Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Изучение экспрессии генов, регулируемых клеточным циклом, двумя протоколами синхронизации комплементарных ячеек

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Мы сообщаем о двух протоколах синхронизации ячеек, которые предоставляют контекст для изучения событий, связанных с конкретными фазами клеточного цикла. Мы показываем, что этот подход полезен для анализа регуляции специфических генов в невозмущенном клеточном цикле или при воздействии агентов, влияющих на клеточный цикл.

Abstract

Программа экспрессии генов клеточного цикла представляет собой критический шаг для понимания процессов, зависящих от клеточного цикла, и их роли в таких заболеваниях, как рак. Анализ экспрессии генов, регулируемый клеточным циклом, зависит от синхронизации клеток на определенные фазы. Здесь мы описываем метод, использующий два дополнительных протокола синхронизации, которые обычно используются для изучения периодического изменения экспрессии генов во время клеточного цикла. Обе процедуры основаны на временном блокировании клеточного цикла в одной определенной точке. Протокол синхронизации обработкой гидроксимочевиной (HU) приводит к клеточному аресту в поздней фазе G1 / ранней S, а высвобождение из опосредованного HU задержания обеспечивает популяцию клеток, равномерно прогрессирующую через S и G2 / M. Протокол синхронизации лечения тимидином и нокодазолом (Thy-Noc) блокирует клетки в раннем митозе и высвобождение из опосредованного Thy-Noc остановки обеспечивает синхронизированную клеточную популяцию, подходящую для фазы G1 и S-фазыПопробуйте исследования. Применение обеих процедур требует мониторинга профилей распределения клеточного цикла, которые обычно выполняются после окрашивания пропидиум иодидом (PI) клеток и опосредованного потоком цитометрии анализа содержания ДНК. Мы показываем, что совместное использование двух протоколов синхронизации является надежным подходом к четкому определению транскрипционных профилей генов, которые дифференциально регулируются в клеточном цикле ( то есть E2F1 и E2F7) и, следовательно, лучше понимать их роль в клеточном цикле процессы. Кроме того, мы показываем, что этот подход полезен для изучения механизмов, лежащих в основе лекарственной терапии ( то есть митомицина С, противоопухолевого агента), поскольку он позволяет различать гены, которые реагируют на генотоксический агент от тех, на кого воздействуют только возмущения клеточного цикла Наложенных агентом.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Переход через все фазы клеточного цикла связан с плотно регулируемой программой экспрессии генов. Считается, что это скоординированное «включение и выключение» транскрипции генов в течение клеточного цикла находится под контролем сложных регуляторных систем транскрипции, регулирующих не только время, но также и уровни экспрессии генов. Известно, что дерегулирование компонентов ключевого клеточного цикла способствует развитию нескольких заболеваний и является хорошо зарекомендовавшим себя признаком опухолевого генеза 1 , 2 . Проведенные в клетках дрожжей и млекопитающих широкомасштабные транскриптомические анализы показали, что большое количество генов проявляют периодические образцы экспрессии генов в клеточном цикле, что указывает на то, что флуктуация транскрипции во время клеточного цикла является отражением временного требования к данному продукту гена В точной фазе 3 , 4 , 5 .

Основная задача изучения экспрессии генов, регулируемых клеточным циклом, - это синхронизация клеток на фазах конкретного клеточного цикла. Синхронизация клеток помогает интерпретировать ассоциацию шаблона экспрессии генов с конкретным фазовым переходом на клеточный цикл, и это привело к лучшему пониманию регуляции и функции многочисленных генов. Синхронизация клеток также важна для изучения механизма действия противораковых лекарств, поскольку известно, что химиотерапевтические агенты влияют как на экспрессию генов, так и на кинетику клеточного цикла 6 , 7 . Тем не менее, часто бывает трудно определить, являются ли различия в экспрессии генов, возникающие в результате лечения этими агентами, прямым ответом на лечение или являются просто следствием изменений в профилях клеточного цикла. Чтобы различать эти возможности, экспрессию генов следует анализировать в клетках, которые былиСинхронизируется до добавления химиотерапевтического препарата.

За исключением некоторых первичных клеток, таких как недавно выделенные лимфоидные клетки, которые представляют собой гомогенную популяцию клеток, синхронизированную в G0 8 , in vitro установленные клеточные линии асинхронно растут в культуре. При регулярных условиях роста эти асинхронно циклические клетки находятся во всех фазах клеточного цикла, но предпочтительно в G1 9 . Следовательно, этот контекст не обеспечивает оптимальный сценарий для анализа функциональных или генных экспрессии в конкретной фазе клеточного цикла ( например, G1, S и т. Д.). Не трансформированные иммортализованные клеточные линии ( например, фибробласты) могут быть синхронизированы с так называемыми физиологическими методами 10 . Эти методы основаны на сохраненных первичных клеточных характеристиках нетрансформированных клеток, таких как ингибирование клеточного контакта и зависимости фактора роста, чтобы продолжить циклирование. УдалениеСыворотки в сочетании с контактным торможением делает нерепрессированные клетки, арестованные в G0 / G1. Однако синхронизированный вход и прогрессирование циклического цикла часто требует субкультуры, которая также включает в себя искусственное отслоение клеток и повторное покрытие 10 . Самое главное, этот метод не подходит для синхронизации трансформированных клеточных линий, подавляющее большинство установленных клеточных линий, которые в настоящее время используются, характеризуется отсутствием клеточного опосредованного клеточным ингибированием роста или ответа на вывод фактора роста. Таким образом, ясно, что для эффективной синхронизации соты в конкретных фазах клеточного цикла требуются альтернативные методы. В общих чертах наиболее часто используемые методы синхронизации основаны на временном химическом или фармакологическом ингибировании одной определенной точки клеточного цикла, как правило, синтезе ДНК или образовании митотического веретена. Ингибирование синтеза ДНК синхронизирует клетки, останавливая их в поздней фазе G1 или ранней S. Это может быть achiПутем добавления таких соединений, как мимозин, ингибитора биосинтеза нуклеотидов 11 , 12 , афидиколина, ингибитора ДНК-полимераз 13 , 14 , гидроксимочевины, ингибитора рибонуклеотидредуктазы 15 , 16 или избыточных количеств тимидина 17 , 18 . С другой стороны, ингибиторы полимеризации микротрубочек, такие как колхицин или нокодазол, способны блокировать образование митотического веретена, приводя к синхронизации клеток на ранней фазе M 19 , 20 , 21 .

В этой работе мы описываем метод, включающий два дополнительных протокола синхронизации, основанных на переходном химическом ингибировании для изучения экспрессии генов, регулируемых клеточным циклом, в мРНКуровень. Этот метод является фундаментальным для определения роли генов клеточного цикла в конкретных процессах клеточного цикла. Кроме того, он обеспечивает общую структуру для изучения влияния противоопухолевых обработок, чтобы точно определить гены, чувствительные к лекарственным средствам, и свести к минимуму неверные истолкования, вызванные нарушениями в прогрессировании клеточного цикла, вызванными этими препаратами.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Сотовая синхронизация, выпуск и мониторинг прогрессирования клеточного цикла

  1. Синтез тимидина и нокодазола (Thy-Noc) и выделение клеток U2OS из митоза
    1. Подготовьте требуемую среду для культивирования клеток. Клетки U2OS обычно выращивают в среде DMEM-глутамина, дополненной 10% (об. / Об.) FBS (необязательно: 1% пенициллин / стрептомицин). Выполните всю подготовку и обработку среды в стерильных условиях и прогрейте дополнительную среду (отныне называемую «полной средой») до 37 ° C перед использованием.
    2. Семена 2 × 10 6 клеток U2OS на 100 мм чашку в 10 мл полной культуральной среды. Чтобы рассчитать количество необходимых блюд, учтите, что каждая 100-миллиметровая чашка обычно обеспечивает достаточное количество митотических клеток для повторной тарелки приблизительно 5 лунок 6-луночного планшета (0,2 - 0,25 × 10 6 клеток / лунка) (см . Рис. 1В ). Две лунки за выбранный момент времени являются обязательными(1 лунка для экстракции РНК и 1 лунка для мониторинга клеточного цикла). Кроме того, третья лунка может собираться в течение времени для анализа белка.
      ПРИМЕЧАНИЕ. Пластинчатые ячейки вечером (около 7 вечера), чтобы последующие шаги можно было выполнить в рабочее время в следующие дни. Включите 2 дополнительных лунки асинхронно растущих клеток, чтобы определить параметры компенсации анализа FACS.
    3. Позвольте клеткам присоединить, инкубируя 100 мм посуду при 37 ° C в увлажненной атмосфере с 5% CO 2 в течение 24 часов.
    4. Для тимидинового блока готовят 200 мМ раствора тимидина путем растворения 145,2 мг тимидинового порошка в 3 мл H 2 O (или эквивалентных количеств) и стерилизуют раствор фильтрованием через фильтр размера пор 0,2 мкм. Небольшое потепление может помочь растворить тимидин. Добавьте 100 мкл свежеприготовленного 200 мМ штока в каждую 100-миллилитровую культуральную чашку (конечная концентрация 2 мМ). Инкубировать клетки с тимидином в течение 20 ч при 3776; C в увлажненной атмосфере с 5% CO 2 .
      ПРИМЕЧАНИЕ. Обработайте клетки вечером (около 7 часов вечера), чтобы успеть выполнить как высвобождение тимидина, так и блок-нокодазол на следующий день.
    5. Чтобы высвободить из блока тимидина, удалите тимидин, содержащий среду для роста, во второй половине дня следующего дня (15:00); Дважды промывайте клетки предварительно нагретым 1 × PBS и добавьте 10 мл полной среды к каждой 100-миллиметровой чашке. Инкубируйте клетки в течение 5 ч при 37 ° С в увлажненной атмосфере с 5% СО 2 .
    6. Для остановки митотических клеток добавьте нокодазол до конечной концентрации 50 нг / мл (8 часов). Подготовьте исходный раствор путем растворения порошка нокодазола в ДМСО ( например, 5 мг / мл) и хранить в замороженном состоянии при -20 ° С. Инкубируйте клетки с нокодазолом не более 10-11 часов при 37 ° C в увлажненной атмосфере с 5% CO 2 .
    7. Освобождение от опосредованного нокодазолом ареста в ранней М-фазе (митотическая встряска) и сбор проб в несколько раз поиNts (начиная с 6-7 утра).
      1. Отсоедините округлые (митотические) клетки, встряхивая каждую пластинку и аккуратно пипетируя среду, содержащую нокодазол. Собирайте среду с отдельными ячейками из каждой 100-миллиметровой пластины в 50 мл стерильных пробирок, центрифугируйте (300 xg, 5 минут, комнатную температуру (RT)) и промывайте клетки дважды добавлением 1 × PBS с последующим центрифугированием. Рекомендуется использовать холодный PBS или PBS плюс нокодазол, чтобы избежать митотического проскальзывания (см. Раздел «Обсуждение»).
      2. Ресуспендируют митотические клетки, собранные с каждой 100-миллиметровой пластины в 10 мл полной среды. Сохраните 2 мл для экстракции РНК и 2 мл для анализа FACS для 0-часовой точки (приблизительно 0,2-0,25 × 10 6 клеток на образец).
      3. Остатки митотических клеток с повторной тарелкой для последующих временных точек в 6-луночных планшетах (2 мл / лунка, 0,2-0,25 × 10 6 клеток / лунка).
        ПРИМЕЧАНИЕ. Помните, что для выбранного момента времени требуется 2 лунки (1 для РНК и 1 для анализа FACS).
    8. Собирать образцы на selВремени. Каждые 1,5-3 часа рекомендуется для получения адекватного профиля прогрессирования клеточного цикла.
      1. Для экстракции РНК удалите среду, хорошо промойте 2 мл предварительно нагретого 1x PBS и добавьте 1 мл подходящего реагента для выделения РНК ( например, TRIzol) в лунку (выполните эту последнюю операцию в шкафу безопасности для химических веществ). Пипеткой вверх и вниз, чтобы отсоединить и лизировать клетки, перенести лизат клеток в 1,5 мл микроцентрифужную пробирку, инкубировать 5 минут при комнатной температуре и хранить пробирку при -80 ° C до дальнейшего использования.
      2. Для анализа FACS хорошо промыть 2 мл предварительно нагретого 1x PBS, добавить предварительно нагретый раствор трипсина-ЭДТА (0,3 мл / лунку) для отделения клеток, блокировать трипсин-ЭДТА путем добавления 1 мл полной среды и собирать каждый образец в отдельном 15 мл.
        1. Центрифужные клетки (300 xg, 5 минут, RT), сохраняют клеточный осадок и отбрасывают супернатант. Для того, чтобы фиксировать клетки, повторно суспендировать клетки в 1 мл охлажденного 70% (об. / Об.) Этанола в 1x PBS мягкими вортексирующими трубками и размещать их на льду для приложенияПримерно за 15 мин до хранения при 4 ° С или окрашиванию для дальнейшего анализа с помощью FACS (описано в шагах 1.4-1.5).
  2. HU-синхронизация и выпуск U2OS-клеток из границы G1 / S
    1. Подготовьте полную среду для культивирования клеток, как описано в шаге 1.1.
    2. Семена 0,25 × 10 6 клеток U2OS на лунку в 6-луночных планшетах (2 мл полной культуральной среды на лунку). Чтобы рассчитать количество скважин, необходимых для эксперимента, учтите, что в выбранный момент времени потребуется 1 лунка (1 скважина для извлечения РНК и 1 лунка для мониторинга клеточного цикла), и что 2 дополнительных лунки асинхронно растущих клеток Необходимо определить параметры компенсации анализа FACS.
    3. Позвольте клеткам присоединить, инкубируя 6-луночные планшеты в течение ночи (O / N) при 37 ° C в увлажненной атмосфере с 5% CO 2 .
    4. Удалите всю среду из лунок следующим утром и добавьте 2 млПредварительно нагретой свободной от FBS среды DMEM-глутамина на лунку. Инкубируйте клетки еще 24 часа при 37 ° C в увлажненной атмосфере с 5% CO 2 .
      ПРИМЕЧАНИЕ. Выполните этот шаг во всех лунках, кроме 2 (сохраненных для определения настроек FACS). Шаг снятия сыворотки может быть опущен, если эффективная синхронизация достигается путем простой инкубации клеток с HU.
    5. Остановка клеточного цикла G1 / S с помощью HU.
      1. Перед каждым использованием подготовьте свежий раствор HU (500 мМ). Добавьте 2 мл H 2 O до 76,06 мг порошка HU и перемешайте до полного растворения. Стерилизуют раствор фильтрованием через фильтр размера пор 0,2 мкм. Смешайте 50 мл полной среды с 400 мкл фильтрованного стерилизованного исходного раствора HU для конечной концентрации HU 4 мМ.
      2. Удалите среду из всех лунок, за исключением 2 лунок, необходимых для определения настроек FACS, и замените свежеприготовленной 4 мМ HU-содержащей полной средой (2 мл / лунку).
      3. Инкубируйте клетки в течение 24 ч вHU-среде при 37 ° C в увлажненной атмосфере с 5% CO 2 .
    6. Выделение клеток из HU-опосредованного ареста. Удалите HU-содержащую среду из лунок и дважды промывайте лунки предварительно разогретым 1x PBS (по 2 мл каждый раз). Добавьте 2 мл полной среды на лунку. Соберите 2 образца для 0-часовой временной точки (1 для экстракции РНК и 1 для проверки остановки клеточного цикла FACS), а также 2 сэмпла, сохраненные для настроек FACS. Поместите оставшиеся лунки в инкубатор.
    7. Собирайте образцы каждые 1,5-3 часа, чтобы получить адекватное распределение прогрессии клеточного цикла. В каждый момент времени выполняйте обработку образца (для экстракции РНК и для анализа FACS), как описано в 1.1.8.1-1.1.8.2.
  3. Лечение повреждающими ДНК агентами
    ПРИМЕЧАНИЕ. Всякий раз, когда целью является выяснение влияния соединения ( например, повреждающих ДНК агентов) в событиях клеточного цикла, любой из ранее описанных способов синхронизации может бытьВ сочетании с обработкой клеток генотоксическим агентом. Чтобы выбрать метод синхронизации, важно рассмотреть фазу клеточного цикла, которую мы хотели бы проанализировать. В общем, процедура Thy-Noc может быть подходящей для изучения влияния соединения в фазе G1 или S-фазы, тогда как HU-опосредованная синхронизация может быть более подходящей для изучения воздействия в фазах S-G2 или при входе в митоз.
    1. Анализ влияния генотоксических агентов на фазу G1 или S-фазы
      1. Синхронизировать ячейки, как описано в 1.1.2. До 1.1.6.
      2. Выделите клетки из нокодазола и повторно залейте их, как описано в 1.1.7. Инкубируйте их при 37 ° C в увлажненной атмосфере с 5% CO 2 в течение 3 часов, чтобы они прикреплялись до добавления агента (требуемый период инкубации может варьироваться в зависимости от клеточной линии).
      3. Добавьте агента и собирайте образцы, как описано выше в 1.1.8.
    2. Анализ влияния генотоксических агентов в SG2 фазы или вход M
      1. Синхронизировать ячейки, как описано в 1.2.2. До 1.2.5.
      2. Выпускайте ячейки из HU, как описано в 1.2.6. И немедленно добавить агент.
      3. Соберите образцы, как описано выше в 1.8.
  4. Мониторинг клеточной синхронизации и прогрессирования через клеточный цикл путем окрашивания пропидиум иодидом (PI) и анализа FACS
    ПРИМЕЧАНИЕ. Образцы, собранные во все моменты времени вместе с параметрами, необходимыми для определения настроек FACS, могут храниться при 4 ° C после их исправления (как указано в 1.1.8.2). Выполните окрашивание раствором PI, а затем анализ FACS для всех образцов эксперимента одновременно. PI интеркалирует в основную канавку двухцепочечной ДНК, получая высоко флуоресцентный сигнал при возбуждении при 535 нм с широким пиком излучения около 600 нм. Поскольку PI может также связываться с двухцепочечной РНК, необходимо обработать клетки РНКазой для оптимального разрешения ДНК.
    1. Подготовьте свежеприготовленный раствор для окрашивания PI. Базовый раствор PI может быть получен путем растворения порошка PI в PBS ( например, 5 мг / мл). Храните исходный раствор при 4 ° C (в темноте). Окрашивающий раствор состоит из PI (140 мкМ), цитрата натрия (38 мМ) и Triton X-100 (0,01% об. / Об.).
    2. Разогрейте соответствующую поверхность ( например, духовку) до 37 ° C.
    3. Центрифужные фиксированные клетки (450 xg, 5 минут, RT), декантирующий супернатант (этанол) и промывают один раз 1x PBS.
    4. Центрифужные клетки снова удалите PBS и добавьте 300 мкл PI-окрашивающего раствора на образец (кроме одного из образцов для настроек FACS, вместо этого добавьте PBS к этому образцу).
    5. Перенесите клетки в FACS Tubes (5 мл круглодонные полистирольные трубки).
    6. Добавьте 1 мкл РНКазы А в каждый образец, смешайте и инкубируйте образцы в течение 30 мин в темноте при 37 ° С. Образцы могут храниться защищенными от света при температуре 4 ° C в течение максимум 2 - 3 дней.
    7. Анализ содержания ДНК в образцах по потокуцитометрии. Определите параметры компенсации анализа FACS с асинхронным образцом, окрашенным PI. Используйте пустой образец (без раствора для окрашивания PI), чтобы проверить наличие аутофлуоресценции. Ранее описывался основанный на PI-опосредованный анализ содержания ДНК по проточной цитометрии 9 .
  5. Определение митотического индекса двойным фосфо-H3 (Ser 10) / PI-окрашиванием
    ПРИМЕЧАНИЕ. Клетки, подвергающиеся митозу, могут быть легко обнаружены проточной цитометрией с антителами, специфичными для фосфогистона H3 в серине 10 (pH3). Сопутствующее окрашивание PI полезно для определения распределения популяции клеток на основе содержания ДНК. Для оптимальных конфигураций настроек FACS требуются 5 образцов: пустая, только PI, только pH3, только вторичное антитело и двойное окрашивание.
    1. Центрифужные фиксированные клетки (450 xg, 5 мин, 4 ° C) и отбрасывают супернатант. Следующие этапы описаны для окрашивания в 15 мл пробирках.
    2. Вымойте ячейки, добавив 1Мл PBS-T (PBS + 0,05% Tween-20) в осадок и центрифугу (450 × g, 5 мин, 4 ° C). Удалите супернатант.
    3. Добавить антитело против pH3 (1: 500) в 100-200 мкл PBS-T + 3% BSA и инкубировать с качанием в течение 2 часов при RT (или O / N при 4 ° C).
    4. Добавляют 2 мл PBS-T (PBS + 0,05% Tween-20) и центрифугируют (450 xg, 5 минут, 4 ° C). Удалите супернатант.
    5. Вымойте еще раз, добавив 2 мл PBS-T в гранулу, центрифугируйте и удалите супернатант.
    6. Добавьте вторичное антитело (антитело против кролика AlexaFluor 488 в случае выбранного антитела pH3), разбавленное (1: 500) в 100-200 мкл PBS-T + 3% BSA и инкубируйте с качанием в течение 1 часа при RT (или O / N При 4 ° С). Защитите образцы от света.
    7. Промывают дважды PBS-T (2 мл) центрифугированием, как описано на этапе 1.5.4.
    8. Выполните окрашивание PI, как описано (шаги с 1.4.1 по 1.4.6).

2. Сбор и обработка образцов для анализа экспрессии генов

  1. принимать1,5 мл микроцентрифужных образцов в реакторе изоляции РНК из морозильной камеры и позволяют им оттаивать RT внутри шкафа безопасности для химических веществ.
  2. Добавьте 400 мкл хлороформа в каждый образец и энергично встряхните (но не вихрь) до полного смешивания. Инкубируйте образцы в течение 5 мин при комнатной температуре.
  3. Центрифужные пробирки в течение 15 мин (≥8000 xg, 4 ° C) в настольной микроцентрифуге.
  4. Перенесите водную (верхнюю) фазу в новую 1,5 мл микроцентрифужную пробирку и зарегистрируйте перенесенный объем (для упрощения процедуры рекомендуется собрать равные объемы во всех образцах эксперимента).
  5. Добавьте 1 объем 100% этанола медленно (по каплям) к водной фазе при перемешивании. Не центрифугируйте.
  6. Выполните следующие шаги с помощью коммерческого набора RNA mini prep. Пипетируйте до 700 мкл каждого образца, включая любой осадок, который может образоваться, в спиновую колонку в сборной трубке объемом 2 мл (предоставляется изготовителем).
  7. ЗакройКрышкой и центрифугой (≥ 8000 г, RT) в течение 15 с. Отбросьте поток. Повторите предыдущий шаг с оставшимся образцом (если есть).
  8. Следуйте инструкциям изготовителей для промывки и элюирования РНК (элюируйте каждый образец в 30-40 мкл нуклеазы без H 2 O для достижения соответствующей концентрации РНК для следующей стадии).
  9. Определить концентрацию РНК и чистоту образцов по измерениям поглощения (отношение A 260/280 2,0-2,1 указывает на хорошую чистоту образца РНК). Храните образцы РНК при -80 ° C до использования для анализа RT-qPCR.
  10. Для превращения РНК в кДНК и последующую количественную ПЦР возьмите 1 мкг РНК на образец и подготовьте реакцию ретротранскрипзы согласно инструкциям производителя. Полученные образцы кДНК можно хранить при 4 ° C (в течение нескольких дней) или при -20 ° C (в течение более длительных периодов времени).
    ПРИМЕЧАНИЕ. Подготовка образца, дизайн праймера и другие соображения для ПЦР в реальном времени были выполненыНапряженно описанных в литературе 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Схематическое представление протоколов Thy-Noc и HU для синхронизации соты.

На рисунке 1 приведены шаги, необходимые для синхронизации ячеек U2OS и последующего сбора проб, чтобы проверить прогрессирование через клеточный цикл и выполнить анализ экспрессии генов.

Фосфо-H3 и окрашивание PI являются хорошими параметрами оценки для выбора методов синхронизации.

Процедуры синхронизации клеток должны оцениваться и оптимизироваться для каждой линии клеток из-за присущей гетерогенности культивируемых клеток. Синхронизация в митозе обычно достигается с помощью протокола Thy-Noc, а обогащение митотических клеток после лечения нокодазолом можно оценить с помощью антител, специфичных для фосфорилированного гистона H3 (pH3), типичного митотического маркера. язь Ntification pH3-положительных клеток позволяет различать митотические клетки и клетки с содержанием 4C-ДНК, которые не подвергаются митозу (все они считаются популяцией «G2» окрашиванием PI). В клетках U2OS протокол Thy-Noc приводит к значительному обогащению популяции с содержанием ДНК 4C (рисунок 2A, верхний левый график, синяя популяция окрашиванием PI), а относительная доля митотических клеток в этой популяции была обычно совершенно чистой (приблизительно 91% по сравнению с 2% в асинхронных ячейках). Выделение из нокодазола приводит к синхронному прогрессированию клеток к следующей фазе G1, что определяется накоплением популяции с содержанием ДНК 2C ( рисунок 2A , верхний правый граф, зеленая популяция окрашиванием PI) и почти исчезновение pH3-положительного митотического ( Рис. 2А , нижний правый граф). Таким образом, результаты окрашивания pH3 подтвердили пригодность протокола Thy-Noc для митотической синхронизации клеток U2OS.

E_content "fo: keep-together.within-page =" 1 "> Синхронизация клеток U2OS в G1 / S была протестирована с тимидином и гидроксимочевиной, двумя широко используемыми синхронизаторами. Обогащение в разных фазах клеточного цикла определяли окрашиванием PI и Анализ FACS и процент клеток, суммированных в таблице ( рисунок 2B ). 24-часовая экспозиция клеток U2OS Thy (2 мМ) была неэффективна при остановке клеток на границе G1 / S ( рисунок 2B ), тогда как лечение HU или двойным Раунд тимидина (DT) приводил к удовлетворительной остановке. Однако только клетки, обработанные HU, полностью восстанавливались после остановки и адекватно продвигались через клеточный цикл. Напротив, блок DT индуцировал постоянную остановку G1 в значительной части популяции клеток ( 13,3% клеток в G1 с 6-часовой временной точкой с DT против 3,1% с протоколом на основе HU), что отрицательно влияет на синхронизацию клеток. Таким образом, воздействие HU рекомендуется в качестве подходящей методики синхронизации G1 / SOd для клеток U2OS.

Протоколы Thy-Noc и HU дополняют друг друга для синхронизации соты.

Как показано на рис. 3А (точка времени 0 ч), обработка протоколом Thy-Noc эффективно арестовывала клетки U2OS при входе в М-фазу (популяция с содержанием ДНК 4С, показанная синим цветом) и лечение задержанными клетками HU в графе G1 / S (Популяция с содержанием ДНК 2С, показанная зеленым / красным). При удалении лекарств клетки вводились и прогрессировали через клеточный цикл синхронно. Клетки, восстановленные после лечения Thy-Noc, были впервые обнаружены в ранней фазе G1 (популяция зеленым цветом) и затем последовательно переходили через G1 и до S фазы. Клетки, полученные после лечения HU, прогрессировали синхронно через S (популяция красного цвета) и G2 / M. Прогрессия через следующий клеточный цикл была связана с потерей синхронности. ConsequentlY, моменты времени более 15 часов не были включены в эти анализы из-за потери синхронности после этого момента времени.

Вестерн-блот-анализ Cyclin E1 (циклический цикл G1 / S) и Cyclin B1 (цикл G2 / M), два белка, уровни которых жестко регулируются в клеточном цикле и митотический маркер pH3, подтвердили фазу клеточного цикла каждого Время, проанализированное FACS ( рисунок 3B ). Как и ожидалось, клетки в M-фазе (соответствующие 0-часовой временной точке клеток, кодированных Thy-Noc), и клетки в фазе G2-M (от 9 до 12 часов времени HU-синхронизированной клетки) показали резкое накопление циклина B1 И необнаруживаемые уровни циклина E1. Кроме того, уровни Cyclin B1 были низкими до неопределяемых в фазе G1 (через 3 часа после высвобождения из нокодазола), и наблюдалось постепенное накопление, поскольку клетки прогрессировали через S (после выделения Thy-Noc) и в G2 (после высвобождения HU). Сильная маркировка pH3 клеток через 0 часов на Thy-Noc synchronizatiНа подтверждении обогащения клеток, арестованных при митозе в этот момент времени. Небольшое повышение уровня pH3 через 12 часов после высвобождения из HU показало, что большинство клеток с содержанием ДНК 4C все еще находились в G2, а доля клеток в митозе была увеличена в 15 часов. Напротив, структура экспрессии Cyclin E1 показала прогрессирующее накопление от раннего входа от G1 до S-фазы (процедура Thy-Noc) и постепенное исчезновение в фазе G2 / M (процедура HU).

Экспрессия генов, которые дифференциально регулируются в клеточном цикле, может быть точно проанализирована с помощью комбинации Thy-Noc и HU-синхронизации.

В качестве доказательства концепции, что анализ экспрессии генов, регулируемый клеточным циклом, лучше всего анализируется комбинацией двух методов синхронизации клеток, экспрессии мРНК двух членов семейства E2F, которые, как известно, имеют различную кинетику экспрессии в клеточном цикле(E2F1 и E2F7) анализировали методом ПЦР с обратной транскриптазой (RT-qPCR). С этой целью были использованы протоколы синхронизации Thy-Noc и HU, как показано на рисунке 1 , и распределение клеточного цикла контролировалось с помощью проточной цитометрии, как показано на рисунке 3A . На рисунке 4 показаны E2F1 (верхние два графика) и профили мРНК E2F7 (нижние два графика) через клеточный цикл. Профиль регуляции транскрипции гена, кодирующего E2F1, лучше всего наблюдался с помощью процедуры Thy-Noc, в результате чего экспрессия E2F1 начала постепенно увеличиваться с ранней фазы G1 до достижения пика на поздней фазе G1 (через 9 ч после выхода Thy-Noc, зеленый фон). После этого его уровни уменьшались, одновременно с вступлением в фазы S и G2 (красный и синий фон). Напротив, кинетика экспрессии генов E2F7 была лучше всего обнаружена после синхронизации на основе HU (нижний граф, красный фон) с пиковым выражением через 6 часов после высвобождения (что соответствует фазовому переходу S-G2). Thy-NocПроцедура, с другой стороны, была пригодна для наблюдения за индукцией E2F7, но не для ее подавления. Следует отметить, что расширение анализа за пределами 15 часов воспроизводило профили экспрессии мРНК E2F1 и E2F7 более ранних временных точек, хотя и с уменьшенным диапазоном изменения мРНК (данные не показаны). В целом эти результаты подтверждают важность работы с правильно синхронизированной популяцией клеток для оценки не только кинетики экспрессии генов, но и точной амплитуды изменений уровней мРНК.

Синхронизация клеток обеспечивает лучшее понимание программы экспрессии генов, воздействующей на противораковую терапию.

Чтобы проанализировать влияние противоопухолевого препарата митомицина С (MMC) на динамику клеточного цикла, а также на экспрессию генов, клетки U2OS были сначала синхронизированы с HU и затем обработаны MMC. Воздействие этого генотоксического агента активировало checkpoinT в фазе G2, что было очевидно после 15 часов экспозиции ( рис. 5A , нижняя строка, синий пик). Напротив, необработанные клетки нормально прогрессировали через G1 в этот момент времени ( Рисунок 5A , верхняя строка, зеленый пик). Долгосрочная MMC-обработка (36 ч) выявила постоянную остановку клеток в фазе G2, в то время как клетки без MMC-терапии продемонстрировали распределение клеточного цикла, которое было аналогично распределению асинхронной клетки.

E2F1 и p21 Cip1 (CDKN1A) были выбраны для анализа экспрессии генов в клетках, обработанных MMC ( фиг. 5B ), с учетом их зависимости от клеточного цикла. Экспрессия E2F1 зависит от фазы G1, как описано на рисунке 4 , тогда как индукция экспрессии p21 Cip1 связана с активацией 24 остановки клеточного цикла / контрольной точки. Как показано на рисунке 5B (верхний левый график), экспрессия гена E2F1 kiNetics были схожи в присутствии или отсутствии MMC, поскольку клетки прогрессировали через G1 / S и в S-фазу. Различия в экспрессии гена E2F1 среди обработанных и необработанных клеток, обработанных MMC, наблюдались через 15 часов воздействия MMC, в результате чего клетки, обработанные MMC, выражали более низкие уровни мРНК E2F1, чем контрольные клетки ( рисунок 5B , сравнивают сплошные и пунктирные линии). Однако, несмотря на явное различие в выражении, нельзя сделать вывод, что MMC подавляет экспрессию E2F1, поскольку профили клеточного цикла обработанных MMC и необработанных клеток в этих более поздних временных точках явно отличаются друг от друга, благодаря устойчивой остановке фазы G2, введенной MMC. Фактически, низкие уровни мРНК E2F1 после 15-часовой временной точки в клетках, подверженных воздействию ММС, вероятно, отражают эффект препарата в динамике клеточного цикла, а не эффект MMC в регуляции транскрипции E2F1.

В отличие от E2F1, p21 Cip1 является MMC-чувствительным геном. Повышенные уровни p21 Cip1 были обнаружены при HU-наложенной остановке G1 / S, указывая на активацию контрольной точки G1 с помощью HU ( рис. 5B , временная точка 0 часов), и после этого ее экспрессия уменьшалась в не обработанных MMC клетках, что соответствовало прогрессированию невозмущенного клеточного цикла после освобождения из арестовывать. Напротив, обработка MMC приводила к повышенным уровням мРНК p21 Cip1 ( рисунок 5B , верхний правый график, сплошная линия), в то время как клетки накапливались в фазе G2 (9 часов воздействия MMC). Несмотря на то, что профили клеточного цикла были одинаковыми в 9-часовой момент времени в контрольных и обработанных MMC клетках, анализ экспрессии генов показывает фундаментальное различие. Открытые клетки MMC отображали активированную контрольную точку G2, о чем свидетельствует индукция экспрессии p21 Cip1 , тогда как необработанные клетки подвергались невозмущенному переходу через G2 с низкими уровнями p21 Cip1 .

Данные, полученные методом проточной цитометрии ( FiGure 5A) и данные, полученные из RT-qPCR ( рис. 5B , верхние графики), были объединены в один граф для каждого из выбранных генов ( рис. 4B , более низкие графики). МРНК, где показана относительная высота полос, в то время как распределение клеточного цикла клеток для каждого образца было проиллюстрировано пропорцией цветов: зеленый для фазы G1 (содержание ДНК 2C), синий для фазы G2 (содержание ДНК 4C) и красный Для S-фазы (промежуточное содержание ДНК). Этот комбинированный метод графического представления может быть полезен для интерпретации распределения клеточного цикла и анализа экспрессии генов.

Таким образом, анализ экспрессии генов, связанный с методом синхронизации культуры, позволил идентифицировать ген, чувствительный к генотоксическим агентам (p21 Cip1 ), и предложил предположить, что изменения, наблюдаемые в экспрессии E2F1 между клетками, обработанными и необработанными агентом, были косвенными, иВозможно, связано с различиями в распределении клеток клеточного цикла.

Рисунок 1
Рисунок 1: Обзор двух дополнительных протоколов синхронизации сотовой ячейки: тимидин-нокодазол и гидроксимочевина. ( A ) Графическое представление клеточного цикла млекопитающих, указывающее точки, в которых остановка клеточного цикла достигается методами клеточной синхронизации. Процедура Thy-Noc блокирует клетки в раннем митозе (M), в то время как HU блокирует клетки на границе G1 / S. ( B ) Схематическое представление протокола Thy-Noc синхронизации соты. Показаны этапы, обычно используемые для анализа генной экспрессии и мониторинга клеточного цикла в клетках U2OS. ( C ) Схематическое представление протокола синхронизации ячеек на основе HU. Показаны этапы, обычно используемые для анализа экспрессии генов и мониторинга клеточного цикла в U2OS. Более короткая процедура синхронизации, исключающая голодание в сыворотке, также может применяться, если оптимальная синхронизация уже достигнута посредством 24-часовой экспозиции HU. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2
Рисунок 2: Оценка подходящих методов синхронизации. ( A ). Синтезированные асинхронные и Thy-Noc культуры клеток U2OS подвергали окрашиванию pH3 для оценки фракции митотических клеток в каждом случае. Одновременное окрашивание PI позволило контролировать содержание ДНК в клетках. В асинхронной популяции только минимальная доля клеток с содержанием ДНК 4C (синим цветом) была положительной для маркера митоза. Напротив, протокол Thy-Noc эффективно accuКлеточных клеток в митозе (положительный для окрашивания pH3) и позволил должным образом перейти к следующей фазе G1 (в зеленом цвете) после удаления нокодазола (3-часовой момент времени). Процент клеток в каждой фазе суммируется в таблице и помечен цветами в соответствии с цветами, используемыми в гистограммах PI: зеленый для клеток содержания ДНК 2C (G1), синий для клеток с содержанием ДНК 4C (включая клетки G2 и M и назван в качестве G2 на гистограммах, чтобы упростить фигуру, и красный для клеток с промежуточным содержанием ДНК (S). ( B ) Оценены тимидин и HU для их эффективности синхронизации клеточного цикла в клетках U2OS. Клетки обрабатывали тимидином (один или два Раундов) или с HU в течение 24 часов, а синхронизация клеток была исследована путем окрашивания PI и анализа FACS. Саммит использовался для анализа данных FACS. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 3
Рисунок 3: Обобщение временной рамки для равномерного прогрессирования клеток после Thy-Noc- и HU-опосредованной синхронизации. ( A ) ячейки U2OS были синхронизированы в M-фазе протоколом Thy-Noc (верхняя строка) или в переходе G1 / S по протоколу HU (нижняя строка). Прогрессирование клеточного цикла контролировали окрашиванием PI и FACS-анализом содержания ДНК в клетках каждые 3 часа после высвобождения из химических веществ. Саммит был использован для анализа данных FACS. Клетки, высвобожденные из опоры, опосредованной Thy-Noc, вводились синхронно в ранней фазе G1 через 3 часа и прогрессировали равномерно до S-фазы в последующие моменты времени. Клетки, высвобожденные из HU-опосредованной остановки, синхронно переходили через фазы S и G2. Клетки, собранные через 15 часов после выпуска, представляли пределы для синхронизации клеток, поскольку переход к следующей фазе был достигнутD на долю населения. ( B ) Контроль соты контролировали вестерн-блот-анализом путем сбора образцов белка каждые 3 ч и до 15 ч после выпуска. Кинетика экспрессии Cyclin E1 (CCNE1), циклин, преимущественно накапливаемая через S-фазу, cyclin B1 (CCNB1), в основном присутствующая от фазы G2 до M и pH3, маркер для митотических клеток, профили распределения активного цикла, наблюдаемые с помощью проточной цитометрии. Actin B (ACTB) использовался в качестве контроля эндогенной нагрузки, поскольку его уровни не зависят от клеточного цикла. (Как модифицировано Mitxelena et al ., 8 ). Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 4
Рисунок 4: Исследование фазовых зависимостей клеточного цикла T Транскрипция членов семейства E2F с помощью методов комплементарной сотовой синхронизации. Клетки U2OS были арестованы в G2 / M протоколом Thy-Noc или в G1 / S обработкой HU, и образцы были собраны для экстракции РНК и анализа FACS каждые 3 часа до 15 ч после освобождения после остановки. Анализ экспрессии генов методом RT-qPCR показал профиль экспрессии E2F1, описанный главным образом в G1 (верхний левый график), в то время как профиль экспрессии гена E2F7 был сдвинут в S-фазу с постепенным понижением уровня через фазу G2 (нижний правый граф). TBP использовали в качестве эндогенного неселективного цикла, регулируемого циклом, для расчета относительных изменений уровней мРНК, и результаты были представлены как средние значения и стандартное отклонение (SD). Прогрессирование через клеточный цикл определяли окрашиванием PI и FACS-анализом содержания ДНК в клетках. Фазы клеточного цикла были представлены в виде фоновых цветов на графиках: черный (остановка при раннем митозе), зеленый (фаза G1), красный (S-фаза) и синий (фаза G2)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Пожалуйста , нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 5
Рисунок 5: Влияние MMC на экспрессию генов и прогрессирование клеточного цикла. Клетки U2OS обрабатывали HU в течение 24 часов, а MMC (250 нМ) добавляли сразу же после высвобождения из HU-опосредованной остановки G1 / S. Образцы для анализа FACS и анализа экспрессии генов были собраны в указанные моменты времени. ( A ) Прогрессирование через клеточный цикл определяли путем окрашивания PI и анализа FACS содержания ДНК с помощью программного обеспечения Summit. MMC вызвала умеренную задержку прогрессирования через S-фазу (красная популяция) и постоянный арест в фазе G2 (синяя популяция), о чем свидетельствует отсутствие клеток в G1 (зеленая популяция) после 15 часов лечения (нижняя строка) по сравнению Не-(Верхние ряды). ( B ) Анализ экспрессии гена E2F1 и p21 Cip1 в обработанных или необработанных клетках MMC проводили на уровне мРНК с помощью RT-qPCR. Oxa1L использовали в качестве эндогенного не-MMC-чувствительного гена, и результаты были представлены как средние значения и SD. Верхние графы представляют относительные уровни мРНК выбранных генов после высвобождения из HU и добавления MMC. Нижние графики объединяют данные, полученные с помощью анализа FACS и RT-qPCR. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Анализ тонкоизмельченных регулируемых генов, участвующих в переходных и специфических ролях в клеточном цикле, требует однородной клеточной популяции. Многие исследователи обычно используют длинные линии опухолевых клеток для этих целей, и были разработаны различные методы для получения синхронных (или частично синхронных) клеточных популяций с целью накопления как можно большего количества клеток в определенных фазах клеточного цикла. Кроме того, были предприняты активные усилия для улучшения и оптимизации хорошо установленных подходов к синхронизации. Тем не менее, все протоколы синхронизации имеют недостатки, которые могут быть связаны с гетерогенностью культур клеток, с субоптимальной эффективностью процедур синхронизации или с дополнительными эффектами, которые химические синхронизаторы имеют в функции клеток, среди прочих. Эти ограничения должны приниматься во внимание при применении протоколов синхронизации соты. Исследователям необходимо определить наиболее подходящие методы синхронизации для их конкретныхТипа или эксперимента. Даже культивируя разные линии клеток точно так же, возникающие в результате скорости синхронизации могут отличаться по нескольким причинам. С одной стороны, длина клеточного цикла может варьироваться в зависимости от выбранной клеточной линии; С другой стороны, тот же самый ингибитор может оказывать контрастное действие на разные клеточные линии из-за особых характеристик каждой клеточной линии 25 . Кроме того, выбранную концентрацию ингибитора и время воздействия необходимо всегда корректировать для каждой клеточной линии, чтобы избежать или минимизировать нежелательную побочную токсичность 26 . Даже после оптимизации всех этих аспектов 100% накопление клеток в данной фазе клеточного цикла никогда не достигается, а асинхронность постепенно увеличивается после удаления химического вещества 27 . Таким образом, важно понимать, что методы синхронизации в лучшем случае обеспечивают частичное обогащение популяции клеток в определенный временной интервал.

В этом w Ork две процедуры синхронизации (Thy-Noc и HU) были оптимизированы для их использования в ячейках U2OS, оба из которых широко используются для анализа синхронизации клеток 28 , 29 , 30 . Для фиксации клеток в М-фазе комбинация тимидина и нокодазола эффективно работала в клетках U2OS. Учитывая цитотоксический характер нокодазола, важно определить время воздействия и дозу этого ингибитора, чтобы получить не только высокосинтетированную популяцию клеток, но и оптимальную выживаемость клеток. До воздействия тимидина (или, теоретически, любого другого подобного соединения, такого как гидроксимочевина) приводило к обогащению популяции клеток в фазах G1 и S, тем самым уменьшая требуемое время воздействия нокодазола. Для фиксации клеток в G1 / S были рассмотрены несколько возможностей, включая двойной тимидиновый блок, метод, который очень эффективен при синхронизации нескольких клеточных линий"> 31 , 32. Однако тимидин был отброшен с учетом его неутешительных результатов в U2OS. Один раунд лечения тимидином только арестовал фракцию клеток, тогда как два раунда лечения тимидином эффективно блокировали большинство клеток в G1 / S, но G1 Популяция поддерживалась после высвобождения из тимидина, а прогрессирование клеточного цикла не происходило равномерно. Напротив, обработка гидроксимочевиной обеспечивала хорошие результаты блокирования G1 / S и равномерное прогрессирование клеток через S и в G2.

Распределение фаз клеточного цикла следует исследовать при проведении экспериментов по синхронизации клеток ( например, путем окрашивания пропидиум иодидом или маркировки pH3 с последующим анализом FACS или путем иммуноблоттинга фазовых белков клеточного цикла) 16 , 33 , 34 , чтобы лучше интерпретировать экспрессию гена Результаты. Неправильная эффективность синхронизацииNcy или небольшие межэкспериментальные различия в прогрессии через клеточный цикл могут привести к неправильным выводам. Например, лечение нозоказолом, как известно, вызывает определенные нарушения функции митотической контрольной точки при определенных условиях. Это приводит к популяции клеток с содержанием ДНК 4C, но отрицательным для митотических маркеров 34, который «скользит» с митотическим делением и возвращается к интерфазе с содержанием 4C 35 . Появление этого подмножества клеток, которое может быть обнаружено путем иммуноокрашивания антителами против фосфо-H3 (см . Фиг. 2A ), может быть сведено к минимуму за счет использования холодного PBS для этапов промывки нокодазолом. Другим эффектом, связанным с использованием химических ингибиторов, которые влияют на синхронизацию клеток, является активация контрольных точек, связанная с воздействием этих соединений 36 , 37 , механизм, посредством которого клетка активно останавливает прогрессирование через клеточный цикл до тех пор, пока он не сможетУбедитесь, что процессы, предшествующие этой точной точке (например, правильная репликация ДНК, узел шпинделя), разрешены 38 . Для того чтобы метод синхронизации был адекватным, арест должен быть не только эффективным, но и полностью обратимым. Таким образом, после выпуска ингибиторов клеточного цикла важно проанализировать, были ли возвращены эффекты ингибитора, например, путем анализа экспрессии маркеров контрольных точек, таких как p21 CIP . На фиг.5В показано, что синхронизированные с гидроксимочевиной клетками U2OS эффективно разрешали контрольную точку, поскольку уровни p21 CIP были снижены до основной экспрессии после высвобождения.

В клетках U2OS проценты обогащения после остановки клеточного цикла находятся в диапазоне, о котором сообщают другие исследования по синхронизации клеток 29 , 30 , 39 : около 85% клеток с содержанием ДНК 4C (окрашивание PI) и аппроксимациейУ 90% пациентов с митозом (с положительной оценкой pH3) при лечении тимидин-нокодазолом и около 80-90% клеток G1 / S после лечения гидроксимочевиной. Освобождение от остановки клеточного цикла обычно приводит к надлежащему прогрессированию через одну или две фазы равномерным образом, хотя синхронизация неизменно теряется через несколько часов, и клетки не могут завершить полный цикл деления клеток синхронно. Поэтому, чтобы получить полную картину всех фаз клеточного цикла, протокол, предложенный в этой работе, использует два метода синхронизации из разных частей клеточного цикла. Как показано на рисунке 3A , каждый отдельный протокол не обеспечивал синхронизацию в течение всего клеточного цикла. Синхронизация на основе Thy-Noc обеспечивала соответствующий кадр для процессов, происходящих в фазах G1-S, в то время как ячейки, высвобождаемые из HU, были пригодны для анализа событий, происходящих во время S и G2 / M. Дополняемость выбранных двух процедурБыли продемонстрированы анализом двух членов семейства транскрипционных факторов E2F ( рисунок 4 ), подтверждающих идею о том, что сочетание двух методов, которые синхронизируются в разных фазах клеточного цикла, является мощным подходом к точному установлению экспрессии гена, регулируемого клеточным циклом Образцами и лучше понимать их физиологическую роль.

Принудительное применение процедур синхронизации соты фокусируется на оценке влияния потенциальных терапевтических агентов. Эффект фармацевтических соединений, таких как противоопухолевая активность, часто изучается в популяциях асинхронных клеток. В этих условиях можно определить импликацию выбранного препарата при индукции нескольких процессов, таких как гибель клеток, остановка клеточного цикла или старение 7 , 40 . Однако выбор асинхронных настроек ячейки для идентификации точных молекулярных событий, регулирующихТакие процессы могут привести к неполным или частично неправильным выводам. Этот момент, который часто упускается из виду, был проиллюстрирован в настоящей работе, анализируя влияние химиотерапевтического лекарственного средства MMC на экспрессию гена E2F1 и p21 Cip1 ( рисунок 5 ). В целом, комбинация синхронизации и лечения клеток генотоксическими агентами обеспечивает подходящий контекст для изучения экспрессии генов, которые реагируют на генотоксический агент, и для того, чтобы отличать от тех, кто страдает от возмущений клеточного цикла, наложенных агентом.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Мы благодарим членов лабораторий Zubiaga и Altmeyer за полезные обсуждения и техническую поддержку. Эта работа была поддержана грантами испанского министерства (SAF2015-67562-R, MINECO / FEDER, UE), правительством Басков (IT634-13 и KK-2015/89) и Университетом Страны Басков UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Изучение экспрессии генов, регулируемых клеточным циклом, двумя протоколами синхронизации комплементарных ячеек
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter