Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

두 개의 상보적인 세포 동기화 프로토콜에 의한 세포주기 조절 유전자 발굴 연구

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

우리는 세포주기의 특정 단계와 관련된 사건을 연구하기위한 배경 정보를 제공하는 두 가지 세포 동기화 프로토콜을보고합니다. 우리는이 접근법이 교란되지 않은 세포주기 또는 세포주기에 영향을 미치는 약물에 노출되었을 때 특정 유전자의 조절을 분석하는데 유용하다는 것을 보여준다.

Abstract

세포주기의 유전자 발현 프로그램은 세포주기 의존적 과정과 암과 같은 질병에서의 그 역할을 이해하는 중요한 단계입니다. 세포주기 조절 유전자 발현 분석은 특정 단계로의 세포 동기화에 달려있다. 여기서 우리는 세포주기 동안 유전자 발현의주기적인 변이를 연구하는데 일반적으로 사용되는 두 개의 보완적인 동기화 프로토콜을 이용하는 방법을 설명한다. 두 절차 모두 하나의 정의 된 지점에서 세포주기를 일시적으로 차단하는 것에 기반합니다. Hydroxyurea (HU) 처리에 의한 동기화 프로토콜은 G1 / 초기 S 기 후반에 세포질 체포를 유도하고, HU- 매개 체포로부터의 방출은 S 및 G2 / M을 통해 균일하게 진행하는 세포 집단을 제공한다. thymidine과 nocodazole (Thy-Noc) 처리에 의한 동기화 프로토콜은 초기 유사 분열에서 세포를 차단하고 Thy-Noc에 의한 체전으로부터의 방출은 G1 기 및 S기에 적합한 동기 세포 집단을 제공한다공부 해봐. 두 절차의 적용은 일반적으로 세포의 프로피 디움 아이오다 이드 (PI) 염색 및 유동 세포 계측법 - 중재 된 DNA 함량 분석 후에 수행되는 세포주기 분포 프로파일의 모니터링을 필요로합니다. 우리는 두 가지 동기화 프로토콜의 결합 된 사용이 세포주기 ( 즉, E2F1 및 E2F7)에서 차별적으로 조절되는 유전자의 전사 프로파일을 명확하게 결정하고 결과적으로 세포주기에서 그들의 역할에 대해 더 잘 이해할 수있는 강력한 접근 방법이라는 것을 보여줍니다 프로세스. 또한,이 접근법은 세포주기 섭동에 의해서만 영향을받는 유전 독성 물질과 유전 독성 물질에 반응하는 유전자를 구별 할 수 있기 때문에 약물 기반 치료법 ​​( 즉, 항암제 인 mitomycin C)의 기초가되는 연구에 유용함을 보여줍니다 대리인에 의해 부과 된

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

세포주기의 모든 단계를 통한 전이는 엄격하게 조절 된 유전자 발현 프로그램과 결합됩니다. 세포주기를 통한 유전자 전사의 "온 오프"는 타이밍뿐 아니라 유전자 발현 수준을 조절하는 복잡한 전사 조절 시스템의 제어하에 있다고 믿어진다. 주요 세포주기 구성 요소의 조절 해제는 여러 질병의 발병에 기여하는 것으로 알려져 있으며 종양 형성의 확실한 특징입니다 1 , 2 . 효모 및 포유 동물 세포에서 수행 된 게놈 - 전 사체 해독 분석 결과 많은 유전자가 세포주기에서주기적인 유전자 발현 양상을 보임으로써 세포주기 동안의 전사 변동이 주어진 유전자 산물의 일시적인 필요성을 반영한다는 것을 보여 주었다 정확한 단계 3 , 4 , 5 .

세포주기 조절 유전자 발현 연구의 주요 과제는 세포주기를 특정 세포주기 단계로 동기화시키는 것입니다. 세포 동기화는 특정 세포주기 위상 전이에 대한 유전자 발현 패턴의 연관성을 해석하는 데 도움을 주며 수많은 유전자의 조절과 기능에 대한 더 나은 이해를 이끌어 냈습니다. 세포 동기화는 항암제의 작용 메커니즘을 연구하는 데에도 중요합니다. 화학 요법 제는 유전자 발현뿐만 아니라 세포주기 동역학 6,7 에도 영향을 미치는 것으로 알려져 있습니다. 그럼에도 불구하고 이러한 약제를 사용한 치료로 인한 유전자 발현의 차이가 치료에 대한 직접적인 반응인지 아니면 단지 세포주기 프로파일의 변화의 결과인지 결정하는 것은 종종 어렵습니다. 이러한 가능성을 구별하기 위해, 유전자 발현은 s화학 요법 약물을 첨가하기 전에 미리 채웠다.

갓 분리 된 림프 세포 (G08에 동 기적으로 동질 된 세포 집단을 구성하는)와 같은 일부 초기 세포를 제외하면 시험관 내 확립 된 세포주는 배양 물에서 비동기 적으로 성장합니다. 정상적인 성장 조건에서 이러한 비동기 사이클링 세포는 세포주기의 모든 단계에서 발견되지만, G1 9 에서 우선적으로 발견됩니다. 따라서이 문맥은 특정 세포주기 단계 ( 예 : G1, S 등)에서 기능적 또는 유전자 발현 분석을위한 최적의 시나리오를 제공하지 않습니다. 비 형질 전환 불멸화 세포주 ( 예 : 섬유 아세포)는 소위 생리적 방법 10 과 동기화 될 수 있습니다. 이러한 방법은 사이클을 계속하기 위해 세포 접촉 억제 및 성장 인자 의존성과 같은 비 형질 전환 세포의 유지 된 일차 세포 특징에 기초한다. 제거접촉 억제와 병용 된 혈청의 혈청 농도는 G0 / G1에서 정지 된 비 형질 전환 세포를 만든다. 그러나 동기화 된 세포주기 진입 및 진행은 종종 계대 배양을 필요로하며, 이는 또한 세포의 인공적인 분리 및 재 - 도금 10을 포함 한다. 가장 중요하게는,이 방법은 세포 접촉 - 매개 성장 억제 또는 성장 인자 금기에 대한 반응이 결여 된 형질 전환 세포주, 현재 사용중인 확립 된 세포주의 대다수에 적합하지 않다. 따라서, 세포주기의 특정 단계에서 효율적인 세포 동기화를 위해 대안적인 방법이 필요하다는 것이 명백하다. 일반적으로 가장 자주 사용되는 동기화 방법은 DNA주기 또는 유사 분열 스핀들 형성과 같은 세포주기의 한 지점에 대한 일시적인 화학적 또는 약리학 적 억제를 기반으로합니다. DNA 합성의 억제는 G1 또는 늦은 S 단계에서 세포를 정지시킴으로써 세포를 동기화시킨다. 이것은 아치 일 수있다.미오신, 뉴클레오티드 생합성 저해제 11,12 , 아피 디 콜린, DNA 폴리머 라제 13,14 , 히드 록시 우레아 억제제, 리보 뉴클레오타이드 리덕 타제 저해제 15,16 또는 과량의 티미 딘 17,18과 같은 화합물의 첨가에 의해 치료 될 수있다. 한편, 콜히친이나 노코 다졸과 같은 미세 소관 중합 억제제는 초기 M 단계에서 세포 동기화를 유도하는 유사 분열 스핀들 형성을 차단할 수 있습니다 19 , 20 , 21 .

이 연구에서 우리는 mRNA에서 세포주기 조절 유전자의 발현을 연구하기 위해 일시적 화학 저해에 기초한 두 개의 보완적인 동기화 프로토콜을 포함하는 방법을 기술한다수평. 이 방법은 특정 세포주기 과정에서 세포주기 유전자의 역할을 정의하는 기본입니다. 또한 항암 치료법의 영향을 연구하여 약물 반응 유전자를 정확하게 검출하고 이러한 약물에 의해 생성 된 세포주기 진행의 혼란으로 인한 잘못된 해석을 최소화하기위한 일반적인 프레임을 제공합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 세포주기의 세포 동조, 방출 및 모니터링

  1. 유사 분열에서 U2OS 세포의 Thymidine- 및 nocodazole- 기반 (Thy-Noc) 동기화 및 방출
    1. 필요한 세포 배양 배지를 준비하십시오. U2OS 세포는 10 % (vol / vol) FBS (선택 : 1 % 페니실린 / 스트렙토 마이신)로 보충 된 DMEM- 글루타민 배지에서 일상적으로 성장시킨다. 멸균 조건에서 모든 배지 준비 및 조작을 수행하고 사용하기 전에 보완 된 배지 (이후부터는 "완전 배지"라고 함)를 37 ° C까지 예열하십시오.
    2. 10 ML 완전한 배양 배지에 100mm 접시 당 종자 2 X 10 6 U2OS 세포. 필요한 접시 수를 계산하려면 각 100mm 접시가 일반적으로 6- 웰 플레이트 (0.2 - 0.25 x 10 6 세포 / 웰)의 약 5 웰을 재 플레이트하기에 충분한 유사 분열 세포를 제공한다는 점을 고려하십시오 ( 그림 참조). 1B ). 선택된 시점 당 두 개의 우물이 필요합니다.실험에서 ed (RNA 추출을위한 1 웰 및 세포주기 모니터링을위한 1 웰). 또한, 단백질 분석을 위해 제 3 웰을 시간 점당 수집 할 수있다.
      참고 : 저녁 (오후 7 시경)에 세포를 배양하여 다음 날 근무 시간 중에 다음 단계를 수행 할 수 있도록하십시오. FACS 분석 보정 설정을 정의하기 위해 비동기 적으로 성장하는 세포 2 웰을 추가합니다.
    3. 37시에 100mm 요리를 잠복시킴으로써 세포를 붙이십시오. 24 시간 동안 5 % CO 2 의 가습 분위기에서.
    4. 티미 딘 블록의 경우, H 2 O (또는 동등한 양) 3 mL에 145.2 mg 티미 딘 파우더를 용해시키고 0.2 μm 기공 크기 필터를 통해 여과하여 용액을 소독하여 200 mM 티미 딘 저장 용액을 준비한다. 약간의 온난화는 티미 딘을 용해시키는 데 도움이 될 수 있습니다. 각 100mm 문화 요리 (최종 농도 2 MM)에 새로 준비한 200 MM 주식의 100 μL를 추가합니다. 37에서 20 시간 동안 thymidine으로 세포를 인큐베이션한다.76 ℃, 5 % CO2의 가습 된 분위기에서의 C.
      참고 : 저녁 (약 오후 7시)에 세포를 처리하여 다음 날 티미 딘 방출과 노코 다졸 차단을 동시에 수행 할 수있는 시간을 갖도록하십시오.
    5. 티미 딘 블록에서 방출하려면 다음날 오후 3시 (3 pm)에 티미 딘 함유 성장 배지를 제거하십시오. 미리 데워진 1x PBS로 세포를 두 번 씻고 각 100mm 접시에 완전한 배지 10 mL를 첨가하십시오. 5 % CO 2 습도 분위기에서 37 ° C에서 5 시간 동안 세포를 인큐베이션하십시오.
    6. mitotic 세포 체포를 위해 50 ng / ML (오후 8시)의 최종 농도에 nocodazole를 추가하십시오. nocodazole 분말을 DMSO ( 예 : 5 mg / mL)에 녹여 -20 ° C에서 냉동 보관하여 재고 용액을 준비하십시오. 5 ~ 2 % CO 2 의 가습 분위기에서 37 ℃에서 10 ~ 11 시간 동안 노코 다졸로 세포를 부화시킨다.
    7. 초기 M 단계 (mitotic shake-off)에서의 nocodazole-mediated arrest로부터의 방출 및 여러 시간 poi에서의 시료 채취nts (오전 6 시부 터 7 시까 지).
      1. 각 플레이트를 흔들어 부드럽게 분열 (mitotic) 세포를 분리하고 부드럽게 nocodazole 함유 성장 매체를 pipetting. 50 ML 멸균 튜브, 원심 분리기 (300 XG, 5 분, 실온 (RT)) 및 원심 분리에 따라 1X PBS를 추가하여 두 번 세포를 씻어 각각의 100mm 판에서 분리 된 세포와 매체를 수집합니다. 분열 된 미끄러짐을 피하기 위해 차가운 ​​PBS 또는 PBS와 노코 다졸을 사용하는 것이 좋습니다 (토론 섹션 참조).
      2. 10 ML의 전체 매체에 각 100mm 플레이트에서 수집 된 Resuspend 유사 분열 세포. RNA 추출을 위해 2 mL, FACS 분석을 위해 2 mL를 0 시간 지점 (시료 당 약 0.2-0.25 x 106 세포) 동안 저장하십시오.
      3. 6 잘 플레이트 (2 ML / 우물, 0.2-0.25 X 10 6 세포 / 우물)의 후속 시점에 대한 남아 mitotic 세포를 다시 판.
        참고 : 선택한 시점 당 2 개의 웰이 필요합니다 (RNA의 경우 1 개, FACS 분석의 경우 1 개).
    8. 셀에서 샘플 수집측정 된 시간 지점. 세포주기 진행의 적절한 프로필을 얻기 위해 1.5 시간에서 3 시간마다 권장됩니다.
      1. RNA 추출의 경우, 배지를 제거하고 2mL의 예열 된 1x PBS로 잘 헹구고 우물에 적합한 RNA 분리 시약 ( 예 : TRIzol) 1 mL를 첨가하십시오 (화학 물질의 안전 캐비닛에서 마지막 단계 수행). 피펫 위아래로 분리하고 세포를 용해, 1.5 ML microcentrifuge 튜브에 세포 lysate을 전송, RT에서 5 분 품어 추가 사용까지 ° C에서 튜브 ° C.
      2. FACS 분석을 위해 2 ML pre-warm 1x PBS로 잘 헹구고, 세포를 분리하기 위해 미리 데워진 Trypsin-EDTA 용액 (0.3 mL / well)을 첨가하고, 1 mL의 완전한 배지를 첨가하여 trypsin-EDTA를 차단하고 별도의 15 mL 튜브.
        1. 세포를 원심 분리기 (300 XG, 5 분, RT), 세포 펠렛을 저장하고 뜨는을 폐기하십시오. 세포를 고정하기 위해 부드럽게 튜브를 vortexing하여 1x PBS에 냉장 70 % (V / V) 에탄올 1 ML에 세포를 resuspend하고, 응용 프로그램에 얼음에 그들을 놓으십시오4 ℃에서 저장하기 약 15 분 전에 또는 FACS에 의한 추가 분석을위한 염색 (1.4-1.5 단계에서 기술).
  2. G1 / S 경계에서 U2OS 세포의 HU 기반 동기화 및 방출
    1. 단계 1.1에서 설명한대로 전체 세포 배양 배지를 준비합니다.
    2. 6 잘 접시 (우물 당 2 ML 완전한 배양 매체)에서 우물 당 종자 0.25 X 10 6 U2OS 세포. 실험에 필요한 우물의 수를 계산하려면 선택한 시점 당 2 개의 우물 (RNA 추출을위한 1 개의 우물 및 세포주기 모니터링을위한 1 개의 우물)이 필요하고 비동기 적으로 성장하는 세포의 2 개의 추가 우물이 FACS 분석 보정 설정을 정의하는 데 필요합니다.
    3. 37 ° C에서 6-well 플레이트를 밤새 배양하여 세포를 부착 시키십시오 (5 % CO 2 의 가습 분위기에서).
    4. 다음날 아침 웰에서 완전 배지를 제거하고 2 mL웰 당 미리 예열 된 FBS-없는 DMEM- 글루타민 배지를 첨가 하였다. 37 ° C에서 추가 24 시간 동안 세포를 인큐베이션하고 5 % CO2의 가습 분위기에서하십시오.
      참고 :이 단계는 2 (FACS 설정을 정의하기 위해 저장된 것)를 제외한 모든 웰에서 수행하십시오. 효율적인 동기화가 세포를 HU와 함께 단순히 배양함으로써 달성되면 세럼 철수 단계는 생략 될 수있다.
    5. HU로 G1 / S 세포주기 정지.
      1. 사용하기 전에 신선한 HU 스톡 용액 (500 mM)을 준비하십시오. HU 분말 76.06 mg에 H 2 O 2 mL를 넣고 완전히 용해 될 때까지 혼합한다. 0.2 μm의 공극 크기 필터를 통해 여과하여 용액을 소독하십시오. 4 MM의 최종 HU 농도에 대한 필터 멸균 HU 재고 솔루션 400 μL와 완벽한 매체 50 ML을 섞는다.
      2. FACS 설정을 정의하는 데 필요한 2 개의 우물을 제외한 모든 우물에서 배지를 제거하고 새로 준비된 4 mM HU 함유 완전 배지 (2 mL / well)로 교체하십시오.
      3. 24 시간 동안 세포를 인큐베이션한다.HU 함유 배지 (37 ℃, 5 % CO 2 의 가습 분위기).
    6. HU 매개 체포에서 세포 방출. 웰에서 HU 함유 배지를 제거하고 예열 된 1x PBS (매회 2 mL)로 웰을 2 회 헹구십시오. 웰당 완전 배지 2 mL를 첨가한다. FACS 설정을 위해 저장된 2 개의 샘플뿐만 아니라 0 시간 지점 (RNA 추출을위한 1 개와 FACS에 의한 세포주기 정지 확인을위한 1 개)을 위해 2 개의 샘플을 수집하십시오. 인큐베이터에 남아있는 웰을 놓습니다.
    7. 세포주기 진행의 적절한 분포를 얻기 위해 1.5-3 시간마다 샘플을 수집하십시오. 각 시점에서 1.1.8.1-1.1.8.2에서 설명한대로 시료 추출 (RNA 추출 및 FACS 분석 용)을 수행합니다.
  3. DNA 손상 제로 치료
    주 : 세포주기 사건에서 화합물 ( 예 : DNA 손상 인자)의 효과를 밝히는 것이 목적 일 때마다, 앞에서 설명한 동기화 방법 중 하나는유전 독성 제제로 세포를 처리하는 것과 결합된다. 동기화 방법을 선택하려면 분석하고자하는 셀주기의 위상을 고려하는 것이 중요합니다. 일반적으로, Thy-Noc 절차는 G1 단계 또는 S 단계 진입에서 화합물의 효과를 연구하는 데 적합 할 수 있지만 HU 매개 동기화는 S 단계에서 G2 단계 또는 유사 분열에 대한 영향을 연구하는 데 더 적합 할 수 있습니다.
    1. G1 위상 또는 S 위상 진입에서 유전 독성 물질의 효과 분석
      1. 1.1.2에서 설명한대로 셀을 동기화하십시오. ~ 1.1.6.
      2. 노 코다 졸 (nocodazole)에서 세포를 방출하고 1.1.7에서 설명한대로 세포를 다시 판다. 37 ℃에서 3 시간 동안 5 % CO 2 의 가습 된 분위기에서 배양하여 첨가제를 첨가하기 전에 부착시킨다 (필요한 항온 배양 기간은 세포주에 따라 다를 수 있음).
      3. 이전에 1.1.8에서 설명한대로 에이전트를 추가하고 샘플을 수집하십시오.
    2. SG에서 유전 독성 물질의 영향 분석2 단계 또는 M 진입
      1. 1.2.2에서 설명한대로 셀을 동기화하십시오. 1.2.5로
      2. 1.2.6에서 설명한대로 HU에서 세포를 방출하십시오. 즉시 상담원을 추가하십시오.
      3. 이전에 1.8에서 설명한대로 샘플을 수집합니다.
  4. propidium iodide (PI) 염색 및 FACS 분석에 의한 세포주기를 통한 세포 동기화 및 진행 모니터링
    참고 : 모든 시점에서 수집 된 샘플과 FACS 설정을 정의하는 데 필요한 샘플은 고정 된 후 4 ° C에 저장할 수 있습니다 (1.1.8.2 참조). PI 용액으로 염색을 수행 한 다음 실험의 모든 샘플을 동시에 FACS 분석합니다. PI는 600 nm 부근에서 넓은 방출 피크를 갖는 535 nm에서 여기 될 때 높은 형광 신호를 생성하는 이중 가닥 DNA의 주요 그루브로 인터 칼 레이션된다. PI는 또한 이중 가닥 RNA에 결합 할 수 있기 때문에 최적의 DNA 분해능을 위해 RNase로 세포를 처리해야합니다.
    1. 새로 만들어진 PI 염색 액을 준비하십시오. PI 저장 용액은 PI 분말을 PBS ( 예 : 5 mg / mL)에 용해시켜 제조 할 수 있습니다. 저장 용액을 4 ° C (어둠)에 보관하십시오. 염색 액은 PI (140 μM), 시트르산 나트륨 (38 mM) 및 Triton X-100 (0.01 % v / v)로 구성됩니다.
    2. 적절한 표면 ( 예 : 오븐)을 37 ° C로 예열하십시오.
    3. 원심 분리 고정 세포 (450 XG, 5 분, RT), 상층 액 (에탄올)을 따라 내고 1X PBS로 한 번 씻어.
    4. 세포를 다시 원심 분리하고 PBS를 제거하고 샘플 당 PI 염색 용액 300 μL를 추가합니다 (FACS 설정을위한 샘플 중 하나를 제외하고이 샘플에 PBS를 넣으십시오).
    5. FACS 튜브 (5 ML 둥근 바닥 폴리스티렌 튜브)에 세포를 전송합니다.
    6. 37 ° C에서 어둠 속에서 30 분 동안 샘플을 혼합하고 품어 각 샘플에 RNase A 1 μL를 추가합니다. 시료는 4 ° C에서 최대 2 ~ 3 일 동안 빛으로부터 보호하여 보관할 수 있습니다.
    7. 플로우에 의한 샘플의 DNA 함량 분석cytometry. PI로 염색 된 비동기 샘플로 FACS 분석 보정 설정을 정의합니다. PI (autofluorescence) 검사를 위해 빈 샘플 (PI 염색 용액없이)을 사용하십시오. 유동 세포 계측법에 의한 DNA 내용물의 PI 염색 - 중재 분석의 기초는 이전에 설명되어 있습니다 9 .
  5. 이중 인산 -H3 (Ser 10) / PI 염색에 의한 유사 분열 지수 측정
    참고 : 유사 분열을 진행하는 세포는 세린 10 (pH3)에서 인산화 - 히스톤 H3에 특이적인 항체로 유세포 분석기로 쉽게 검출 할 수 있습니다. 수반되는 PI 염색은 세포 집단의 DNA 함량에 근거한 분포를 결정하는데 유용합니다. FACS 설정의 최적 구성에는 5 개의 시료가 필요합니다 : blank, PI 전용, pH3 전용, 2 차 항체 만 및 이중 염색.
    1. 고정 세포 (450 XG, 5 분, 4 ° C)를 원심 분리기 및 뜨는 폐기. 15 mL 튜브에서 염색을 수행하기위한 다음 단계가 설명되어 있습니다.
    2. 1을 더하여 세포를 씻는다.펠렛 및 원심 분리기 (450 xg, 5 분, 4 ° C)에 ML PBS - T (PBS + 0.05 % 트윈 -20). 뜨는 제거하십시오.
    3. PBS-T + 3 % BSA 100-200 μL에 희석 한 항 -pH3 항체를 첨가하고 RT에서 2 시간 동안 흔들어 주면서 (4 ℃에서 O / N) 배양한다.
    4. 2 ML PBS - T (PBS + 0.05 % 트윈 -20)와 원심 분리기 (450 XG, 5 분, 4 ° C)를 추가합니다. 뜨는 제거하십시오.
    5. 펠렛에 2 ML PBS - T를 추가하여 한번 더 씻어, 원심 분리기와 뜨는을 폐기하십시오.
    6. PBS - T + 3 % BSA 100-200 μL에 희석 한 (1 : 500) 항생제 (anti-rabbit AlexaFluor 488 선택 pH3 항체의 경우)를 첨가하고 RT (또는 O / N 4 ℃에서). 빛으로부터 시료를 보호하십시오.
    7. 단계 1.5.4에서 설명한대로 원심 분리로 PBS-T (2 mL)로 두 번 씻는다.
    8. 설명 된대로 PI 염색을 수행하십시오 (1.4.1 ~ 1.4.6 단계).

2. 유전자 발현 분석을위한 샘플 수집 및 처리

  1. 갖다1.5 mL의 microcentrifuge 시료는 냉동실에서 RNA 분리 시약으로 추출하여 화학 물질에 대한 안전 캐비닛 내부의 RT에서 해동 시키십시오.
  2. 각 샘플에 400 μL의 클로로포름을 첨가하고 완전히 혼합 될 때까지 격렬히 흔들어주세요. (그러나 와동하지 마십시오). RT에서 5 분 동안 표본을 품어 낸다.
  3. benchtop microcentrifuge에서 15 분 (≥8,000 xg, 4 ° C) 동안 튜브를 원심 분리하십시오.
  4. 수성 (상) 단계를 새로운 1.5 ML microcentrifuge 튜브로 옮기고 전달 된 부피를 등록하십시오 (절차를 단순화하기 위해 실험의 모든 샘플에서 동일한 부피를 수집하는 것이 좋습니다).
  5. 혼합하면서 수성 상에 1 부피의 100 % 에탄올을 천천히 (1 방울 씩) 첨가한다. 원심 분리하지 마십시오.
  6. 상업용 RNA mini prep 키트로 다음 단계를 수행하십시오. 형성 될 수있는 침전물을 포함하여 각 시료를 최대 700 μL까지 2 mL 수집 튜브 (제조업체가 제공)의 스핀 컬럼에 피펫 팅하십시오.
  7. 닫기뚜껑과 원심 분리기 (≥8,000 g, RT)를 15 초간 씻는다. 플로우 스루를 폐기하십시오. 나머지 샘플 (있는 경우)을 사용하여 이전 단계를 반복하십시오.
  8. 다음 단계를 위해 적절한 RNA 농도를 얻기 위해 30 ~ 40 μl의 핵산 분해 효소가없는 H 2 O로 각 시료를 용리하고 RNA 세척 및 용출에 대한 제조업체의 지침을 따르십시오.
  9. 흡광도 측정에 의한 시료의 RNA 농도와 순도를 결정하십시오 ( A 260/280 비율 2.0-2.1은 RNA 샘플의 양호한 순도를 나타냄). RT-qPCR 분석에 사용할 때까지 -80 ° C에서 RNA 샘플을 저장하십시오.
  10. cDNA 로의 RNA 전환 및 그 후의 정량적 PCR을 위해, 샘플 당 1 μg의 RNA를 취하고 제조업 자의 지시에 따라 레트로 트랜스 클리 티아 제 반응을 준비한다. 얻은 cDNA 샘플은 4 ° C (2 일간) 또는 -20 ° C (장기간) 보관할 수 있습니다.
    참고 : 실시간 PCR을위한 샘플 준비, 프라이머 디자인 및 기타 고려 사항은참고 문헌 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

세포 동기화를위한 Thy-Noc 및 HU 기반 프로토콜의 도식적 표현.

그림 1 은 U2OS 세포 동기화 및 후속 샘플 수집에 필요한 단계를 요약하여 세포주기를 통한 진행을 확인하고 유전자 발현 분석을 수행합니다.

Phospho-H3 및 PI 염색은 동기화 방법을 선택하는 좋은 평가 변수입니다.

세포 동기화 절차는 배양 된 세포의 본질적 이질성으로 인해 각 세포주에 대해 평가되고 최적화되어야합니다. 유사 분열의 동기화는 일반적으로 Thy-Noc 프로토콜을 통해 이루어지며 노코 다졸 처리 후 유사 분열 세포의 농축은 전형적인 유사 분열 마커 인 인산화 된 히스톤 H3 (pH3)에 특이적인 항체로 평가할 수 있습니다. 이데 pH3 양성 세포의 증식은 유사 분열 세포와 유사 분열을 일으키지 않는 4C-DNA 함량을 가진 세포 (PI 염색에 의해 모두 "G2"집단으로 간주 됨)를 구별 할 수있게한다. U2OS 세포에서 Thy-Noc 프로토콜은 4C DNA 함량 (그림 2A, 왼쪽 상단 그래프, PI 염색에 의한 청색 모집단)이있는 집단의 유의 한 농축을 유도하고,이 집단 내의 유사 분열 세포의 상대적 분율은 일상적으로 상당히 순수했다 비동기 세포에서 2 %에 비해 91 %). Nocodazole의 방출은 2C DNA 함량 ( 그림 2A , 오른쪽 위 그래프, PI 염색에 의한 녹색 개체군)과 pH3 양성 유사 분열물의 누적에 의해 결정된대로 다음 G1 단계로의 세포의 동시 진행을 초래한다 세포 ( 그림 2A , 오른쪽 아래 그래프). 따라서, pH3 염색 결과는 U2OS 세포의 유사 분열 동기화를위한 Thy-Noc 프로토콜의 적합성을 확인 하였다.

G1 / S에서의 U2OS 세포의 동기화는 널리 사용되는 2 개의 동기화 제인 티미 딘 및 하이드 록시 유레아로 시험 하였다. 세포주기의 상이한 단계에서의 농축은 PI 염색 및 FACS 분석 및 표에 요약 된 세포의 비율 ( 그림 2B ) U2OS 세포가 Thy (2mM)에 24 시간 노출되는 것은 G1 / S 경계에서 세포를 정지시키는 데 비효율적 이었지만 ( 그림 2B ), HU 또는 이중 thymidine (DT)의 발현은 만족스런 체포를 보였으 나, HU 처리 된 세포 만이 완전히 회복되어 세포주기를 통해 적절히 진행되었다. 대조적으로, DT 차단은 세포 집단의 상당 부분에서 영구적 인 G1 정지를 유도했다 6 시간 시점에서 G1에서 13.3 %의 세포가 DT와 HU 기반의 프로토콜에서 3.1 %), 이는 세포 동시성에 부정적 영향을 미쳤다. 따라서 HU에 대한 노출은 적절한 G1 / S 동기화 메타U2OS 세포에 대한 od.

Thy-Noc 및 HU 기반 프로토콜은 셀 동기화를 보완합니다.

그림 3A (0 시간 시점)에 표시된 바와 같이, Thy-Noc 프로토콜에 의한 처리는 M 상 엔트리 (4C DNA 함량의 집단, 파란색으로 표시)에서 U2OS 세포를 효율적으로 체포하고, HU 프로토콜에 의한 처리를 G1 / S 경계 (2C DNA 함유 인구, 녹색 / 적색으로 표시). 약물을 제거하면 세포는 동기화 된 방식으로 세포주기를 시작하여 진행합니다. Thy-Noc 처리로부터 회수 된 세포는 초기 G1 단계 (녹색 모집단)에서 처음 관찰되었고,이어서 G1을 통해 그리고 균일 한 방식으로 S 단계까지 전이되었다. HU 처리에서 회수 된 세포는 S (적색의 개체군) 및 G2 / M을 통해 동 기적으로 진행되었다. 다음 세포주기를 통한 진행은 동시성의 상실과 수반되었다. Consequently,이 시점 이후의 동시성의 상실로 인해 15 시간 이상의 시점이 분석에 포함되지 않았습니다.

Cyclin E1 (G1 / S cyclin)과 Cyclin B1 (G2 / M cyclin) (세포주기에서 단단히 조절되는 수준의 두 단백질 및 유사 분열 마커 pH3)의 웨스턴 블랏 분석은 각 세포주기 단계를 확인했다 FACS에 의해 분석 된 시점 ( 도 3B ). 예상대로, M 상 (Thy-Noc 동기화 된 세포의 0 시간 시점에 상응 함) 및 G2 내지 M 상 (HU 동기화 된 세포의 9 시간 내지 12 시간 시점)의 세포는 사이클린 B1의 극적인 축적을 나타내었다 및 cyclin E1의 검출 할 수없는 수준. 또한, Cyclin B1 수준은 G1 단계 (nocodazole에서 방출시 3 시간)에서 감지 할 수 없었으며 세포가 S-Th-Noc 방출 후 G-2로 (HU 방출 후) 진행됨에 따라 점진적인 축적이 관찰되었습니다. Thy-Noc 동시성에 0 h에 세포의 강한 pH3 레테르를 붙이기에이 시점에서 유사 분열시에 체포 된 세포의 농축이 확인되었다. HU로부터의 방출 후 12 시간에서 pH3 수준을 약간 증가 시키면 4C DNA 함유 세포의 대부분이 여전히 G2에 존재하는 반면, 유사 분열시 세포의 비율은 15 시간 시점에서 증가하는 것으로 나타났다. 대조적으로 Cyclin E1의 발현 양상은 초기 G1에서 S-phase 진입 (Thy-Noc 절차) 및 G2 / M 단계 (HU 절차)에서 점차적으로 사라짐으로 점진적인 축적을 보였다.

세포주기 내에서 차별적으로 조절되는 유전자의 발현은 Thy-Noc- 및 HU- 기반 동기화의 조합으로 정확하게 분석 될 수있다.

세포주기 조절 유전자 발현 분석이 2 가지 세포 동기화 방법의 조합에 의해 가장 잘 분석된다는 개념 증명으로서, 세포주기에서 상이한 발현 동역학을 갖는 것으로 알려진 2 종의 E2F 계열 구성원의 mRNA 발현(E2F1 및 E2F7)을 역전사 효소 정량적 PCR (RT-qPCR)로 검사 하였다. 이를 위해, Thy-Noc 및 HU 동기화 프로토콜이 도 1 에 요약 된 바와 같이 사용되었고, 세포주기 분포는 도 3A 에 도시 된 바와 같이 유동 세포 계측법에 의해 모니터링되었다. 그림 4 는 세포주기를 통해 E2F1 (상단 두 그래프)와 E2F7 (하단 두 그래프) mRNA 프로필을 보여줍니다. E2F1을 코딩하는 유전자의 전사 조절 프로파일은 Thy-Noc 과정에서 가장 잘 관찰되었으며, 이로써 E2F1 발현은 초기 G1 단계에서 늦은 G1 단계 (Thy-Noc 방출 9 시간 후, 녹색 배경)에 도달하기 시작했다. 이후 S 및 G2 단계 (빨간색과 파란색 배경)로 진입하면서 그 수치가 감소했습니다. 대조적으로, E2F7 유전자 발현 동역학은 HU- 기반 동조 (하부 그래프; 적색 배경) 후에 가장 잘 검출되었으며, 방출로부터 6 시간 째에 최대 발현 (S에서 G2 상전이에 해당)이 검출되었다. Thy-Noc반면에, 절차는 E2F7의 유도를 관찰하기에 적합 하였지만, 그것의 하향 조절은 관찰하지 않았다. 주목할 것은, 15 시간 시점을 넘어서는 분석의 연장은 비록 mRNA 변이의 범위가 감소되었지만 (데이터는 나타내지 않음), 초기 시점의 E2F1 및 E2F7 mRNA 발현 프로파일을 재현한다는 것을 알 수있다. 전체적으로, 이러한 결과는 유전자 발현 동역학뿐만 아니라 mRNA 수준의 정확한 진폭 변화를 평가하기 위해 적절히 동기화 된 세포 집단과 작업하는 것이 중요하다는 것을 확인시켜줍니다.

세포 동기화는 항암 요법의 영향을받는 유전자 발현 프로그램에 대한 더 나은 이해를 제공합니다.

항암제 인 mitomycin C (MMC)가 세포주기 동역학 및 유전자 발현에 미치는 영향을 분석하기 위해 U2OS 세포를 먼저 HU와 동기화시킨 다음 MMC로 치료했습니다. 이 유전 독성 물질에 노출되면 체표가 활성화됩니다.( 그림 5A , 아래 줄, 푸른 피크). 대조적으로, 처리되지 않은 세포는이 시점에서 G1을 통해 정상적으로 진행되었다 ( 도 5A , 상부 줄, 녹색 피크). 장기 MMC 치료 (36 시간)는 G2 단계에서 세포의 영구적 정지를 나타 냈지만 MMC 치료가없는 세포는 비동기 세포 집단과 비슷한 세포주기 분포를 보였다.

E2F1과 p21 Cip1 (CDKN1A)은 MMC 처리 세포에서 유전자 발현 분석을 위해 선택되었다 ( 그림 5B ). E2F1의 발현은 그림 4 에서 설명한 바와 같이 G1기에 의존적 인 반면 p21 Cip1 발현 유도는 세포주기 정지 / 체크 포인트 활성화 24 와 결합되어있다. 도 5B (상단 좌측 그래프)에 나타낸 바와 같이, E2F1 유전자 발현 ki세포가 G1 / S 및 S기로 진행됨에 따라 MMC의 존재 또는 부재 하에서 유사성이 나타났다. MMC에 처리 된 세포가 대조군 세포보다 낮은 E2F1 mRNA 수준을 나타내는 MMC에 15 시간 노출 된 후 MMC 처리 및 처리되지 않은 세포에서 E2F1 유전자 발현의 차이가 관찰되었다 ( 그림 5B , 실선과 점선 비교). 그러나 명확한 표현의 차이에도 불구하고 MMC에 의해 부과 된 지속적인 G2 상 정지로 인해 MMC 처리 및 미처리 세포의 세포주기 프로파일이이 시점에서 분명히 다르므로 MMC가 E2F1 발현을 하향 조절한다고 결론 지을 수 없다. 실제로, MMC- 노출 된 세포에서 15 시간 시점 이후의 낮은 E2F1 mRNA 수준은 E2F1 전사 조절에서의 MMC 효과보다는 세포주기 동역학에서의 약물 효과를 반영한 ​​것으로 보인다.

E2F1과 달리 p21 Cip1 은 MMC 반응 유전자입니다. p의 상승 된 레벨21 Cip1 은 HU- 부과 된 G1 / S 정지에서 검출되어, HU에 의한 G1 검사 점 활성화를 나타내었고 ( 도 5B , 0 시간 시점), 그 발현은 비 MMC 처리 된 세포에서 감소하였고, 방출 후 교란되지 않는 세포주기 진행과 일치 하였다 체포. 대조적으로, MMC 치료는 세포가 G2 단계 (MMC 노출 9 시간)에 축적되는 동안 상승 된 p21 Cip1 mRNA 수준 ( 그림 5B , 오른쪽 위 그래프, 실선)으로 이어진다. 세포주기 프로파일이 대조군과 MMC 처리 된 세포에서 9 시간 시점에서 유사하다는 사실에도 불구하고, 유전자 발현 분석은 근본적인 차이를 보여준다. MMC 노출 세포는 활성화 된 G2 체크 포인트를 나타내었고, p21 Cip1 발현의 유도에 의해 입증되었지만, 처리되지 않은 세포는 낮은 p21 Cip1 수준의 G2를 통해 교란되지 않는 전이를 겪고 있었다.

유동 세포 계측법 분석 ( Figure 5A)와 RT-qPCR ( 그림 5B , 상단 그래프)에서 얻은 결과를 각각의 선택된 유전자 ( 그림 4B , 하단 그래프)에 대한 단일 그래프로 결합시켰다. mRNA 발현 수준은 막대의 상대적 높이로 표시되는 반면, 각 시료에 대한 세포의 세포주기 분포는 색의 비율로 나타내었다 : G1 상 (2C DNA 함량)의 녹색, G2 상 (4C DNA 함량)의 청색 및 적색 S 상 (중간 DNA 함량). 이러한 그래픽 표현의 결합 된 방법은 세포주기 분포 및 유전자 발현 분석을 해석하는 데 도움이 될 수 있습니다.

요약하면, 유전자 발현 분석은 배양 동조 방법과 결합하여 유전 독성 인자 - 반응성 유전자 (p21 Cip1 )의 동정을 가능하게하고, 약제로 처리되거나 처리되지 않은 세포 사이의 E2F1 발현에서 관찰 된 변화가 간접적 이었음을 제시 하였다.세포의 세포주기 분포의 차이와 관련이있을 수 있습니다.

그림 1
그림 1 : 두 개의 상보적인 세포 동기화 프로토콜의 개요 : Thymidine-Nocodazole과 Hydroxyurea. ( A ) 포유 동물 세포주기의 그래픽 표현으로, 세포주기 정지가 세포 동기화 방법에 의해 달성되는 지점을 가리킨다. Thy-Noc 기반 절차는 초기 유사 분열 (M)에서 세포를 차단하고 HU는 G1 / S 경계에서 세포를 차단합니다. ( B ) 세포 동기화의 Thy-Noc 프로토콜의 도식적 표현. U2OS 세포에서 유전자 발현 분석 및 세포주기 모니터링에 일반적으로 사용되는 단계가 표시됩니다. ( C ) 셀 동기화의 HU 기반 프로토콜의 도식적 표현. U에서 유전자 발현 분석 및 세포주기 모니터링에 일반적으로 사용되는 단계가 표시됩니다2OS 세포. 혈청 기아를 생략 한보다 짧은 동기화 절차는 HU에 24 시간 노출로 최적의 동기화가 이미 달성 된 경우에도 적용될 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : 적합한 동기화 방법 평가. ( A ) 비동기 및 Thy - Noc 동기화 U2OS 세포 배양 물은 각각의 경우에 유사 분열 세포의 분율을 평가하기 위해 pH3 염색을 수행했습니다. 동시 PI 염색으로 세포의 DNA 함량을 모니터링 할 수있었습니다. 비동기 집단에서는 4C DNA 함량이있는 세포의 최소 분획 만이 유사 분열 마커에 양성이었다. 대조적으로 Thy-Noc 프로토콜은 효율적으로 accu(pH3 염색에 대해 양성) 및 노코 다졸 (3 시간 시점)의 제거시 다음 G1 단계 (녹색으로) 로의 적절한 진행을 허용한다. 각 단계의 세포 백분율은 표에 요약되어 있으며 PI 히스토그램에 사용 된 색상에 따라 색상이 표시됩니다. 2C DNA 내용 세포 (G1)의 경우 녹색, 4C DNA 내용의 세포 인 경우 파란색 (G2 및 M 세포 포함) G2는 그림을 단순화하기 위해 히스토그램에, 중간 DNA 함량이있는 세포에는 적색 (S). ( B ) Thymidine과 HU는 U2OS 세포에서 세포주기 동기화 효율을 평가 받았다. 세포를 thymidine (1 또는 2 24 시간 동안 HU를 투여 한 후 PI 염색과 FACS 분석을 통해 세포 동기화를 검사하였고, FACS 데이터 분석을 위해 Summit을 사용 하였다. 이 그림의 확대 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : Thy-Noc 및 HU 매개 동기화 후 셀의 균일 진행을위한 시간 프레임 개요. ( A ) U2OS 세포는 Thy-Noc 프로토콜 (위의 행) 또는 HU 프로토콜 (아래 행)에 의한 G1 / S 전이에 의해 M 상 동조되었다. 세포주기 진행은 PI 염색 및 화학 물질 방출 후 매 3 시간마다 세포의 DNA 함량에 대한 FACS 분석에 의해 모니터되었다. Summit은 FACS 데이터 분석에 사용되었습니다. Thy-Noc- 매개 체포로부터 방출 된 세포는 3 시간 후 초기 G1 단계에서 동 기적으로 진입하여 후속 시점에서 S 단계까지 균일하게 진행되었다. HU- 매개 체포로부터 방출 된 세포는 S 및 G2 단계를 통해 동 기적으로 전이되었다. 방출 후 15 시간 후에 수집 된 세포는 다음 단계로의 진행 만이 달성되었으므로 세포 동기화에 대한 한계를 나타냈다인구의 일부분으로 ( B ) 세포 동기화는 릴리스 후 3 시간마다 및 15 시간마다 단백질 샘플을 수집하여 웨스턴 블랏 분석에 의해 모니터링 하였다. Cyclin E1 (CCNE1), 주로 G2에서 M 단계 및 유사 분열 세포의 표지자 인 S 기, cyclin B1 (CCNB1)을 통해 축적 된 cyclin은 유동 세포 계측법에 의해 관찰 된 세포주기 분포 프로파일을 뒷받침한다. 액틴 B (ACTB)는 내인성 로딩 대조군으로 사용되었는데, 그 수준은 세포주기에 의존하지 않기 때문이다. (Mitxelena 8 에서 수정 됨). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
도표 4 : 세포주기 단계 연구의 학문 t 상보 적 세포 동기화 방법에 의한 E2F 패밀리 구성원의 전사. U2OS 세포는 Thy-Noc 프로토콜에 의해 G2 / M에서 또는 HU 처리에 의해 G1 / S에서 체포되었으며, 검체 채취로부터 3 시간에서 15 시간마다 RNA 추출 및 FACS 분석을 위해 샘플을 수집 하였다. RT-qPCR에 의한 유전자 발현 분석은 G1 (외측 그래프)에 외접 된 E2F1 발현 프로파일을 나타내었고 E2F7 유전자 발현 프로파일은 G2 위상 (오른쪽 그래프)을 통한 점진적 하향 조절과 함께 S 상으로 이동되었다. TBP를 내인성 비 세포주기 조절 유전자로 사용하여 mRNA 수준의 상대적인 변화를 계산하였고, 결과는 평균값 및 표준 편차 (SD)로 나타내었다. 세포주기를 통한 진행은 PI 염색 및 세포의 DNA 함량에 대한 FACS 분석에 의해 결정되었다. 세포주기 단계는 흑색 (초기 유사 분열), 녹색 (G1 단계), 적색 (S 단계) 및 청색 (G2 단계)의 그래프에서 배경색으로 나타냈다..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target ="_ blank "> 이 그림의 확대 버전을 보려면 여기를 클릭하십시오.

그림 5
도표 5 : 유전자 발현과 세포주기 진행에 대한 MMC의 영향. U2OS 세포를 HU로 24 시간 동안 처리하고, HU- 매개 G1 / S 정지로부터 방출 된 직후에 MMC (250nM)를 첨가 하였다. FACS 분석 및 유전자 발현 분석을위한 샘플을 표시된 시점에 수집 하였다. ( A ) 세포주기를 통한 진행은 PI 염색 및 Summit 소프트웨어에 의한 DNA 함량의 FACS 분석에 의해 결정되었다. MMC는 S 기 (적색 집단)와 G2 기 (청색 집단)의 영구 체포를 통한 진행의 완만 한 지연을 유도 하였는데, 이는 15 시간의 치료 (더 낮은 열) 후 G1 (녹색 개체군) 비 -처리 된 (상부 행) 세포. ( B ) RT-qPCR에 의해 MMC 처리 또는 처리되지 않은 세포에서 E2F1 및 p21 Cip1 유전자 발현 분석을 mRNA 수준에서 수행 하였다. Oxa1L은 내인성 비 MMC 반응 유전자로 사용되었고 결과는 평균값과 SD로 나타내었다. 상부 그래프는 HU로부터의 방출 및 MMC의 첨가 후 선택된 유전자의 상대적인 mRNA 수준을 나타낸다. 하위 그래프는 FACS 분석과 RT-qPCR로 얻은 데이터를 결합합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

세포주기에서 일시적인 역할과 특정 역할에 관여하는 미세 조정 된 유전자의 분석에는 균일 한 세포 집단이 필요합니다. 많은 연구자들은 이러한 목적을 위해 오래 동안 종양 세포주를 일상적으로 사용하고 있으며 정의 된 세포주기 단계에서 가능한 한 많은 세포를 축적하려는 목적으로 동기식 (또는 부분적으로 동시적인) 세포군을 얻기위한 다양한 방법이 개발되었습니다. 더욱이, 잘 확립 된 동기화 접근법을 개선하고 최적화하기 위해 많은 노력이 기울여왔다. 그럼에도 불구하고, 모든 동기화 프로토콜에는 세포 배양의 이질성, 동기화 절차의 차선의 효율성, 또는 화학 물질 동기화 제가 세포 기능에서 갖는 이차 효과에 기인 할 수있는 결점이있다. 셀 동기화 프로토콜을 적용 할 때 이러한 제한 사항을 고려해야합니다. 연구자는 자신의 구체적인 동기화 방법을 확인해야합니다.ic 세포 유형 또는 실험. 똑같은 방법으로 다른 세포주를 재배해도 몇 가지 이유로 동기화 속도가 달라질 수 있습니다. 한편, 세포주기의 길이는 선택된 세포주에 따라 다를 수있다. 다른 한편으로, 동일한 억제제는 각 세포주 ( 25) 의 특정 특성으로 인해 상이한 세포주에 대해 대조 효과를 가질 수있다. 또한, 원하지 않는 부작용을 피하거나 최소화하기 위해 선택된 억제제 농도와 노출 시간을 각 세포주에 맞게 조정해야합니다. 이러한 모든 측면의 최적화 후에도 주어진 세포주기 단계에서 세포의 100 % 축적은 달성되지 않으며 화학 물질 제거 후 점진적으로 비동기가 증가합니다. 따라서, 동기화 방법이 특정 시간 프레임에서 부분적으로 세포 집단 농축을 얻을 수 있다는 것을 이해하는 것이 중요합니다.

이 w ork 2 개의 동기화 절차 (Thy-Noc 및 HU)는 U2OS 셀에서의 사용을 위해 최적화되었으며, 둘 다 셀 동기화 분석 28 , 29 , 30 에 광범위하게 사용됩니다. M 단계에서 세포를 포착하기 위해, thymidine과 nocodazole의 조합이 U2OS 세포에서 효율적으로 작용했다. 노코 다졸의 세포 독성 특성을 고려할 때, 고도로 동기화 된 세포 집단뿐만 아니라 최적의 세포 생존을 얻기 위해이 억제제의 노출 시간과 투여 량을 결정하는 것이 중요했습니다. 티미 딘 (또는 이론적으로 다른 유사한 화합물, 예를 들어 hydroxyurea)에 노출되면 G1 및 S 단계에서 세포 집단이 풍부 해져서 필요한 노코 다졸 노출 시간이 감소합니다. G1 / S에서 세포를 포착하기 위해 이중 티미 딘 (double thymidine) 블록을 포함하여 여러 가지 가능성을 고려했다.이 방법은 여러 세포주의 동기화에 매우 효율적인 방법이다그러나 티미 딘은 U2OS에서 실망스러운 결과를 보였으 나 폐기되었다. 티미 딘 처리의 한 라운드는 세포 분획만을 정지시키는 반면, 티미 딘 처리의 두 라운드는 G1 / S에서 세포의 대부분을 효과적으로 차단하는 반면 G1 (thymidine)의 방출과 세포주기의 진행이 균일하게 진행되지 않았으며, hydroxyurea 처리로 G1 / S 차단 효과가 우수하고 S와 G2를 통해 세포가 균일하게 진행되었다.

세포 발현 위상 분포는 유전자 발현을 더 잘 해석하기 위해 세포 동기화 실험을 수행 할 때마다 ( 예 : propidium iodide 염색 또는 pH3 표지, FACS 분석, 또는 세포주기 특이 적 단백질의 면역 블로 팅으로) 검사해야한다 ( 16 , 33 , 34) . 결과. 잘못된 동기화 효율성세포주기를 통한 진행의 차이 또는 약간의 실험 간 차이로 인해 잘못된 결론이 도출 될 수 있습니다. 예를 들어, 노코 다졸 치료는 특정 조건 하에서 유사 분열 검사 점 기능의 실패를 일으키는 것으로 알려져 있습니다. 이것은 4C DNA 함량이있는 세포군을 발생 시키지만, 유사 분열을 일으키는 분열을 "미끄러 져서"4C 함량으로 중간 단계로 되돌아가는 유사 분열 마커 34 에 대해서는 음성이다. anti-phospho-H3 항체 ( 그림 2A 참조 )로 면역 염색을 통해 검출 할 수있는 세포 서브 세트의 출현은 노 코다 졸 세척 단계에서 콜드 PBS를 사용하여 최소화 할 수 있습니다. 세포 동시성에 영향을 미치는 화학 저해제의 사용과 관련된 또 다른 효과는 세포가 능동적으로 세포주기를 통해 진행을 억제하는 메커니즘 인 이러한 화합물에 대한 노출과 관련된 검문소 활성화이다정확히 정확한 지점 (예 : 정확한 DNA 복제, 스핀들 조립) 이전의 공정이 해결되었는지 확인하십시오 38 . 동기화 방법이 적절하기 위해서는 체포가 효율적 일뿐만 아니라 완전히 되돌릴 수 있어야합니다. 따라서 세포주기 억제제가 방출 된 후에는 p21 CIP 와 같은 검사 점 마커의 발현을 분석하여 억제제의 효과가 회복되었는지 여부를 분석하는 것이 중요합니다. 도 5B 는 p21 CIP 수준이 방출 후 기저 발현으로 감소 되었기 때문에 히드 록시 우레아 동기화 된 U2OS 세포가 체크 포인트를 효율적으로 분해한다는 것을 보여준다.

U2OS 세포에서 세포주기 정지시의 농축 백분율은 세포 동조에 대한 다른 연구에서보고 된 범위에 속합니다 29 , 30 , 39 : 4C DNA 함량 (PI 염색)을 가진 세포의 약 85 %Thymidine-nocodazole 치료시 유사 분열 (pH3 양성 표지) 환자의 90 %, hydroxyurea 치료 후 약 80-90 %의 G1 / S 세포가 관찰되었다. 세포주기 정지로부터의 방출은 전형적으로 균일 한 방식으로 다음 단계 또는 2 단계를 통해 적절한 진행을 유도하지만, 동기화는 변하지 않게 수 시간 후에 사라지고 세포는 동기화 된 방식으로 전체 세포 분할주기를 완료 할 수 없다. 그러므로 세포주기의 모든 단계에 대한 완전한 그림을 얻기 위해이 연구에서 제안 된 프로토콜은 세포주기의 다른 부분에서 두 가지 동기화 방법을 사용한다. 도 3A에 도시 된 바와 같이, 각각의 개별 프로토콜은 전체 세포주기에 걸쳐 동시성을 보장하지 못했다. Thy-Noc 기반 동기화는 G1에서 S 단계에서 발생하는 프로세스에 적합한 프레임을 제공하는 반면 HU에서 출시 된 셀은 S 및 G2 / M에서 발생하는 이벤트 분석에 적합했습니다. 선택된 두 절차의 상보성E2F 전사 인자 계열 (E2F transcription factor family)의 두 구성원을 분석하여 세포주기의 여러 단계에서 동기화하는 두 가지 방법의 조합이 세포주기 조절 유전자 발현을 정확하게 확립하는 강력한 접근법이라는 아이디어를 뒷받침했습니다 ( 그림 4 ). 패턴을 이해하고 그들의 생리 학적 역할을 더 잘 이해할 수 있습니다.

셀 동기화 절차의 강력한 응용 프로그램은 잠재적 인 치료제의 영향을 평가하는 데 중점을 둡니다. 항 종양 활성을 갖는 화합물과 같은 제약 화합물의 효과는 종종 비동기 세포 집단에서 연구된다. 이러한 설정에서 세포 죽음, 세포주기 정지 또는 노화와 같은 여러 과정의 유도에서 선택된 약물의 함의를 결정하는 것이 가능합니다 7 , 40 . 그러나 정확한 분자 현상을 규명하기위한 비동기 세포 세팅 선택그러한 프로세스는 불완전하거나 부분적으로 잘못된 결론을 도출 할 수 있습니다. 간과하기 쉬운이 지점은 E2F1 및 p21 Cip1 유전자 발현에 대한 화학 요법 약물 MMC의 효과를 분석하여 본 연구에서 설명했다 ( 그림 5 ). 전체적으로, 세포 동기화 및 유전 독성 제제로의 처리의 조합은 유전 독성 제제에 반응하는 유전자의 발현을 연구하고 그의 작용제에 의해 부과 된 세포주기 섭동에 의해 영향을받는 유전자와 구별하기에 적합한 상황을 제공한다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

Zubiaga 및 Altmeyer 연구소의 구성원에게 도움이되는 토론과 기술 지원에 감사드립니다. 이 작업은 바스크 정부 (IT634-13 및 KK-2015 / 89)와 바스크 국 UPV / EHU (바스크 정부)의 스페인 교육부 (SAF2015-67562-R, MINECO / FEDER, UE) UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
두 개의 상보적인 세포 동기화 프로토콜에 의한 세포주기 조절 유전자 발굴 연구
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter