשלבים ספציפיים של מחזור התא. אנו מראים כי גישה זו שימושית לניתוח הרגולציה של גנים ספציפיים במחזור תאים לא מופרע או בחשיפה לסוכנים המשפיעים על מחזור התא.

Abstract

התוכנית ביטוי גנים של מחזור התא מייצג צעד קריטי להבנת התהליכים תלוי מחזור התא ואת תפקידם במחלות כגון סרטן. התא מחזור מוסדר ניתוח ביטוי גנים תלוי בסנכרון התא לשלבים ספציפיים. כאן אנו מתארים שיטה ניצול שני פרוטוקולים סינכרון משלימים כי הוא נפוץ בחקר וריאציה תקופתית של ביטוי גנים במהלך מחזור התא. שני ההליכים מבוססים על חסימה זמנית של מחזור התא בנקודה אחת מוגדרת. פרוטוקול הסינכרון על ידי הידרוקסיאורה (HU) מוביל לתא סלולרי בסוף שלב G1 / מוקדם S, ושחרור ממעצר HU מתווך מספק אוכלוסייה סלולרית מתקדם באופן אחיד באמצעות S ו- G2 / M. פרוטוקול הסינכרון על-ידי טיפול ב- thymidine ו- nocodazole (Thy-Noc) חוסם תאים במיטוזה מוקדמת, ושחרור ממעצר Thy-Noc בתיווך מספק אוכלוסיה סלולרית מסונכרנת המתאימה לשלב G1 ו- S שלבEvacpid יישום של שני הליכים דורש ניטור של פרופילי הפצה מחזור התא, אשר מבוצעת בדרך כלל לאחר propidium יודיד (PI) מכתים של התאים זרימת cytometry בתיווך ניתוח של תוכן ה- DNA. אנו מראים שהשימוש המשולב בשני פרוטוקולי סינכרון הוא גישה חזקה לבירור ברור של הפרוטוקולים התעתיקיים של גנים המווסתים באופן דיפרנציאלי במחזור התא ( כלומר E2F1 ו- E2F7), וכתוצאה מכך יש הבנה טובה יותר של תפקידם במחזור התא תהליכים. יתר על כן, אנו מראים כי גישה זו שימושית עבור מחקר של מנגנונים המבוססים על תרופות מבוססות תרופה ( כלומר, mitomycin C, סוכן antiancer), משום שהוא מאפשר להפלות גנים כי מגיבים סוכן genotoxic מאלה שהושפעו רק על ידי הפרעות מחזור התא שהוטל על ידי הסוכן.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

המעבר דרך כל השלבים של מחזור התא הוא מצורף לתוכנית ביטוי הגן מוסדר היטב. זה מתואמת "לסירוגין" של שעתוק גנים ברחבי מחזור התא הוא האמין להיות תחת שליטה של ​​מערכות תמלול מורכבות תעתיק, המסדיר לא רק את העיתוי, אלא גם את רמות ביטוי גנים. הדה-רגולציה של מרכיבי מחזורי התא העיקריים ידועה כתורמת להתפתחותן של מספר מחלות והיא סימן ההיכר המובהק של tumorigenesis 1 , 2 . ניתוחי גנום רחבי תמליל שבוצעו בתאי שמרים ותאי יונקים גילו שמספר רב של גנים מציגים דפוסי ביטוי גנטיים מחזוריים במחזור התא, דבר המצביע על כך שתנודות תעתיק במהלך מחזור התא משקפות את הדרישה הטמפורלית של מוצר גנטי נתון בשלב 3 , 4 , 5 .

משימה מרכזית בחקר מחזור גנים מוסדר במחזור גנים היא סינכרון של תאים לשלבים ספציפיים של מחזור התא. סינכרון תאים מסייע לפרש את ההתאמה של דפוס ביטוי גנטי לתא מסוים של מעבר מחזורי התא, והוא הוביל להבנה טובה יותר של הרגולציה והתפקוד של גנים רבים. סינכרון סלולרי חשוב גם לחקר מנגנון הפעולה של תרופות נגד סרטן, כמו סוכני כימותרפיה ידועים להשפיע הן ביטוי גנים כמו גם מחזור תאים קינטיקה 6 , 7 . עם זאת, לעתים קרובות קשה לקבוע אם הפרשי ביטוי גנים הנובעים מטיפול בסוכנים אלה הם תגובה ישירה לטיפול או שהם רק תוצאה של שינויים בפרופילי מחזור התא. כדי להבחין בין האפשרויות הללו, ביטוי גנים צריך להיות מנותח בתאים שהיו sYnchronized לפני תוספת של תרופה כימותרפית.

למעט כמה תאים ראשוניים כגון תאים לימפואידים מבודדים טרי, אשר מהווים אוכלוסיית תאים הומוגנית מסונכרן G0 8 -, במבחנה הוקמה שורות תאים לגדול באופן אסינכרוני בתרבות. תחת תנאי צמיחה רגילים, אלה אופניים אסינכרוני אופניים נמצאים בכל השלבים של מחזור התא אבל, מעדיפים G1 9 . לכן, הקשר זה אינו מספק תרחיש אופטימלי עבור ניתוח פונקציונלי או ביטוי גנים בשלב מחזור תא מסוים ( לדוגמה , G1, S וכו '). שורות תאים נצחיות שלא הוסבו ( כגון fibroblasts) ניתן לסנכרן עם מה שמכונה שיטות פיזיולוגיות 10 . שיטות אלה מבוססות על תכונות התא העיקרי שנשמר של תאים שאינם משנים, כגון עיכוב קשר עם תא ותלות גורם גדילה כדי להמשיך את רכיבה על אופניים. הֲסָרָהשל סרום בשילוב עם עיכוב מגע הופך תאים שאינם הופכים נעצרו ב G0 / G1. עם זאת, מסומן מחזור מחזור התא התקדמות לעתים קרובות דורש תת, אשר כרוך גם ניתוק מלאכותי של תאים מחדש ציפוי 10 . והכי חשוב, שיטה זו אינה מתאימה לסינכרון של שורות תאים שהשתנו, הרוב המכריע של שורות תאים מבוססות הנמצאות בשימוש, המאופיינות בחסרונם של עיכובים בצמיחת מגע בתא או בתגובה לנסיגת גורמי גדילה. לכן, ברור כי שיטות חלופיות נדרשים סינכרון תא יעיל בשלבים ספציפיים של מחזור התא. באופן כללי, שיטות הסינכרון הנפוצות ביותר מבוססות על עיכוב כימי זמני או פרמקולוגי של נקודה מוגדרת אחת של מחזור התא, בדרך כלל סינתזה של DNA או יצירת ציר מיטוטי. עיכוב של סינתזת דנ"א מסנכרן תאים על ידי מעצר אותם בסוף G1 או בשלב S מוקדם. זה יכול להיות achiEved על ידי הוספת תרכובות כגון mimosine, מעכב של ביוטוסיזה של נוקליאוטיד 11 , 12 , aphidicolin, מעכב של פולימרים 13 , 14 , hydroxyurea, מעכב של ribonucleotide רדוקטאז 15 , 16 או על ידי כמויות עודפות של תימידין 17 , 18 . מצד שני, מעכבי פילמור microtubule, כגון קולצ'יצין או nocodazole, מסוגלים לחסום היווצרות ציר מיטוטי המוביל סינכרון התא בשלב M מוקדם 19 , 20 , 21 .

בעבודה זו אנו מתארים שיטה המערבת שני פרוטוקולים סינכרון משלימים המבוססים על עיכוב כימי חולף ללימוד הביטוי של גנים מחזורי מוסדר מחזור התא ב mRNAרָמָה. שיטה זו היא בסיסית להגדרת תפקידם של גנים במחזור תאים בתהליכי מחזור תאים ספציפיים. יתר על כן, הוא מספק מסגרת כללית לחקר ההשפעה של טיפולים נגד סרטן כדי לזהות במדויק את הגנים המגיבים לתרופות ולמזער הפרעות שגויות הנגזרות מהפרעות בתהליכי מחזור התא שנוצרו על ידי תרופות אלו.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. סינכרון נייד, שחרור ומעקב של התקדמות מחזור התא

  1. תימידין ו- nocodazole מבוססי (Thy-Noc) סינכרון ושחרור של תאים U2OS מ מיטוזה
    1. הכינו המדיום הנדרש לתרבות תאים. תאים U2OS גדלים באופן שגרתי ב DMEM- גלוטמין בינוני השלימו עם 10% (Vol / Vol) FBS (אופציונלי: 1% פניצילין / סטרפטומיצין). בצע את כל ההכנה בינוני מניפולציה בתנאים סטריליים ולחמם בינוני השלימה (מעתה ואילך המכונה "בינוני מלא") עד 37 מעלות צלזיוס לפני השימוש.
    2. זרע 2 x 10 6 תאים U2OS לכל צלחת 100 מ"מ במדיום 10 מ"ל תרבות מלאה. כדי לחשב את מספר הכלים הדרושים, יש לקחת בחשבון כי כל צלחת 100 מ"מ בדרך כלל מספק מספיק תאים מיטוטיים לצלחת מחדש כ 5 בארות של צלחת 6 באר (0.2 - 0.25 x 10 6 תאים / טוב) (ראה איור 1 ב ). שתי בארות לכל נקודת זמן שנבחרו הם requirאד בניסוי (1 גם עבור מיצוי רנ"א 1 גם לניטור מחזור התא). בנוסף, טוב השלישי ניתן לאסוף בכל נקודת זמן עבור ניתוח חלבון.
      הערה: תאים צלחת בערב (בסביבות 7 בערב), כך הצעדים הבאים ניתן לבצע בשעות העבודה בימים הבאים. כלול 2 בארות נוספות של תאים גדל באופן אסינכרוני להגדיר הגדרות פיצוי FACS ניתוח.
    3. בואו תאים לצרף על ידי דוגרים 100 מנות מ"מ על 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 עבור 24 שעות.
    4. עבור בלוק תימידין, להכין פתרון 200 מ"מ thymidine המניות על ידי המסת אבקת תימידין 145.2 מ"ג ב 3 מ"ל H 2 O (או כמויות שווה) ולעקר את הפתרון על ידי סינון באמצעות 0.2 מיקרומטר מסנן גודל הנקבוביות. התחממות קלה עשויה לעזור להמיס תימידין. הוסף 100 μL של 200 מ"מ טרי מוכן טרי לכל צלחת 100 מ"מ תרבות (ריכוז סופי 2 מ"מ). דגירה תאים עם תימידין במשך 20 שעות ב 3776; C באווירה humidified עם 5% CO 2 .
      הערה: לטפל בתאים בערב (בסביבות 7 בערב), יש לי זמן לבצע הן שחרור thymidine ו nocodazole לחסום למחרת.
    5. כדי לשחרר את בלוק thymidine, להסיר בינוני thymidine המכיל צמיחה בשעות אחר הצהריים של היום הבא (15:00); לשטוף תאים פעמיים עם חימם מראש 1x PBS ולהוסיף 10 מ"ל של המדיום המלא לכל צלחת 100 מ"מ. דגירה תאים 5 שעות ב 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 .
    6. למעצר תא מיטוטי, להוסיף nocodazole לריכוז סופי של 50 ng / mL (8 בערב). הכן פתרון המניות על ידי המסת אבקת nocodazole ב DMSO ( למשל 5 מ"ג / מ"ל) ולאחסן בחנות ב -20 מעלות צלזיוס. דגירה תאים עם nocodazole לא יותר מ 10-11 שעות ב 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 .
    7. שחרור ממעצר בתיווך nocodazole בשלב M בשלב מוקדם (מיטוטי לנער- off) ואוסף של דגימות בכמה poi זמןNts (החל בשעה 6-7 בבוקר).
      1. לנתק מעוגלות (תאים מיטוטים) על ידי רעד כל צלחת בעדינות pipetting nocodazole המכיל בינוני צמיחה. איסוף בינוני עם תאים מנותקים מכל צלחת 100 מ"מ לתוך 50 צינורות סטרילי מ"ל, צנטריפוגות (300 xg, 5 דקות, טמפרטורת החדר (RT)), לשטוף תאים פעמיים על ידי הוספת 1x PBS ואחריו צנטריפוגה. שימוש קר PBS או PBS בתוספת nocodazole מומלץ להימנע slipage מיטוטי (ראה סעיף דיון).
      2. Resuspend תאים מיטוטיים נאספו כל צלחת 100 מ"מ 10 מ"ל של המדיום המלא. שמור 2 מ"ל עבור מיצוי RNA ו 2 מ"ל עבור ניתוח FACS עבור נקודת זמן 0 h (כ 0.2-0.25 x 10 6 תאים לכל מדגם).
      3. Re-plate שנותרו תאים מיטוטיים עבור נקודות זמן לאחר מכן 6 צלחות היטב (2 מ"ל / טוב, 0.2-0.25 x 10 6 תאים / טוב).
        הערה: זכור כי 2 בארות נדרשים לנקודת זמן שנבחרה (1 עבור RNA ו 1 לניתוח FACS).
    8. איסוף דגימות ב selEcted נקודות זמן. כל 1.5 עד 3 שעות מומלץ על מנת לקבל פרופיל הולם של התקדמות מחזור התא.
      1. עבור מיצוי RNA, להסיר בינוני, לשטוף היטב עם 2 מ"ל מראש חם 1x PBS ולהוסיף 1 מ"ל של מגיב בידוד RNA מתאים ( למשל TRIzol) בבאר (בצע את השלב האחרון בארון בטיחות עבור כימיקלים). פיפטה למעלה ולמטה כדי לנתק תאים lyse, להעביר lysate תא צינור microcentrifuge 1.5 מ"ל, דגירה 5 דקות ב RT ו חנות החנות ב -80 מעלות צלזיוס עד לשימוש נוסף.
      2. עבור ניתוח FACS, לשטוף היטב עם 2 מ"ל לפני החום 1x PBS, להוסיף מראש חימם פתרון טריפסין- EDTA (0.3 מ"ל / טוב) לנתק תאים, לחסום Trypsin-EDTA על ידי הוספת בינוני 1 מ"ל מלא ולאסוף כל מדגם נפרד צינור 15 מ"ל.
        1. צנטריפוגה תאים (300 xg, 5 דקות, RT), לשמור גלולה הסלולר וזורקים supernatant. כדי לתקן תאים, תאים resuspend ב 1 מ"ל של צונן 70% (V / V) אתנול 1x PBS ידי צינורות vortexing בעדינות, ומניחים אותם על הקרח עבור היישוםבערך 15 דקות לפני אחסון ב 4 ° C או מכתים לניתוח נוסף על ידי FACS (המתואר צעדים 1.4 - 1.5).
  2. HU מבוסס סינכרון ושחרור של תאים U2OS מן הגבול G1 / S
    1. הכן את המדיום מלא תרבות התא כפי שתואר בשלב 1.1.
    2. זרעים 0.25 x 10 6 תאים U2OS לכל טוב 6 צלחות גם (2 מ"ל תרבות בינוני מלא לכל טוב). כדי לחשב את מספר הבארות הדרושות לניסוי, יש לקחת בחשבון כי 2 בארות יידרשו לכל נקודת זמן שנבחרה (1 גם עבור מיצוי רנ"א 1 גם לניטור מחזור התא) וכי 2 בארות נוספות של תאים גדל באופן אסינכרוני הם צריך להגדיר הגדרות פיצוי FACS ניתוח.
    3. בואו תאים לצרף על ידי דוגרים 6-גם צלחות לילה (O / N) ב 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 .
    4. הסר בינוני מלא מבארות למחרת בבוקר ולהוסיף 2 מ"לשל חימם מראש FBS ללא DMEM- גלוטמין בינוני לכל טוב. דגירה תאים במשך 24 שעות נוספות ב 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 .
      הערה: בצע שלב זה בכל הבארות למעט 2 (אלה שנשמרו כדי להגדיר הגדרות FACS). צעד נסיגה בסרום ניתן להשמיט אם סינכרון יעיל מושגת על ידי הדגירה פשוטה תאים עם HU.
    5. G1 / S מחזור מחזור המעצר עם HU.
      1. הכן טריים פתרון מניות HU (500 מ"מ) לפני כל שימוש. הוסף 2 מ"ל H 2 O ל 76.06 מ"ג אבקת HU ומערבבים עד מומס ביסודיות. לעקר את הפתרון על ידי סינון באמצעות 0.2 מיקרומטר גודל הנקבוביות מסנן. מערבבים 50 מ"ל של המדיום המלא עם 400 μL של מסנן מעוקרים פתרון מניות HU לריכוז HU הסופי של 4 מ"מ.
      2. הסר בינוני מכל בארות למעט 2 הבארות הדרושים להגדרת הגדרות FACS ולהחליף עם מוכן 4 מ"מ HU המכיל בינוני מלא (2 מ"ל / טוב).
      3. דגירה תאים עבור 24 שעות בHU המכיל בינוני ב 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 .
    6. שחרור של תאים מהמעצר מתווך HU. הסר בינוני המכיל HU מבארות לשטוף בארות פעמיים עם חימם מראש 1x PBS (2 מ"ל בכל פעם). הוסף 2 מ"ל של המדיום המלא לכל טוב. איסוף 2 דגימות עבור נקודת זמן 0 h (1 עבור החילוץ RNA ו 1 עבור מעצר תא מעצר אימות על ידי FACS), כמו גם 2 דגימות שנשמרו עבור הגדרות FACS. מקום בארות הנותרים בחממה.
    7. איסוף דגימות כל 1.5 עד 3 שעות על מנת להשיג חלוקה נאותה של מחזור מחזור התא. בכל נקודת זמן, לבצע עיבוד מדגם (עבור מיצוי RNA ו FACS ניתוח) כמתואר 1.1.8.1-1.1.8.2.
  3. טיפול בסוכני דנ"א
    הערה: בכל פעם שהמטרה היא להבהיר את ההשפעה של תרכובת ( כגון חומרים מזיקים של DNA) באירועי מחזור תאים, כל אחת משיטות הסינכרון המתוארות לעיל יכולה להיותבשילוב עם טיפול בתאים עם סוכן genotoxic. כדי לבחור את שיטת הסנכרון, חשוב לשקול את השלב של מחזור התא שאנחנו רוצים לנתח. באופן כללי, ההליך Thy-Noc עשוי להתאים את ההשפעה של תרכובת בשלב G1 או שלב שלב S בזמן סינכרון HU בתיווך עשוי להיות מתאים יותר ללמוד את ההשפעה של S ל G2 שלבים או בכניסה מיטוזה.
    1. ניתוח ההשפעה של חומרים genotoxic בשלב G1 או שלב שלב S
      1. סנכרן תאים כמתואר בסעיף 1.1.2. 1.1.6.
      2. שחרר תאים מ nocodazole מחדש צלחת אותם כמתואר 1.1.7. דגירה אותם על 37 מעלות צלזיוס באווירה humidified עם 5% CO 2 במשך 3 שעות לתת להם לצרף לפני הוספת סוכן (תקופת הדגירה נדרש עשוי להשתנות בהתאם לקו התא).
      3. הוסף סוכן לאסוף דוגמאות כפי שתואר לעיל 1.1.8.
    2. ניתוח ההשפעה של סוכנים genotoxic ב SG2 שלבים או כניסה M
      1. סנכרן תאים כמתואר בסעיף 1.2.2. כדי 1.2.5.
      2. שחרר תאים מ HU כמתואר 1.2.6. ולהוסיף סוכן ישר.
      3. איסוף דגימות כפי שתואר לעיל 1.8.
  4. ניטור של סינכרון התא התקדמות דרך מחזור התא על ידי propidium יודיד (PI) מכתים וניתוח FACS
    הערה: הדגימות שנאספו בכל נקודות הזמן יחד עם אלה הדרושות להגדרת הגדרות FACS ניתנות לאחסון ב 4 ° C לאחר תיקוןן (כאמור בסעיף 1.1.8.2). בצע מכתים עם פתרון PI ואחריו ניתוח FACS עבור כל דגימות של הניסוי בו זמנית. PI intercalates לתוך החריץ העיקרי של ה- DNA תקועים פעמיים לייצר אות ניאון מאוד כאשר מתרגש ב 535 ננומטר עם שיא פליטה רחב סביב 600 ננומטר. מאז PI יכול גם להכפיף RNA תקועים פעמיים, יש צורך לטפל בתאים עם RNase לקבלת רזולוציה דנ"א אופטימלית.
    1. הכן טריים פתרון צביעה PI. פתרון המניות PI יכול להיות מוכן על ידי המסת אבקת PI ב PBS ( למשל 5 מ"ג / מ"ל). חנות הפתרון המניות ב 4 ° C (בחושך). פתרון מכתים מורכב PI (140 מיקרומטר), ציטראט נתרן (38 מ"מ) וטריטון X-100 (0.01% v / v).
    2. מחממים משטח מתאים ( למשל, תנור) עד 37 ° C.
    3. צנטריפוגה תאים קבועים (450 xg, 5 דקות, RT), supernatant decant (אתנול) ולשטוף פעם עם 1x PBS.
    4. צנטריפוגות תאים שוב, להסיר PBS ולהוסיף 300 μL של פתרון מכתים PI לכל מדגם (למעט לאחד הדגימות עבור הגדרות FACS, להוסיף PBS למדגם זה במקום).
    5. העברת תאים צינורות FACS (5 מ"ל עגול צינורות פוליסטירן התחתונה).
    6. הוסף 1 μL של RNase A לכל דגימה, לערבב דגימות דגימה למשך 30 דקות בחושך על 37 מעלות צלזיוס. דוגמאות ניתן לאחסן מוגן מפני האור על 4 מעלות צלזיוס למשך מקסימום של 2 - 3 ימים.
    7. ניתוח תוכן DNA בדגימות על ידי זרימהציטומטרי. הגדרת הגדרות פיצוי FACS ניתוח עם מדגם אסינכרוני מוכתמים PI. השתמש מדגם ריק (ללא תמיסת PI מכתים) כדי לבדוק autofluorescence. יסודות של PI מכתים בתיווך ניתוח של תוכן ה- DNA על ידי cytometry הזרימה תוארה בעבר 9 .
  5. קביעת מדד מיטוטי על ידי כפול phospho-H3 (סר 10) / מכתים PI
    הערה: תאים שעוברים מיטוזה ניתן לזהות בקלות על ידי cytometry הזרימה עם נוגדנים ספציפיים עבור H3 H phone histone ב Serine 10 (pH3). מכתים PI מקביל הוא שימושי כדי לקבוע DNA מבוסס תוכן ההפצה של האוכלוסייה התא. 5 דגימות נדרשות עבור תצורות אופטימלי של הגדרות FACS: ריק, PI בלבד, pH3 בלבד, נוגדנים משני בלבד מכתים כפול.
    1. צנטריפוגה תאים קבועים (450 xg, 5 דקות, 4 ° C) וזורקים supernatant. השלבים הבאים מתוארים כדי לבצע מכתים צינורות 15 מ"ל.
    2. שטפו תאים על ידי הוספת 1מ"ל PBS-T (PBS + 0.05% Tween-20) כדי גלולה צנטריפוגה (450 xg, 5 דקות, 4 ° C). הסר supernatant.
    3. הוסף נוגדנים נוגדי pH3 מדולל (1: 500) μL 100-200 של PBS-T + 3% BSA, ו דגירה עם נדנדה עבור 2 שעות ב RT (או O / N ב 4 ° C).
    4. הוסף 2 מ"ל PBS-T (PBS + 0.05% Tween-20) ו צנטריפוגה (450 xg, 5 דקות, 4 ° C). הסר supernatant.
    5. לשטוף פעם נוספת על ידי הוספת 2 מ"ל PBS-T כדי גלולה, צנטריפוגה וזורקים supernatant.
    6. הוסף נוגדנים משני (אנטי ארנב AlexaFluor 488 במקרה של נוגדן pH3 נבחרים) מדולל (1: 500) ב 100-200 μL של PBS-T + 3% BSA ו דגירה עם נדנדה עבור 1 שעה ב RT (או O / N ב 4 ° C). להגן על דגימות מן האור.
    7. לשטוף פעמיים עם PBS-T (2 מ"ל) על ידי צנטריפוגה כמתואר בשלב 1.5.4.
    8. ביצוע מכתים PI כמתואר (צעדים 1.4.1-1.4.6).

2. אוסף לדוגמא ו Processsing עבור ניתוח ביטוי גנים

  1. לקחת1.5 מ"ל microcentrifuge דגימות של מגיב בידוד RNA מתוך המקפיא ולתת להם להפשיר ב RT בתוך ארון בטיחות עבור כימיקלים.
  2. הוסף 400 μL של כלורופורם לכל מדגם ולנער במרץ (אך לא מערבולת) עד ערבוב מלא. דגירה דגימות במשך 5 דקות ב RT.
  3. צנטריפוגה צינורות במשך 15 דקות (XG 8,000 ≥, 4 ° C) microcentrifuge benchtop.
  4. מעבירים את השלב מימית (עליון) לצינור microcentrifuge 1.5 מ"ל חדש לרשום את נפח המועבר (כדי לפשט את ההליך, מומלץ לאסוף כמויות שוות בכל דגימות של הניסוי).
  5. הוסף נפח 1 של 100% אתנול לאט (ירידה טיפה) לשלב מימית בזמן ערבוב. אין צנטריפוגות.
  6. בצע את הצעדים הבאים עם ערכת RNA מסחרי מיני. פיפטה עד 700 μL של כל מדגם, כולל כל המשקע שאולי יצרו, לתוך עמוד ספין בצינור 2 מ"ל אוסף (מסופק על ידי היצרן).
  7. סגור אתמכסה צנטריפוגה (≥ 8,000 גרם, RT) במשך 15 s. מחק את הזרימה דרך. חזור על השלב הקודם עם המדגם הנותר (אם בכלל).
  8. בצע הוראות manufactors 'עבור RNA כביסה elution (elute כל מדגם 30-40 nuclease μl חינם H 2 O כדי להשיג ריכוז מתאים RNA לשלב הבא).
  9. קביעת ריכוז RNA וטוהר של דגימות ידי מדידות ספיגת ( A יחס 260/280 של 2.0-2.1 מצביע על טוהר טוב של מדגם RNA). חנות דגימות RNA ב -80 מעלות צלזיוס עד לשימוש עבור ניתוח RT-qPCR.
  10. עבור המרה RNA לתוך cDNA ואחריו כמותי- PCR, לקחת 1 RNA מיקרוגרם לדגימה ולהכין תגובה retrotranscriptase על פי הוראות היצרנים. דגימות cDNA שהושגו ניתן לאחסן על 4 מעלות צלזיוס (במשך כמה ימים) או ב -20 מעלות צלזיוס (לתקופות זמן ארוכות יותר).
    הערה: הכנה לדוגמא, עיצוב פריימר ושיקולים אחרים בזמן אמת PCR כבר לשעברמתוארת מתוחכמת בספרות 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ייצוג סכמטי של פרוטוקולים Thy-Noc ו- HU עבור סינכרון תאים.

איור 1 מסכם את הצעדים הנדרשים עבור סינכרון תא U2OS ואת אוסף המדגם הבאים על מנת לאמת את ההתקדמות דרך מחזור התא ולבצע ניתוח ביטוי גנים.

Phospho-H3 ו PI מכתים הם פרמטרים הערכה טובה כדי לבחור שיטות סינכרון.

יש לבדוק ולבצע אופטימיזציה של תהליכי סינכרון תאים עבור כל שורה תאית עקב הטרוגניות של תאים בתרבית. סינכרון במיטוזה מושגת בדרך כלל עם פרוטוקול Thy-Noc, והעשרה של תאים מיטוטיים לאחר הטיפול ב- nocodazole ניתנת להערכה עם נוגדנים ספציפיים עבור היסטון H3 (phH3) phosphorylated, סמן מיטיוטי טיפוסי. אידיאל Ntification של תאים חיוביים pH3 מאפשר להפלות בין תאים מיטוטים לאלה עם תוכן 4C-DNA לא עובר מיטוזה (כולם נחשבים "G2" האוכלוסייה על ידי מכתים PI). בתאי U2OS פרוטוקול Thy-Noc מוביל להעשרה משמעותית של אוכלוסייה עם תוכן דנ"א 4C (איור 2 א ', גרף עליון עליון, אוכלוסיה כחולה על ידי צביעת PI), והשברי היחסי של תאים מיטוטים באוכלוסייה זו היה באופן קבוע טהור (בערך 91% לעומת 2% בתאי אסינכרוני). שחרור מתוצאות nocodazole התקדמות מסונכרן של תאים לשלב הבא G1, כפי שנקבע על ידי הצטברות של אוכלוסייה עם תוכן C 2C ( איור 2 א , גרף ימני עליון, אוכלוסייה ירוקה על ידי מכתים PI) ואת היעלמות כמעט של pH3 מיטוטי חיובי תאים ( איור 2 א , הגרף הימני התחתון). לפיכך, תוצאות מכתים pH3 אישר את ההתאמה של פרוטוקול Thy-Noc לסינכרון מיטוטי של תאים U2OS.

"סינכרון של תאי U2OS ב G1 / S נבדק עם thymidine ו hydroxyurea, שני synzzzers בשימוש נרחב.העשרה בשלבים שונים של מחזור התא נקבע על ידי מכתים PI ו ניתוח FACS ואחוז התאים מסוכם בטבלה ( איור 2 ב ) 2. חשיפה של 24 שעות של תאים U2OS ל Thy (2MM) היה יעיל במעצר תאים בגבול G1 / S ( איור 2 ב ), ואילו טיפול עם HU או עם כפולה (DT) הביא למעצר משביע רצון, אך רק תאים שטופלו ב- HU התאוששו לחלוטין מהמעצר והתקדמו בצורה הולמת דרך מחזור התא, לעומת זאת, בלוק DT גרם לעוצר קבוע של G1 בחלק ניכר מאוכלוסיית התא ( 13.3% מהתאים ב- G1 בנקודת זמן של 6 שעות עם DT לעומת 3.1% עם פרוטוקול מבוסס HU), אשר השפיעו לרעה על סינכרון התא, ולכן החשיפה ל- HU מומלצת כמתאמת סינכרון G1 / S המתאימהOd עבור תאים U2OS.

הפרוטוקולים Thy-Noc ו- HU הם משלימים עבור סינכרון תאים.

כפי שמוצג בתרשים 3A (נקודת זמן של 0 שעות), הטיפול על ידי פרוטוקול Thy-Noc נעצר ביעילות תאי U2OS ב M- שלב הכניסה (האוכלוסייה עם תוכן דנ"א 4C, מוצג בכחול) וטיפול על ידי פרוטוקול HU נעצר תאים בגבול G1 / S (אוכלוסייה עם תוכן DNA 2C, שמוצג ירוק / אדום). עם הסרת התרופות, תאים נכנסו והתקדמו דרך מחזור התא באופן מסונכרן. תאים שהתאוששו מטיפול Thy-Noc נצפו לראשונה בשלב G1 מוקדם (האוכלוסייה בירוק) ולאחר מכן עברו דרך G1 ועד שלב S בצורה אחידה. תאים התאושש טיפול HU התקדמה באופן סינכרוני דרך S (האוכלוסייה באדום) ו- G2 / M. התקדמות דרך מחזור התא הבא היה קשור לאובדן הסינכרוניות. כתוצאה מכךY, נקודות זמן מעל 15 שעות לא נכללו בניתוחים אלה בגלל אובדן סינכרוניזציה לאחר נקודת זמן זו.

ניתוח של כתמים מערביים של Cyclin E1 (C1, Cyclin G1 / S) ו- Cyclin B1 (C2, G2 / M cyclin), שני חלבונים שרמותיהם מוסדרים בחוזקה במחזור התא וב- pH3 הסמן המיטי, אישרו את שלב מחזור התא של כל אחד נקודת זמן ניתח על ידי FACS ( איור 3 ב ). כצפוי, תאים בשלב M (המקביל לנקודת זמן 0 h של תאים מסונכרנים Thy-Noc) ותאים בשלב G2 עד M (9 שעות עד 12 שעות נקודת זמן של HU- תאים synzzed) הראה הצטברות דרמטית של cyclin B1 ואת רמות בלתי ניתנות לגילוי של cyclin E1. יתר על כן, רמות Cyclin B1 היו נמוכות לבלתי ניתנות לזיהוי בשלב G1 (3 שעות עם שחרור מ- nocodazole) והצטברות הדרגתית נצפתה כאשר תאים התקדמו דרך S (לאחר שחרור Thy-Noc) ולתוך G2 (לאחר שחרור HU). תיוג pH3 חזק של תאים ב 0 h על Thy-Noc synchronizatiעל אישר את העשרה של תאים שנעצרו בשעה מיטוזה בשלב זה זמן. עלייה קלה ברמות pH3 בשעה 12 שעות לאחר שחרור מ HU גילה כי רוב התאים עם תוכן דנ"א 4C היו עדיין G2 ואילו חלקם של תאים מיטוזה הוגדל ב 15 שעה נקודת זמן. לעומת זאת, דפוס הביטוי של Cyclin E1 הראה הצטברות פרוגרסיבית מ G1 מוקדם לשלב S- שלב (הליך Thy-Noc) והיעלמות הדרגתית בשלב G2 / M (הליך HU).

ביטוי של גנים אשר מוסדר באופן דיפרנציאלי במחזור התא ניתן לנתח במדויק עם שילוב של סינכרון Thy-Noc ו- HU מבוססי.

כהוכחה של מושג כי התא מחזור מוסדר ניתוח ביטוי גנים הוא assayed הטובה ביותר על ידי שילוב של שתי שיטות סינכרון התא, ביטוי mRNA של שני בני משפחה E2F ידוע יש קינטיקה ביטוי שונים במחזור התא(E2F1 ו E2F7) נבדקו על ידי transcriptase לאחור PCR כמותי (RT-qPCR). לשם כך, Thy-Noc ו- HU פרוטוקולי סינכרון שימשו, כפי מסוכם באיור 1 , והפצה מחזור התא היה פיקוח על ידי cytometry זרימה כפי שמוצג בתרשים 3A . איור 4 מראה 2 E2F1 (העליון שני גרפים) ו E2F7 (התחתון שני גרפים) פרופילים mRNA דרך מחזור התא. פרופיל הרגולציה תעתיק של הגן קידוד E2F נצפתה הטובה ביותר עם הליך Thy-Noc, לפיה E2F1 הביטוי התחיל בהדרגה להגדיל משלב G1 מוקדם להגיע לשיא בשלב מאוחר G1 (9 שעות לאחר שחרור Thy-Noc, רקע ירוק). רמותיו ירדו לאחר מכן, במקביל לכניסת שלבי S ו- G2 (רקעים אדומים וכחולים). לעומת זאת, E2F7 ביטוי גנטיקה קינטיקה זוהו בצורה הטובה ביותר לאחר סינכרון מבוסס HU (גרף נמוך יותר, רקע אדום), עם ביטוי שיא בשעה 6 שעות משחרור (המקביל ל S המעבר לשלב G2). Thy-Nocהליך, לעומת זאת, היה מתאים התבוננות אינדוקציה של E2F7, אבל לא downregulation שלה. ראוי לציין, הרחבה של ניתוח מעבר שעה 15 נקודת זמן לשעתק E2F1 ו E2F7 mRNA ביטוי פרופילים של נקודות זמן מוקדמות יותר, אם כי עם טווח פחתה של וריאציה mRNA (נתונים לא מוצג). בסך הכל, תוצאות אלה מאשרים את החשיבות של עבודה עם אוכלוסייה תאים מסונכרן כראוי להעריך לא רק ביטוי גנטיקה קינטיקה אלא גם משרעת מדויק של שינויים ברמות ה- mRNA.

סינכרון סלולרי מספק הבנה טובה יותר של תוכנית ביטוי גנים המושפעת על ידי טיפול נגד סרטן.

כדי לנתח את ההשפעה של התרופה antomumor mitomycin C (MMC) בדינמיקה מחזור התא, כמו גם ביטוי גנים, תאים U2OS סונכרנו לראשונה עם HU וטיפל לאחר מכן עם MMC. חשיפה לסוכן הגנוטוקסי הזה הפעילה צ'קT בשלב G2 כי היה ברור לאחר 15 שעות של חשיפה ( איור 5 א , שורה תחתונה, שיא כחול). לעומת זאת, תאים מטופלים התקדם בדרך כלל דרך G1 בשלב זה נקודת ( איור 5 א , בשורה העליונה, שיא ירוק). טיפול ארוך טווח MMC (36 ח) חשף מעצר קבוע של תאים בשלב G2 בעוד תאים ללא טיפול MMC הציג חלוקת מחזור התא שהיה דומה לזה שמוצג על ידי האוכלוסייה התא אסינכרוני.

E2F1 ו P21 Cip1 (CDKN1A) נבחרו לניתוח ביטוי גנים בתאי MMC שטופלו ( איור 5 ב ), בהתחשב בתקנה שונים שלהם תלוי מחזור התא. הביטוי של E2F1 הוא תלוי בשלב G1, כמתואר באיור 4 , בעוד אינדוקציה של ביטוי C211 Cip1 מצמידים מחזור מעצר התא / הפעלת המחסום 24 . כפי שמוצג באיור 5 ב (גרף שמאל עליון), ביטוי E2F1 גן kiנטו היו דומים בנוכחות או בהעדר MMC, כמו תאים התקדם דרך G1 / S ו לתוך שלב S. ההבדלים ביטוי E2F1 גנים בקרב MMC מטופלים תאים מטופלים נצפו לאחר 15 שעות של חשיפה ל- MMC, לפיו תאים MMC שטופלו לידי ביטוי רמות נמוכות יותר E2F1 mRNA מאשר תאים שליטה ( איור 5 ב , להשוות קווי מוצק ו מקווקו). עם זאת, למרות הבדל ברור בביטוי, זה לא ניתן להסיק כי MMC downregulates ביטוי E2F1, כי פרופילים מחזור התא של מטופלים מטופלים תאים מטופלים שונים בבירור אלה נקודות זמן מאוחר יותר, בשל מתמשך שלב G2 שלב שהוטלו על ידי MMC. למעשה, רמות נמוכות של E2F1 mRNA לאחר נקודת הזמן של 15 שעות בתאי MMC שנחשפו משקפים כנראה את השפעת התרופה בדינמיקה של מחזור התא, ולא את ההשפעה של MMC בתקנה E2F1 תמליל.

בניגוד E2F1 , P21 Cip1 הוא הגן MMC-Respive. רמות גבוהות של p21 Cip1 זוהו במעצר G1 / S שהוטל על ידי HU, דבר המעיד על הפעלת מחסום G1 על ידי HU ( איור 5 ב ' , נקודת זמן של 0 h) והביטוי שלה ירד לאחר מכן בתאים שאינם מטופלים ב- MMC, בהתאם להתקדמות מחזור התא ללא הפרעה לאחר השחרור מַעְצָר. לעומת זאת, טיפול MMC הוביל רמות p1 Cip1 mRNA מוגברת ( איור 5 ב , גרף הימני העליון, קו מוצק) בעוד התאים היו צבירת בשלב G2 (9 שעות של חשיפה MMC). למרות העובדה פרופילים מחזור התא היו דומים בנקודת זמן 9 שעות בשליטה תאים MMC שטופלו, ניתוח ביטוי גנים מראה הבדל מהותי. MMC תאים חשופים הציג מחסום G2 מופעל, עדות על ידי אינדוקציה של ביטוי P21 Cip1, ואילו תאים מטופלים היו עוברים מעבר unperururbed דרך G2, עם רמות נמוכות P21 Cip1 .

הנתונים המתקבלים על ידי ניתוח cytometry זרימה ( FiGure 5A) ונתונים הנובעים RT-qPCR ( איור 5 ב , גרפים העליון) שולבו בגרף אחד עבור כל הגנים שנבחרו ( איור 4 ב ' , גרפים נמוכים). רמות ביטוי mRNA שבו מוצג גובה יחסית של הסורגים בעוד חלוקת מחזור התא של תאים עבור כל מדגם הודגם עם חלקם של צבעים: ירוק עבור שלב G1 (תוכן DNA 2C), כחול עבור שלב G2 (תוכן DNA 4C) ואדום עבור שלב S (תוכן DNA ביניים). שיטה משולבת זו של ייצוג גרפי עשויה לסייע בפירוש חלוקת מחזור התא וביטוי ביטוי גנים.

לסיכום, ניתוח ביטוי גנים, בשילוב עם שיטת סינכרון תרבותית, איפשר זיהוי של הגן הגנוטוקסי ( P21 Cip1 ) והוביל לכך ששינויים שנצפו בביטוי E2F1 בין תאים שטופלו ולא מטופלים עם הסוכן היו עקיפים,אולי קשור להבדלים חלוקת מחזור התא של תאים.

איור 1
איור 1: סקירה כללית של שני פרוטוקולי סינכרון תאיים משלימים: Thymidine-Nocodazole ו- Hydroxyurea. ( א ) ייצוג גרפי של מחזור תא יונקים המציין את הנקודות שבהן מעצר מחזור התא מושגת על ידי שיטות סינכרון התא. נוי מבוסס נוהל חוסם תאים מיטוזה מוקדמת (M) בעוד HU חוסם תאים בגבול G1 / S. ( ב ) ייצוג סכמטי של פרוטוקול Thy-Noc של סינכרון התא. המוצגים הם השלבים המשמשים בדרך כלל לניתוח ביטוי גנים וניטור מחזור התא בתאי U2OS. ( ג ) ייצוג סכמטי של פרוטוקול מבוסס HU של סינכרון התא. המוצגים הם השלבים המשמשים בדרך כלל לניתוח ביטוי גנים ניטור מחזור התא ב U2OS תאים. הליך סינכרון קצר יותר משמיט רעב בסרום יכול להיות מיושם גם אם הסינכרון אופטימלי מושגת כבר על ידי חשיפה 24 שעות HU. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2: הערכת שיטות סינכרון מתאימות. ( A ) אסינכרוני ו Thy-Noc מסונכרן בתרבויות תאים U2OS היו נתונים מכתים pH3 על מנת להעריך את השבר של תאים מיטוטיים בכל מקרה. כתמים PI סימולטני מותר ניטור של התוכן DNA של תאים. באוכלוסייה אסינכרוני רק חלק מזערי של תאים עם תוכן דנ"א 4C (בכחול) היו חיוביות סמן מיטוזה. לעומת זאת, Thy-Noc פרוטוקול ביעילות accu(חיובי עבור מכתים pH3) ו מותר התקדמות נאותה לשלב הבא G1 (בירוק) עם הסרת nocodazole (3 שעה נקודת זמן). אחוז התאים בכל שלב מסוכם בטבלה ו מסומן בצבעים על פי אלה המועסקים ב היסטוגרמות PI: ירוק עבור 2C תוכן DNA תאים (G1), כחול עבור תאים עם תוכן דנ"א 4C (כולל G2 ו- M תאים בשם G2 ב היסטוגרמות על מנת לפשט את הדמות, ואדום עבור תאים עם תוכן DNA ביניים (S). ( B ) Thymidine ו- HU הוערכו על יעילות סינכרון מחזור התא שלהם בתאי U2OS.תאים טופלו thymidine (אחד או שניים סיבובים), או עם HU במשך 24 שעות, סינכרון התא נבדק על ידי מכתים PI וניתוח FACS.פסגה שימש ניתוח נתונים FACS אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3: התוויית המסגרת הזמנית להתקדמות אחידה של תאים לאחר סינכרון של Thy-Noc ו- HU בתיווך. ( א ) תאים U2OS סונכרנו בשלב M על ידי פרוטוקול Thy-Noc (בשורה העליונה) או במעבר G1 / S על ידי פרוטוקול HU (שורה תחתונה). מחזור מחזור התא היה פיקוח על ידי מכתים PI ו FACS ניתוח של תוכן ה- DNA של התאים כל 3 שעות לאחר שחרורו של כימיקלים. הפסגה שימש ניתוח נתונים FACS. תאים ששוחררו ממעצר Thy-Noc בתיווך נכנסו באופן סינכרוני בשלב G1 מוקדם לאחר 3 שעות, והתקדם אחיד עד שלב S בנקודות זמן לאחר מכן. תאים ששוחררו ממעצר עם תסמונת HU עברו מעבר סינכרוני דרך שלבי S ו- G2. תאים שנאספו 15 שעות לאחר שחרור ייצג את גבולות סינכרון התא, כמו התקדמות לשלב הבא היה להשיג רקD על ידי חלק קטן של האוכלוסייה. ( B ) סנכרון התא היה פיקוח על ידי ניתוח כתם המערבי על ידי איסוף דגימות חלבון כל 3 שעות עד 15 שעות לאחר שחרור. ביטוי קינטיקה של Cyclin E1 (CCNE1), cyclin שנצבר בעיקר דרך השלב S, cyclin B1 (CCNB1), בעיקר נוכח מ G2 ל M שלב pH3, סמן לתאים מיטוטים, תא המאשר פרופילים הפצה מחזור שנצפה על ידי cytometry הזרימה. אקטין B (ACTB) שימש כבדיקת העמסה אנדוגנית משום שרמותיה אינן תלויות במחזור התא. (כפי שונה מ Mitxelena et al . 8 ). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 4
איור 4: מחקר של שלב מחזור תאים תלויים תמלול של בני משפחה E2F על ידי שיטות סינכרון תא משולב. תאים U2OS נעצרו G2 / M על ידי פרוטוקול Thy-Noc או G1 / S על ידי טיפול HU, דגימות נאספו עבור מיצוי רנ"א ו FACS ניתוח כל 3 עד 15 שעות עם שחרורו מן המעצר. ניתוח ביטוי גנים על ידי RT-qPCR גילה פרופיל ביטוי E2F מוגבל בעיקר G1 (גרף השמאלי העליון) ואילו פרופיל E2F7 ביטוי גנטי הועבר לשלב S, עם downregulation הדרגתית דרך שלב G2 (הגרף הימני התחתון). TBP שימש גן endogenous שאינם תאים מחזור מוסדר לחשב את השינויים היחסיים ברמות mRNA והתוצאות היו מיוצגים כערכים הממוצע וסטיית תקן (SD). התקדמות דרך מחזור התא נקבע על ידי מכתים PI ו FACS ניתוח של תוכן ה- DNA של תאים. שלבי מחזור התא היו מיוצגים כצבעי רקע בגרפים: שחור (מעצר במיטוזה מוקדמת), ירוק (שלב G1), אדום (שלב S) וכחול (שלב G2)." לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו. " Target = "_ blank"> לחץ כאן כדי לראות גרסה גדולה יותר של דמות זו.

איור 5
איור 5: ההשפעה של MMC על הביטוי גנים מחזור התקדמות סל. תאי U2OS טופלו ב- HU למשך 24 שעות, ו- MMC (250 ננומטר) נוספה מיד לאחר שחרורם ממעצר G1 / S בתיווך HU. דוגמאות לניתוח FACS וניתוח ביטוי גנים נאספו בנקודות זמן. ( א ) התקדמות דרך מחזור התא נקבע על ידי מכתים PI ו FACS ניתוח של תוכן ה- DNA על ידי תוכנת הפסגה. MMC גרמה לעיכוב מתון בהתקדמות דרך שלב S (אוכלוסייה אדומה) ומעצר קבוע בשלב G2 (אוכלוסיה כחולה), כפי שמוצג על ידי היעדר תאים ב- G1 (אוכלוסייה ירוקה) לאחר 15 שעות של טיפול (שורה תחתונה) בהשוואה Post(בשורה העליונה) תאים. ( ב ) E2F1 ו P21 Cip1 ביטוי ביטוי גנים MMC מטופלים או תאים מטופלים בוצעה ברמה mRNA ידי RT-qPCR. Oxa1L שימש כגן אנדוגני שאינו MMC-Respive והתוצאות היו מיוצגות כערכים ממוצעים ו- SD. גרפים עליונים מייצגים רמות mRNA יחסית של גנים נבחרים לאחר שחרור מ- HU והוספת MMC. הגרפים התחתונים משלבים נתונים המתקבלים על ידי ניתוח FACS ו- RT-qPCR. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ניתוח גנים מווסתים עדינים המעורבים בתפקידים זמניים וספציפיים במחזור התא דורשים אוכלוסיית תאים אחידה. חוקרים רבים משתמשים באופן שגרתי בקווי תאים סרטניים ארוכי טווח למטרות אלו, ומספר שיטות פותחו כדי להשיג אוכלוסיות תאים סינכרוני (או סינכרוני), במטרה לצבור תאים רבים ככל האפשר בשלבים מוגדרים של מחזור התא. יתר על כן, מאמצים חזקים נעשו כדי לשפר ולייעל גישות סינכרון מבוססת היטב. עם זאת, לכל פרוטוקולי הסינכרון יש חסרונות, שניתן לייחסם להטרוגניות של תרבויות תאים, ליעילות תת-אופטימלית של תהליכי הסנכרון, או להשפעות משניות שמפענחים כימיים בתפקוד התא, בין היתר. הגבלות אלה יש לקחת בחשבון בעת ​​יישום פרוטוקולי סנכרון תאים. החוקרים צריכים לזהות את שיטות הסינכרון המתאימות ביותר עבור specif שלהםסוג תא IC או ניסוי. אפילו לטפח שורות תאים שונים בדיוק באותו אופן, וכתוצאה מכך שיעורי הסינכרון עשוי להשתנות בשל כמה סיבות. מצד אחד, אורך מחזור התא עשוי להשתנות בהתאם לקו התא שנבחר; מצד שני, אותו מעכב עשוי להיות בעל השפעות מנוגדות על שורות תאים שונים בשל מאפיינים מסוימים של כל שורה התא 25 . יתר על כן, ריכוז מעכב נבחר וזמן חשיפה חייב להיות מותאם תמיד לכל שורה התא על מנת למנוע או למזער רעילות צד לא רצוי 26 . גם לאחר אופטימיזציה של כל ההיבטים האלה, 100% הצטברות של תאים בשלב מחזור התא נתון לא מושגת, ואסינכרוני עולה בהדרגה לאחר הסרת כימיים 27 . לכן, חשוב להבין כי שיטות הסינכרון להשיג לכל היותר העשרה חלקית האוכלוסייה העשרה במסגרת זמן מסוים.

בשנת W זה אורק שני הליכי סינכרון (Thy-Noc ו- HU) כבר אופטימיזציה עבור השימוש שלהם בתאי U2OS, שניהם נמצאים בשימוש נרחב עבור מבחני סינכרון התא 28 , 29 , 30 . עבור מעצר תאים בשלב M, שילוב של תימידין ו nocodazole עבד ביעילות בתאי U2OS. בהתחשב באופי ציטוטוקסי של nocodazole, חשוב לקבוע את זמן החשיפה ואת המינון של מעכב זה כדי להשיג לא רק אוכלוסייה תאים מסונכרן מאוד, אבל גם הישרדות התא אופטימלי. חשיפה מוקדמת לתימידין (או תיאורטית כל תרכובת דומה אחרת כגון hydroxyurea) הובילה להעשרה של אוכלוסיית התא ב G1 ו- S שלבים, ובכך להקטין את הזמן החשיפה nocodazole הנדרש. עבור מעצר תאים G1 / S, כמה אפשרויות נחשבו, כולל בלוק תימדין כפול, שיטה כי הוא מאוד יעיל בסנכרון של מספר שורות תאים"31 , 32. עם זאת, ת'ימידין נמחק בשל תוצאותיו המאכזבות ב- U2OS.סיבוב אחד של טיפול בתימידין רק עצר חלק קטן מהתאים, בעוד ששני סיבובים של טיפול בתימידין חסמו ביעילות את רוב התאים ב- G1 / S, האוכלוסייה נשמרה לאחר שחרור מטימידין והתפתחות מחזור התא לא המשיכה באופן אחיד, לעומת זאת, טיפול הידרוקסוריאה סיפק תוצאות טובות של חסימת G1 / S והתפתחות אחידה של תאים באמצעות S ו- G2.

יש לבדוק את התפלגות שלב מחזור התא בכל פעם ביצוע ניסויים בסנכרון תא ( למשל על ידי מכתים propidium iodide או תיוג pH3 ואחריו ניתוח FACS, או על ידי immunoblotting של חלבונים מחזור שלב ספציפי מחזור) 16 , 33 , 34 , על מנת לפרש טוב יותר ביטוי גנים תוצאות. סינכרון יעילNcy או הבדלים בין הניסוי בין ההתפתחות דרך מחזור התא עלולים להוביל למסקנות שגויות. לדוגמה, טיפול nocodazole ידוע לגרום לכישלון של פונקציית מחסום מיטוטי בתנאים מסוימים. זה גורם לאוכלוסייה של תאים עם תוכן דנ"א 4C אבל שלילי עבור סמנים מיטוטיים 34 כי "מחליק" חלוקה מיטוטי וחוזר interfase עם תוכן 4C 35 . הופעתה של תת קבוצה זו של תאים, אשר ניתן לזהות על ידי immunostaining עם נוגדנים נוגדי פוספו H3 (ראה איור 2 א ) ניתן למזער על ידי שימוש של PBS קר עבור צעדים כביסה nocodazole. אפקט נוסף הקשור לשימוש במעכבים כימיים המשפיעים על סינכרון התא הוא הפעלת המחסום הקשורה לחשיפה לתרכובות אלה 36 , 37 , מנגנון שבו התא מעכב באופן פעיל את תהליך ההתאוששות של התא עד שהוא יכוללהבטיח כי תהליכים קודמים לנקודה המדויקת (למשל שכפול דנ"א נכון, הרכבה ציר), נפתרו 38 . כדי שהשיטה תהיה מסודרת, המעצר חייב להיות לא רק יעיל אלא גם הפיך לחלוטין. לכן, לאחר שחרור מעכבי מחזור התא, חשוב לנתח האם ההשפעות של המעכב בוטלו, למשל על ידי ניתוח ביטוי של סמני מחסום, כגון p21 CIP . איור 5 ב מראה כי hydroxyurea מסונכרן תאים U2OS ביעילות לפתור את המחסום, כי רמות p21 CIP הופחתו לביטוי הבסיסי לאחר שחרור.

בתאי U2OS, אחוזי ההעשרה על מעגל מחזור התא נופלים בטווח המדווח על ידי מחקרים אחרים על סינכרון התא 29 , 30 , 39 : סביב 85% של תאים עם תוכן דנ"א 4C (מכתים PI) ו כ90% מהמטופלים ב- mitosis (תיוג חיובי ל- pH3) בטיפול ב- thymidine-nocodazole, ובסביבות 80-90% מתאי G1 / S לאחר טיפול ב- hydroxyurea. שחרור ממעצר מחזור תא בדרך כלל כוננים התקדמות נאותה באמצעות השלב הבא או שני שלבים בצורה אחידה, אם כי הסינכרון הוא איבד תמיד לאחר מספר שעות ותאים אינם מסוגלים להשלים מחזור שלם התא חלוקת באופן מסונכרן. לכן, על מנת לקבל תמונה מלאה של כל השלבים של מחזור התא, הפרוטוקול המוצע בעבודה זו עושה שימוש בשתי שיטות סינכרון מחלקים שונים של מחזור התא. כפי שמוצג באיור 3 א , כל פרוטוקול בודד לא יבטיח סינכרוניזציה על פני מחזור שלם של תאים. סינכרון המבוסס על Thy-Noc סיפק מסגרת מתאימה לתהליכים המתרחשים בשלבי G1 ל- S, בעוד שהתאים ששוחררו מ- HU היו מתאימים לניתוח האירועים המתרחשים במהלך S ו- G2 / M. את complementarities של שני procurur שנבחרEs הוכחו על ידי ניתוח של שני חברים של המשפחה E2F גורם שעתוק גורם ( איור 4 ), התומכת ברעיון שילוב של שתי שיטות לסנכרן בשלבים שונים של מחזור התא הוא גישה רבת עוצמה כדי לקבוע במדויק תא מחזור מוסדר ביטוי גנים דפוסי להבין טוב יותר את תפקידם הפיזיולוגי.

יישום משכנע של הליכי סינכרון תאים מתמקד בהערכת ההשפעה של סוכני טיפול פוטנציאליים. ההשפעה של תרכובות פרמצבטיות, כמו אלה עם פעילות נוגדנים נלמדת לעיתים קרובות אוכלוסיות תאים אסינכרוני. תחת הגדרות אלה ניתן לקבוע את המשמעות של התרופה שנבחרה באינדוקציה של מספר תהליכים כגון מוות של תאים, מעצר מחזור התא או הזיהום 7 , 40 . עם זאת, הבחירה של הגדרות התא אסינכרוני לזיהוי של אירועים מולקולריים מדויק המסדירתהליכים כאלה עשויים להוביל למסקנות לא נכונות או חלקית. נקודה זו, אשר לעתים קרובות התעלמו, הודגם בעבודה הנוכחית על ידי ניתוח ההשפעה של MMC Chemotherapyapeutic על E2F1 ו P21 Cip1 ביטוי גנים ( איור 5 ). בסך הכל, שילוב של סינכרון התא עם טיפול genotoxic סוכנים מספק הקשר מתאים שבו ללמוד את הביטוי של גנים כי הם מגיבים סוכן genotoxic ו להפלות מאלו שנפגעו על ידי הפרעות מחזור התא שהוטל על ידי הסוכן.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgments

אנו מודים לחברי Zubiaga ומעבדות Altmeyer לדיונים מועילים ולתמיכה טכנית. עבודה זו נתמכה על ידי מענקים מהמשרד הספרדי (SAF2015-67562-R, MINECO / FEDER, UE), ממשלת הבאסקים (IT634-13 ו KK-2015/89), ואת אוניברסיטת המדינה הבסקית UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
לימוד מחזור גנים ביטוי מוסדר על ידי שני פרוטוקולי סינכרון התא
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter